Starting /dee2/code/volunteer_pipeline.sh SRR6958417 current disk space = 1548671348736 free memory = 1598388568 SRR6958417 SRAfilesize 15b9332a3eb6740f047fa5cb99f3a2ea SRR6958417.sra SRR6958417.sra file validated SRR6958417 is paired end SRR6958417 is conventional basespace SRR6958417 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.9495 32.0 18.0 33.0 18.0 33.0 2 29.4005 31.0 27.0 33.0 25.0 33.0 3 30.62275 31.0 29.0 33.0 27.0 33.0 4 32.19625 33.0 31.0 33.0 30.0 34.0 5 32.73525 33.0 33.0 33.0 32.0 34.0 6 36.18725 37.0 36.0 38.0 33.0 38.0 7 37.17775 38.0 37.0 38.0 36.0 38.0 8 36.702 38.0 38.0 38.0 35.0 38.0 9 37.3125 38.0 38.0 38.0 36.0 38.0 10-14 37.46405 38.0 38.0 38.0 37.0 38.0 15-19 37.40865 38.0 38.0 38.0 36.8 38.0 20-24 37.325900000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.404700000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.5222 38.0 38.0 38.0 37.4 38.0 35-39 37.451100000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.40915 38.0 38.0 38.0 37.0 38.0 45-49 37.2384 38.0 38.0 38.0 36.6 38.0 50-54 36.882549999999995 38.0 38.0 38.0 35.2 38.0 55-59 36.7909 38.0 38.0 38.0 34.8 38.0 60-64 36.7253 38.0 37.8 38.0 34.6 38.0 65-69 36.69605 38.0 37.8 38.0 34.2 38.0 70-74 36.8722 38.0 38.0 38.0 35.0 38.0 75-79 36.798649999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.645799999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.7582 38.0 38.0 38.0 34.8 38.0 90-94 36.659749999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.3772 38.0 37.6 38.0 33.6 38.0 100-104 36.24705 38.0 37.0 38.0 33.8 38.0 105-109 36.047450000000005 38.0 36.8 38.0 32.8 38.0 110-114 35.701550000000005 38.0 36.4 38.0 31.6 38.0 115-119 35.541399999999996 38.0 36.0 38.0 31.0 38.0 120-124 35.4221 38.0 35.8 38.0 30.4 38.0 125-129 35.03185 38.0 35.0 38.0 28.2 38.0 130-134 35.01989999999999 38.0 35.0 38.0 28.4 38.0 135-139 34.6205 38.0 34.6 38.0 27.2 38.0 140-144 34.05049999999999 38.0 34.4 38.0 23.4 38.0 145-149 32.9822 38.0 33.2 38.0 18.8 38.0 150-151 28.68075 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 0.0 15 0.0 16 0.0 17 3.0 18 2.0 19 3.0 20 2.0 21 3.0 22 11.0 23 7.0 24 11.0 25 11.0 26 10.0 27 14.0 28 19.0 29 28.0 30 46.0 31 54.0 32 87.0 33 143.0 34 227.0 35 410.0 36 1120.0 37 1785.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.747531020511516 10.939478348949102 6.204102304380856 30.10888832615852 2 25.924999999999997 12.425 35.675000000000004 25.974999999999998 3 20.95 17.575 28.675 32.800000000000004 4 24.75 27.150000000000002 23.599999999999998 24.5 5 25.724999999999998 30.9 23.400000000000002 19.975 6 21.9 32.925 24.2 20.974999999999998 7 15.375 26.1 40.65 17.875 8 20.8 23.525 29.975 25.7 9 20.575 21.5 33.2 24.725 10-14 22.93 27.139999999999997 26.505000000000003 23.425 15-19 22.68 26.340000000000003 27.07 23.91 20-24 23.044999999999998 27.310000000000002 26.83 22.814999999999998 25-29 23.244999999999997 26.495 27.065 23.195 30-34 22.68 27.215 26.945000000000004 23.16 35-39 23.525 26.395000000000003 26.195 23.885 40-44 22.895 26.735 27.07 23.3 45-49 22.21 27.229999999999997 26.8 23.76 50-54 21.84 26.77 26.63 24.759999999999998 55-59 22.74 27.169999999999998 26.58 23.51 60-64 23.07730773077308 26.51765176517652 26.4976497649765 23.907390739073907 65-69 22.866143307165355 25.906295314765735 