Starting /dee2/code/volunteer_pipeline.sh SRR6958416 current disk space = 1548592193536 free memory = 1599669288 SRR6958416 SRAfilesize 835f282b3b2fbac320f6eaaaf3da10ec SRR6958416.sra SRR6958416.sra file validated SRR6958416 is paired end SRR6958416 is conventional basespace SRR6958416 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958416_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.4535 18.0 18.0 31.0 18.0 33.0 2 26.141 27.0 18.0 32.0 18.0 33.0 3 29.80375 31.0 28.0 33.0 27.0 33.0 4 29.99725 31.0 29.0 33.0 25.0 33.0 5 31.34275 33.0 32.0 33.0 28.0 33.0 6 35.62325 37.0 36.0 38.0 31.0 38.0 7 35.706 38.0 36.0 38.0 31.0 38.0 8 36.534 38.0 37.0 38.0 34.0 38.0 9 36.931 38.0 38.0 38.0 35.0 38.0 10-14 37.28675 38.0 38.0 38.0 36.6 38.0 15-19 37.1562 38.0 38.0 38.0 36.0 38.0 20-24 37.12975 38.0 38.0 38.0 36.0 38.0 25-29 37.00285 38.0 38.0 38.0 35.8 38.0 30-34 36.832 38.0 38.0 38.0 35.0 38.0 35-39 36.87370000000001 38.0 38.0 38.0 35.2 38.0 40-44 36.94045 38.0 38.0 38.0 35.2 38.0 45-49 36.83945 38.0 38.0 38.0 35.0 38.0 50-54 36.406850000000006 38.0 38.0 38.0 33.8 38.0 55-59 36.424800000000005 38.0 37.6 38.0 33.6 38.0 60-64 36.75675 38.0 38.0 38.0 34.6 38.0 65-69 36.68705 38.0 38.0 38.0 34.4 38.0 70-74 36.3008 38.0 37.6 38.0 33.4 38.0 75-79 35.989549999999994 38.0 37.0 38.0 32.0 38.0 80-84 35.73325 38.0 36.8 38.0 30.6 38.0 85-89 36.0317 38.0 37.0 38.0 33.0 38.0 90-94 35.84245 38.0 36.8 38.0 32.0 38.0 95-99 35.518950000000004 38.0 36.0 38.0 30.4 38.0 100-104 34.8323 38.0 35.0 38.0 27.0 38.0 105-109 34.45095 38.0 34.6 38.0 24.8 38.0 110-114 34.218650000000004 38.0 34.2 38.0 23.6 38.0 115-119 34.1137 38.0 34.0 38.0 23.8 38.0 120-124 34.03445 38.0 34.0 38.0 23.2 38.0 125-129 34.0496 38.0 34.4 38.0 23.4 38.0 130-134 33.8112 38.0 33.8 38.0 21.4 38.0 135-139 33.0815 37.6 33.2 38.0 18.6 38.0 140-144 31.848200000000002 36.0 30.8 38.0 13.4 38.0 145-149 30.292199999999998 35.4 29.0 38.0 8.6 38.0 150-151 26.25175 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 3.0 17 4.0 18 9.0 19 5.0 20 7.0 21 5.0 22 11.0 23 12.0 24 21.0 25 26.0 26 26.0 27 42.0 28 49.0 29 58.0 30 89.0 31 125.0 32 161.0 33 223.0 34 324.0 35 574.0 36 1125.0 37 1096.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.84189512909236 10.912962470055895 6.5211605003992545 40.723981900452486 2 24.375 13.625000000000002 27.900000000000002 34.1 3 23.95 13.375 23.575 39.1 4 26.174999999999997 17.775 20.724999999999998 35.325 5 29.299999999999997 21.575 23.849999999999998 25.275 6 26.35 28.775000000000002 22.475 22.400000000000002 7 19.950000000000003 23.35 36.05 20.65 8 22.75 23.875 27.950000000000003 25.424999999999997 9 22.1 21.025 32.675 24.2 10-14 24.505 25.165 25.380000000000003 24.95 15-19 24.03 23.48 25.585 26.905 20-24 24.16 24.02 25.34 26.479999999999997 25-29 24.895 24.04 24.755 26.31 30-34 24.18 23.825 25.369999999999997 26.625 35-39 24.315 24.575 24.81 26.3 40-44 24.65 24.075 24.740000000000002 26.534999999999997 45-49 24.610000000000003 23.919999999999998 25.330000000000002 26.14 50-54 24.52 23.895 25.319999999999997 26.265 55-59 24.335 23.94 25.45 26.275 60-64 23.974999999999998 24.035 25.465 26.525 65-69 25.055 24.095 24.625 26.224999999999998 70-74 24.735 24.38 24.805 26.08 75-79 24.805 23.735 25.264999999999997 26.195 80-84 24.635 24.3 24.7 