27.13135656782839 24.09620481024051 70-74 22.245 27.22 25.755 24.779999999999998 75-79 22.49 26.83 26.640000000000004 24.04 80-84 22.335 26.529999999999998 26.68 24.455 85-89 22.770000000000003 26.450000000000003 26.889999999999997 23.89 90-94 22.720000000000002 26.974999999999998 26.015 24.29 95-99 22.7 26.27 26.455000000000002 24.575 100-104 23.105 27.105 26.255 23.535 105-109 23.1 26.995 26.31 23.595 110-114 23.59 27.200000000000003 26.179999999999996 23.03 115-119 23.195 27.655 25.94 23.21 120-124 22.939999999999998 27.58 25.39 24.09 125-129 23.395 27.515 25.255 23.835 130-134 23.635 26.825 25.580000000000002 23.96 135-139 23.06 26.700000000000003 25.430000000000003 24.81 140-144 22.67 26.484999999999996 25.45 25.395 145-149 22.24 27.384999999999998 24.995 25.380000000000003 150-151 22.7375 26.8125 24.6125 25.837500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 2.0 26 3.0 27 2.5 28 4.0 29 6.5 30 7.5 31 14.0 32 21.5 33 25.0 34 38.0 35 52.5 36 61.5 37 80.5 38 103.5 39 129.0 40 164.0 41 191.5 42 212.5 43 220.0 44 232.0 45 238.5 46 227.5 47 213.5 48 193.0 49 179.5 50 161.5 51 145.0 52 123.0 53 103.5 54 92.0 55 85.5 56 84.0 57 80.5 58 71.0 59 61.5 60 62.5 61 51.0 62 37.5 63 39.0 64 37.0 65 28.5 66 21.0 67 17.0 68 16.5 69 16.0 70 9.5 71 5.5 72 8.5 73 7.0 74 3.0 75 1.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7068921989396617 1.4000000000000001 3 0.10098459984852311 0.3 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.55 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.3875 0.0 0.0 0.0 0.0 112-113 4.074999999999999 0.0 0.0 0.0 0.0 114-115 4.6375 0.0 0.0 0.0 0.0 116-117 5.3 0.0 0.0 0.0 0.0 118-119 6.0 0.0 0.0 0.0 0.0 120-121 6.725 0.0 0.0 0.0 0.0 122-123 7.4 0.0 0.0 0.0 0.0 124-125 8.4375 0.0 0.0 0.0 0.0 126-127 9.162500000000001 0.0 0.0 0.0 0.0 128-129 10.1125 0.0 0.0 0.0 0.0 130-131 10.8875 0.0 0.0 0.0 0.0 132-133 11.850000000000001 0.0 0.0 0.0 0.0 134-135 12.875 0.0 0.0 0.0 0.0 136-137 13.8875 0.0 0.0 0.0 0.0 138-139 14.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGATA 10 0.006830828 145.0 2 >>END_MODULE SRR6958417 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958417_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1565 33.0 33.0 34.0 33.0 34.0 2 33.247 34.0 33.0 34.0 33.0 34.0 3 33.31575 34.0 33.0 34.0 33.0 34.0 4 33.23775 34.0 33.0 34.0 33.0 34.0 5 33.248 34.0 33.0 34.0 33.0 34.0 6 37.43125 38.0 38.0 38.0 38.0 38.0 7 37.49925 38.0 38.0 38.0 38.0 38.0 8 37.50075 38.0 38.0 38.0 38.0 38.0 9 37.495 38.0 38.0 38.0 38.0 38.0 10-14 37.442 38.0 38.0 38.0 38.0 38.0 15-19 37.43385 38.0 38.0 38.0 38.0 38.0 20-24 36.70685 38.0 37.8 38.0 34.0 38.0 25-29 37.44425 38.0 38.0 38.0 38.0 38.0 30-34 37.51030000000001 38.0 38.0 38.0 38.0 38.0 35-39 36.9753 38.0 38.0 38.0 35.6 38.0 40-44 37.4055 38.0 38.0 38.0 37.6 38.0 45-49 37.3913 38.0 38.0 38.0 37.8 38.0 50-54 37.3913 38.0 38.0 38.0 37.4 38.0 55-59 36.77945 38.0 37.8 38.0 34.6 38.0 60-64 37.35225 38.0 38.0 38.0 37.4 38.0 65-69 37.2587 38.0 38.0 38.0 37.0 38.0 70-74 37.254650000000005 38.0 38.0 38.0 37.0 38.0 75-79 37.20655 38.0 38.0 38.0 37.0 38.0 80-84 37.1585 38.0 38.0 38.0 37.0 38.0 85-89 37.0809 38.0 38.0 38.0 36.6 38.0 90-94 36.964349999999996 38.0 38.0 38.0 36.2 38.0 95-99 36.9366 38.0 38.0 38.0 36.0 38.0 100-104 36.0001 38.0 37.4 