26.365 85-89 24.865000000000002 23.87 24.52 26.745 90-94 25.56 23.415 24.43 26.595000000000002 95-99 24.765 24.295 24.675 26.265 100-104 25.36 23.580000000000002 24.87 26.19 105-109 25.71 24.16 23.880000000000003 26.25 110-114 24.825 24.415 24.705 26.055 115-119 25.41 24.355 23.974999999999998 26.26 120-124 24.7 24.545 24.43 26.325 125-129 24.740000000000002 25.115 24.27 25.874999999999996 130-134 24.759999999999998 24.705 23.985 26.55 135-139 25.355 24.77 23.794999999999998 26.08 140-144 24.240000000000002 24.87 23.82 27.07 145-149 24.58 25.2 23.97 26.25 150-151 24.3125 24.4375 24.2875 26.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 0.5 27 1.0 28 3.5 29 6.0 30 7.0 31 6.0 32 7.0 33 12.5 34 17.0 35 23.5 36 35.5 37 49.0 38 64.0 39 73.0 40 80.5 41 109.5 42 148.0 43 172.5 44 188.0 45 187.5 46 173.5 47 177.0 48 188.5 49 184.0 50 164.0 51 141.0 52 135.0 53 125.5 54 113.5 55 103.0 56 94.5 57 98.5 58 85.0 59 87.5 60 101.5 61 86.0 62 69.5 63 73.0 64 75.0 65 70.5 66 66.5 67 62.0 68 63.0 69 52.5 70 39.5 71 36.5 72 33.5 73 29.0 74 24.5 75 17.0 76 10.0 77 9.0 78 9.5 79 6.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19171507956554 98.175 2 0.7830260166708766 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAACGCTTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 9 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.6749999999999998 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.4124999999999996 0.0 0.0 0.0 0.0 108-109 3.9749999999999996 0.0 0.0 0.0 0.0 110-111 4.75 0.0 0.0 0.0 0.0 112-113 5.2625 0.0 0.0 0.0 0.0 114-115 5.9125 0.0 0.0 0.0 0.0 116-117 6.775 0.0 0.0 0.0 0.0 118-119 7.65 0.0 0.0 0.0 0.0 120-121 8.3875 0.0 0.0 0.0 0.0 122-123 9.0375 0.0 0.0 0.0 0.0 124-125 9.837499999999999 0.0 0.0 0.0 0.0 126-127 10.8625 0.0 0.0 0.0 0.0 128-129 11.8625 0.0 0.0 0.0 0.0 130-131 12.6625 0.0 0.0 0.0 0.0 132-133 13.5375 0.0 0.0 0.0 0.0 134-135 14.325 0.0 0.0 0.0 0.0 136-137 15.3 0.0 0.0 0.0 0.0 138-139 16.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958416 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958416_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4035 33.0 33.0 34.0 32.0 34.0 2 32.49025 33.0 33.0 34.0 31.0 34.0 3 32.32125 33.0 33.0 34.0 31.0 34.0 4 32.267 33.0 33.0 34.0 31.0 34.0 5 32.38375 33.0 33.0 34.0 31.0 34.0 6 36.1955 38.0 38.0 38.0 33.0 38.0 7 36.3325 38.0 38.0 38.0 33.0 38.0 8 36.238 38.0 38.0 38.0 33.0 38.0 9 35.7615 38.0 38.0 38.0 31.0 38.0 10-14 36.2541 38.0 38.0 38.0 33.4 38.0 15-19 36.4972 38.0 38.0 38.0 34.2 38.0 20-24 36.6007 38.0 38.0 38.0 34.6 38.0 25-29 36.4379 38.0 38.0 38.0 34.2 38.0 30-34 36.529700000000005 38.0 38.0 38.0 34.6 38.0 35-39 36.302550000000004 38.0 38.0 38.0 34.0 38.0 40-44 36.08485 38.0 38.0 38.0 33.2 38.0 45-49 36.1049 38.0 38.0 38.0 33.0 38.0 50-54 36.095600000000005 38.0 37.8 38.0 33.2 38.0 55-59 36.1745 38.0 38.0 38.0 33.6 38.0 60-64 35.86925 38.0 37.6 38.0 32.0 38.0 65-69 35.6211 38.0 37.0 38.0 30.8 38.0 70-74 35.386649999999996 38.0 37.0 38.0 29.4 38.0 75-79 35.2972 38.0 36.6 38.0 29.0 38.0 80-84 35.16145 38.0 36.6 38.0 28.2 38.0 85-89 35.23004999999999 38.0 36.4 38.0 28.8 38.0 90-94 34.81575 38.0 35.8 38.0 27.0 38.0 95-99 34.287850000000006 38.0 34.8 38.0 22.8 38.0 100-104 33.87395 38.0 34.4 38.0 21.4 38.0 105-109 33.945100000000004 38.0 34.4 38.0 22.2 38.0 110-114 33.607150000000004 38.0 34.0 38.0 19.0 38.0 115-119 32.9078 37.6 32.4 38.0 17.6 38.0 120-124 32.6822 37.6 33.0 38.0 15.0 38.0 125-129 31.943099999999998 36.8 31.4 38.0 14.0 38.0 130-134 31.049149999999997 36.0 30.4 38.0 13.0 38.0 135-139 30.08885 35.8 27.0 38.0 13.0 38.0 140-144 28.9351 34.4 24.4 38.0 2.0 38.0 145-149 26.808550000000004 33.2 15.4 38.0 2.0 38.0 150-151 20.603375 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 6.0 4 2.0 5 3.0 6 4.0 7 5.0 8 3.0 9 3.0 10 5.0 11 7.0 12 3.0 13 6.0 14 5.0 15 12.0 16 6.0 17 12.0 18 9.0 19 6.0 20 18.0 21 16.0 22 15.0 23 30.0 24 34.0 25 32.0 26 48.0 27 59.0 28 66.0 29 90.0 30 98.0 31 143.0 32 170.0 33 230.0 34 323.0 35 471.0 36 888.0 37 1156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.70655983975964 19.379068602904358 11.967951927891837 30.946419629444165 2 27.825 24.05 25.674999999999997 22.45 3 22.875 25.874999999999996 25.974999999999998 25.275 4 27.125 29.95 20.5 22.425 5 28.000000000000004 31.574999999999996 20.150000000000002 20.275000000000002 6 25.324999999999996 33.1 20.025000000000002 21.55 7 23.3 20.4 32.15 24.15 8 24.55 23.275000000000002 23.5 28.675 9 24.925 23.325000000000003 24.775 26.974999999999998 10-14 26.279999999999998 25.740000000000002 22.21 25.77 15-19 26.314999999999998 24.955 23.325000000000003 25.405 20-24 26.19 25.21 22.805 25.795 25-29 26.415 24.685000000000002 23.494999999999997 25.405 30-34 25.985000000000003 24.779999999999998 23.525 25.71 35-39 25.94 25.34 22.985 25.735000000000003 40-44 26.795 24.175 23.375 25.655 45-49 26.795 24.89 23.47 24.845 50-54 26.27 25.515 23.175 25.040000000000003 55-59 27.02 24.03 23.005 25.945 60-64 26.284999999999997 24.555 23.285 25.874999999999996 65-69 26.555 24.654999999999998 23.62 25.169999999999998 70-74 26.240000000000002 25.14 23.32 25.3 75-79 26.565 24.46 23.65 25.324999999999996 80-84 26.745 25.074999999999996 23.064999999999998 25.115 85-89 26.43 24.625 23.400000000000002 25.545 90-94 26.540000000000003 24.875 23.294999999999998 25.290000000000003 95-99 26.505000000000003 25.415 23.244999999999997 24.834999999999997 100-104 27.21 25.040000000000003 23.369999999999997 24.38 105-109 27.46 25.040000000000003 23.06 24.44 110-114 26.87 25.825 23.015 24.29 115-119 27.72 25.6 22.955000000000002 23.724999999999998 120-124 27.96 24.995 23.275000000000002 23.77 125-129 29.03 25.665 22.535 22.770000000000003 130-134 28.754999999999995 25.865 22.795 22.585 135-139 28.549999999999997 25.455 23.365 22.63 140-144 29.294999999999998 25.85 22.775000000000002 22.08 145-149 30.264999999999997 25.405 23.22 21.11 150-151 30.975 26.1 22.3375 20.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 2.0 30 4.5 31 5.5 32 6.0 33 10.5 34 13.0 35 21.0 36 32.0 37 45.0 38 59.0 39 72.5 40 91.5 41 119.5 42 140.5 43 144.5 44 169.5 45 182.5 46 181.5 47 185.0 48 173.5 49 161.0 50 145.5 51 148.5 52 147.5 53 125.5 54 112.0 55 111.5 56 113.5 57 102.0 58 97.5 59 89.5 60 84.5 61 82.0 62 76.5 63 74.0 64 74.5 65 80.5 66 73.5 67 66.0 68 66.5 69 62.5 70 50.5 71 41.5 72 34.5 73 33.5 74 29.0 75 16.0 76 12.5 77 9.5 78 3.0 79 3.0 80 3.0 81 2.