38.0 31.0 38.0 105-109 36.0687 38.0 37.2 38.0 30.8 38.0 110-114 36.0752 38.0 37.4 38.0 32.6 38.0 115-119 36.453 38.0 38.0 38.0 34.0 38.0 120-124 34.473699999999994 38.0 34.6 38.0 24.4 38.0 125-129 35.47195 38.0 35.8 38.0 30.6 38.0 130-134 33.703199999999995 38.0 33.6 38.0 20.8 38.0 135-139 33.035700000000006 37.6 31.4 38.0 20.8 38.0 140-144 33.057100000000005 38.0 32.2 38.0 21.2 38.0 145-149 33.4576 38.0 33.0 38.0 19.8 38.0 150-151 27.798375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 2.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 3.0 14 1.0 15 2.0 16 3.0 17 1.0 18 2.0 19 2.0 20 2.0 21 2.0 22 5.0 23 3.0 24 4.0 25 15.0 26 11.0 27 10.0 28 15.0 29 30.0 30 38.0 31 35.0 32 70.0 33 109.0 34 175.0 35 372.0 36 1125.0 37 1954.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.675000000000004 21.349999999999998 9.0 25.974999999999998 2 28.775000000000002 24.425 28.525 18.275 3 21.85 27.275 29.875 21.0 4 24.275 33.0 21.85 20.875 5 25.324999999999996 35.525 20.575 18.575 6 25.3 36.9 19.35 18.45 7 21.125 20.625 38.05 20.200000000000003 8 22.900000000000002 24.05 27.025 26.025 9 22.7 23.400000000000002 28.775000000000002 25.124999999999996 10-14 25.169999999999998 27.634999999999998 24.884999999999998 22.31 15-19 24.675 26.634999999999998 25.974999999999998 22.715 20-24 24.82 26.795 25.564999999999998 22.82 25-29 24.645 26.919999999999998 25.895000000000003 22.54 30-34 23.84 27.229999999999997 26.045 22.884999999999998 35-39 24.14 26.495 26.185000000000002 23.18 40-44 24.765 26.674999999999997 25.7 22.86 45-49 24.279999999999998 27.060000000000002 26.119999999999997 22.54 50-54 24.560000000000002 26.415 26.179999999999996 22.845 55-59 24.185000000000002 26.724999999999998 25.81 23.28 60-64 24.255 26.235000000000003 26.325 23.185 65-69 24.29 27.22 26.145000000000003 22.345000000000002 70-74 24.55 26.69 25.785000000000004 22.975 75-79 24.725 26.174999999999997 26.515 22.585 80-84 24.62 26.185000000000002 26.534999999999997 22.66 85-89 23.68 26.375 26.979999999999997 22.965 90-94 23.98 27.025 26.145000000000003 22.85 95-99 23.93 26.645000000000003 26.195 23.23 100-104 24.485 27.12 25.740000000000002 22.655 105-109 23.885 27.26 25.814999999999998 23.04 110-114 24.595 27.05 26.340000000000003 22.015 115-119 25.669999999999998 26.840000000000003 25.590000000000003 21.9 120-124 25.255 27.12 25.679999999999996 21.945 125-129 25.41 27.07 25.729999999999997 21.790000000000003 130-134 26.035000000000004 27.455000000000002 25.380000000000003 21.13 135-139 26.32 26.795 25.324999999999996 21.560000000000002 140-144 26.06 27.605 25.09 21.245 145-149 27.045 26.875 25.074999999999996 21.005 150-151 26.674999999999997 27.35 25.7875 20.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.5 26 3.0 27 3.0 28 7.5 29 10.0 30 11.5 31 15.5 32 17.5 33 22.5 34 35.0 35 46.5 36 53.5 37 71.5 38 97.0 39 128.5 40 150.5 41 187.0 42 208.0 43 203.0 44 217.0 45 228.0 46 225.0 47 211.0 48 195.0 49 189.5 50 172.5 51 157.0 52 146.5 53 125.0 54 104.5 55 82.5 56 74.5 57 64.0 58 56.5 59 66.0 60 58.0 61 47.5 62 55.5 63 55.5 64 46.0 65 32.0 66 22.5 67 20.5 68 20.0 69 15.0 70 9.5 71 5.0 72 5.0 73 6.0 74 4.5 75 2.0 76 1.0 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29275069461985 98.275 2 0.5556958827986865 1.0999999999999999 