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88551165146909 97.6 2 0.911854103343465 1.7999999999999998 3 0.2026342451874367 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.4749999999999996 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.475 0.0 0.0 0.0 0.0 108-109 4.05 0.0 0.0 0.0 0.0 110-111 4.775 0.0 0.0 0.0 0.0 112-113 5.275 0.0 0.0 0.0 0.0 114-115 5.9 0.0 0.0 0.0 0.0 116-117 6.8375 0.0 0.0 0.0 0.0 118-119 7.7125 0.0 0.0 0.0 0.0 120-121 8.4125 0.0 0.0 0.0 0.0 122-123 9.0375 0.0 0.0 0.0 0.0 124-125 9.7375 0.0 0.0 0.0 0.0 126-127 10.7 0.0 0.0 0.0 0.0 128-129 11.6375 0.0 0.0 0.0 0.0 130-131 12.4375 0.0 0.0 0.0 0.0 132-133 13.2625 0.0 0.0 0.0 0.0 134-135 14.024999999999999 0.0 0.0 0.0 0.0 136-137 14.975000000000001 0.0 0.0 0.0 0.0 138-139 16.012500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980905 spots for SRR6958416.sra Written 980905 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra Read 980890 spots for SRR6958416.sra Written 980890 spots for SRR6958416.sra SRR ids: ['SRR6958416.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zm9bb96y SRR6958416.sra spots: 19617815 blocks: [[1, 980890], [980891, 1961780], [1961781, 2942670], [2942671, 3923560], [3923561, 4904450], [4904451, 5885340], [5885341, 6866230], [6866231, 7847120], [7847121, 8828010], [8828011, 9808900], [9808901, 10789790], [10789791, 11770680], [11770681, 12751570], [12751571, 13732460], [13732461, 14713350], [14713351, 15694240], [15694241, 16675130], [16675131, 17656020], [17656021, 18636910], [18636911, 19617815]] SRR6958416 file size 6626133 SRR6958416 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958416 SRR6958416_1.fastq SRR6958416_2.fastq Input file: SRR6958416_1.fastq Paired file: SRR6958416_2.fastq trimmed: SRR6958416-trimmed-pair1.fastq, SRR6958416-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:36:17 2024 >> started Fri Dec 6 22:36:40 2024 >> done (23.167s) 19617815 read pairs processed; of these: 40386 ( 0.21%) short read pairs filtered out after trimming by size control 110204 ( 0.56%) empty read pairs filtered out after trimming by size control 19467225 (99.23%) read pairs available; of these: 10408444 (53.47%) trimmed read pairs available after processing 9058781 (46.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 7 0.00% 21 4 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 7 0.00% 26 6 0.00% 27 7 0.00% 28 4 0.00% 29 8 0.00% 30 15 0.00% 31 15 0.00% 32 10 0.00% 33 13 0.00% 34 16 0.00% 35 10 0.00% 36 17 0.00% 37 16 0.00% 38 24 0.00% 39 26 0.00% 40 21 0.00% 41 23 0.00% 42 33 0.00% 43 32 0.00% 44 40 0.00% 45 51 0.00% 46 58 0.00% 47 66 0.00% 48 77 0.00% 49 84 0.00% 50 103 0.00% 51 128 0.00% 52 145 0.00% 53 150 0.00% 54 190 0.00% 55 210 0.00% 56 201 0.00% 57 243 0.00% 58 277 0.00% 59 343 0.00% 60 392 0.00% 61 500 0.00% 62 559 0.00% 63 666 0.00% 64 690 0.00% 65 783 0.00% 66 917 0.00% 67 993 0.01% 68 1176 0.01% 69 1347 0.01% 70 1558 0.01% 71 1816 0.01% 72 2121 0.01% 73 2482 0.01% 74 2870 0.01% 75 3237 0.02% 76 3550 0.02% 77 4189 0.02% 78 4330 0.02% 79 5232 0.03% 80 5806 0.03% 81 6818 0.04% 82 7740 0.04% 83 8814 0.05% 84 11320 0.06% 85 12889 0.07% 86 13933 0.07% 87 15182 0.08% 88 16358 0.08% 89 17329 0.09% 90 18733 0.10% 91 20514 0.11% 92 22314 0.11% 93 24457 0.13% 94 26662 0.14% 95 29091 0.15% 96 30582 0.16% 97 32594 0.17% 98 34236 0.18% 99 36436 0.19% 100 38689 0.20% 101 41435 0.21% 102 44193 0.23% 103 46773 0.24% 104 49534 0.25% 105 