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025258903763576663 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 8 0.2 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.35 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.1624999999999996 0.0 0.0 0.0 0.0 112-113 3.7375 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.75 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.800000000000001 0.0 0.0 0.0 0.0 122-123 6.3625 0.0 0.0 0.0 0.0 124-125 7.225 0.0 0.0 0.0 0.0 126-127 7.775 0.0 0.0 0.0 0.0 128-129 8.6125 0.0 0.0 0.0 0.0 130-131 9.2375 0.0 0.0 0.0 0.0 132-133 10.025 0.0 0.0 0.0 0.0 134-135 10.9125 0.0 0.0 0.0 0.0 136-137 11.8875 0.0 0.0 0.0 0.0 138-139 12.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTCAG 10 0.006830828 145.0 4 >>END_MODULE Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573542 spots for SRR6958417.sra Written 573542 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra Read 573525 spots for SRR6958417.sra Written 573525 spots for SRR6958417.sra SRR ids: ['SRR6958417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2fmkm__n SRR6958417.sra spots: 11470517 blocks: [[1, 573525], [573526, 1147050], [1147051, 1720575], [1720576, 2294100], [2294101, 2867625], [2867626, 3441150], [3441151, 4014675], [4014676, 4588200], [4588201, 5161725], [5161726, 5735250], [5735251, 6308775], [6308776, 6882300], [6882301, 7455825], [7455826, 8029350], [8029351, 8602875], [8602876, 9176400], [9176401, 9749925], [9749926, 10323450], [10323451, 10896975], [10896976, 11470517]] SRR6958417 file size 3865281 SRR6958417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958417 SRR6958417_1.fastq SRR6958417_2.fastq Input file: SRR6958417_1.fastq Paired file: SRR6958417_2.fastq trimmed: SRR6958417-trimmed-pair1.fastq, SRR6958417-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:33:52 2024 >> started Fri Dec 6 22:34:05 2024 >> done (13.284s) 11470517 read pairs processed; of these: 6936 ( 0.06%) short read pairs filtered out after trimming by size control 11572 ( 0.10%) empty read pairs filtered out after trimming by size control 11452009 (99.84%) read pairs available; of these: 6957441 (60.75%) trimmed read pairs available after processing 4494568 (39.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 16 0.00% 20 6 0.00% 21 12 0.00% 22 5 0.00% 23 7 0.00% 24 8 0.00% 25 10 0.00% 26 18 0.00% 27 11 0.00% 28 16 0.00% 29 12 0.00% 30 18 0.00% 31 16 0.00% 32 15 0.00% 33 19 0.00% 34 24 0.00% 35 21 0.00% 36 25 0.00% 37 16 0.00% 38 25 0.00% 39 31 0.00% 40 32 0.00% 41 37 0.00% 42 30 0.00% 43 42 0.00% 44 44 0.00% 45 43 0.00% 46 47 0.00% 47 71 0.00% 48 62 0.00% 49 81 0.00% 50 103 0.00% 51 94 0.00% 52 123 0.00% 53 122 0.00% 54 137 0.00% 55 152 0.00% 56 170 0.00% 57 183 0.00% 58 206 0.00% 59 255 0.00% 60 249 0.00% 61 289 0.00% 62 373 0.00% 63 415 0.00% 64 400 0.00% 65 483 0.00% 66 467 0.00% 67 598 0.01% 68 606 0.01% 69 782 0.01% 70 900 0.01% 71 968 0.01% 72 1115 0.01% 73 1266 0.01% 74 1403 0.01% 75 1577 0.01% 76 1757 0.02% 77 2061 0.02% 78 2149 0.02% 79 2352 0.02% 80 2706 0.02% 81 3038 0.03% 82 3583 0.03% 83 3958 0.03% 84 4694 0.04% 85 5153 0.04% 86 5417 0.05% 87 5917 0.05% 88 6583 0.06% 89 7020 0.06% 90 7631 0.07% 91 8479 0.07% 92 9394 0.08% 93 10277 0.09% 94 11478 0.10% 95 12193 0.11% 96 12720 0.11% 97 13520 0.12% 98 14088 0.12% 99 15396 0.13% 100 16895 0.15% 101 19078 0.17% 102 19339 0.17% 103 20973 0.18% 104 22536 0.20% 105 23146 0.20% 106 24572 0.21% 107 25149 0.22% 108 26652 0.23% 109 27450 0.24% 110 29238 0.26% 111 30682 0.27% 112 32306 0.28% 113 33680 0.29% 114 35255 0.31% 115 36950 0.32% 116 37849 0.33% 117 38831 0.34% 118 39698 0.35% 119 40871 0.36% 120 42697 0.37% 121 43948 0.38% 122 45596 0.40% 123 47954 0.42% 124 49973 0.44% 125 51569 0.45% 126 53476 0.47% 127 54810 0.48% 128 55406 0.48% 129 57009 0.50% 130 59381 0.52% 131 60809 0.53% 132 64135 0.56% 133 67125 0.59% 134 69637 0.61% 135 72830 0.64% 136 75823 0.66% 137 79292 0.69% 138 81947 0.72% 139 87261 0.76% 140 91539 0.80% 141 98552 0.86% 142 107917 0.94% 143 119296 1.04% 144 133983 1.17% 145 159108 1.39% 146 192862 1.68% 147 251905 2.20% 148 357991 3.13% 149 677111 5.91% 150 2779527 24.27% 151 4494568 39.25% 11452009 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=23 prefix-density=0.72 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=65.85 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=21 prefix-density=0.43 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=91.20 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCC SRR6958417 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:34:40 Started mapping on | Dec 06 22:34:40 Finished on | Dec 06 22:35:26 Mapping speed, Million of reads per hour | 896.24 Number of input reads | 11452009 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 11267370 Uniquely mapped reads % | 98.39% Average mapped length | 289.23 Number of splices: Total | 12289799 Number of splices: Annotated (sjdb) | 11520242 Number of splices: GT/AG | 12132995 Number of splices: GC/AG | 141529 Number of splices: AT/AC | 4777 Number of splices: Non-canonical | 10498 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 78332 % of reads mapped to multiple loci | 0.68% Number of reads mapped to too many loci | 7758 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 110561 110561 110561 N_multimapping 78332 78332 78332 N_noFeature 452936 10937497 563042 N_ambiguous 257450 1436 37977 UnstrandedReadsAssigned:10556984 PositiveStrandReadsAssigned:328437 NegativeStrandReadsAssigned:10666351 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR6958417 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958417-trimmed-pair1.fastq SRR6958417-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,452,009 reads, 10,695,572 reads pseudoaligned [quant] estimated average fragment length: 200.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52973 SRR6958417.ke.tsv 35125 SRR6958417.se.tsv 88098 total ==> SRR6958417.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 736.878 0 0 PNS24247 1044 844.525 34.2159 6.04571 PNS24249 1928 1728.53 18.8817 1.63003 PNS24246 1044 844.525 34.2159 6.04571 PNS24248 1044 844.525 34.2159 6.04571 PNS24244 1471 1271.53 18.4706 2.16765 PNS24243 293 111.439 0 0 KQK14069 1603 1403.53 2375.91 252.605 KQK14071 474 277.428 50.6138 27.2239 ==> SRR6958417.se.tsv <== BRADI_1g14170v3 2851 BRADI_1g53295v3 116 BRADI_1g59795v3 162 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 165 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 141 BRADI_1g48960v3 0 SRR6958417 completed mapping pipeline successfully