51891 0.27% 106 54656 0.28% 107 56565 0.29% 108 58498 0.30% 109 61145 0.31% 110 62273 0.32% 111 64740 0.33% 112 67697 0.35% 113 70374 0.36% 114 73627 0.38% 115 76208 0.39% 116 78801 0.40% 117 80054 0.41% 118 81696 0.42% 119 82899 0.43% 120 84924 0.44% 121 86793 0.45% 122 87861 0.45% 123 91132 0.47% 124 94625 0.49% 125 97530 0.50% 126 98522 0.51% 127 101559 0.52% 128 101885 0.52% 129 102697 0.53% 130 104883 0.54% 131 107241 0.55% 132 109763 0.56% 133 113021 0.58% 134 115135 0.59% 135 118533 0.61% 136 121534 0.62% 137 123574 0.63% 138 127046 0.65% 139 131235 0.67% 140 134627 0.69% 141 140033 0.72% 142 148840 0.76% 143 159419 0.82% 144 175069 0.90% 145 197292 1.01% 146 230249 1.18% 147 290169 1.49% 148 410753 2.11% 149 770493 3.96% 150 3956348 20.32% 151 9058781 46.53% 19467225 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.23 sequence-density-rank=7 fanout-score=30.30 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=8.4 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=25 prefix-density=0.39 prefix-fanout=2.6 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=16 fanout-score=65.46 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=10.7 sequence=CCGCCGCCGCCG SRR6958416 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:37:22 Started mapping on | Dec 06 22:37:22 Finished on | Dec 06 22:38:55 Mapping speed, Million of reads per hour | 753.57 Number of input reads | 19467225 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 19026184 Uniquely mapped reads % | 97.73% Average mapped length | 287.46 Number of splices: Total | 20528629 Number of splices: Annotated (sjdb) | 19222514 Number of splices: GT/AG | 20252934 Number of splices: GC/AG | 237871 Number of splices: AT/AC | 8040 Number of splices: Non-canonical | 29784 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.66 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 163817 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 20010 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297541 297541 297541 N_multimapping 163817 163817 163817 N_noFeature 536522 18527729 680699 N_ambiguous 418487 2357 65054 UnstrandedReadsAssigned:18071175 PositiveStrandReadsAssigned:496098 NegativeStrandReadsAssigned:18280431 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=141 echo kmer=137 SRR6958416 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958416-trimmed-pair1.fastq SRR6958416-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,467,225 reads, 18,314,352 reads pseudoaligned [quant] estimated average fragment length: 216.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6958416.ke.tsv 35125 SRR6958416.se.tsv 88098 total ==> SRR6958416.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 721.192 0 0 PNS24247 1044 828.921 44.0486 4.32443 PNS24249 1928 1712.92 76.7453 3.64607 PNS24246 1044 828.921 44.0486 4.32443 PNS24248 1044 828.921 44.0486 4.32443 PNS24244 1471 1255.92 32.109 2.08053 PNS24243 293 111.394 0 0 KQK14069 1603 1387.92 4483.54 262.885 KQK14071 474 266.502 94.3052 28.7968 ==> SRR6958416.se.tsv <== BRADI_1g14170v3 4952 BRADI_1g53295v3 251 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 239 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 257 BRADI_1g48960v3 0 SRR6958416 completed mapping pipeline successfully