Starting /dee2/code/volunteer_pipeline.sh SRR6958418 current disk space = 1548557840384 free memory = 1603557388 SRR6958418 SRAfilesize 3ea9953180cf02f029c816bb0cfcfabd SRR6958418.sra SRR6958418.sra file validated SRR6958418 is paired end SRR6958418 is conventional basespace SRR6958418 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958418_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9945 33.0 32.0 33.0 27.0 34.0 2 31.91425 33.0 31.0 34.0 28.0 34.0 3 31.326 33.0 31.0 33.0 27.0 34.0 4 31.8335 33.0 31.0 33.0 29.0 34.0 5 32.01775 33.0 32.0 33.0 31.0 34.0 6 36.4355 38.0 37.0 38.0 34.0 38.0 7 36.91975 38.0 38.0 38.0 35.0 38.0 8 36.94325 38.0 38.0 38.0 35.0 38.0 9 37.06975 38.0 38.0 38.0 36.0 38.0 10-14 37.201299999999996 38.0 38.0 38.0 36.0 38.0 15-19 37.18415 38.0 38.0 38.0 36.2 38.0 20-24 37.277699999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.16875 38.0 38.0 38.0 36.0 38.0 30-34 36.97825 38.0 38.0 38.0 35.8 38.0 35-39 36.8885 38.0 38.0 38.0 35.4 38.0 40-44 36.7756 38.0 38.0 38.0 35.0 38.0 45-49 36.933550000000004 38.0 38.0 38.0 35.4 38.0 50-54 36.8521 38.0 38.0 38.0 35.0 38.0 55-59 36.7139 38.0 38.0 38.0 34.4 38.0 60-64 36.70765 38.0 38.0 38.0 34.6 38.0 65-69 36.735800000000005 38.0 38.0 38.0 34.6 38.0 70-74 36.75095 38.0 38.0 38.0 34.6 38.0 75-79 36.6694 38.0 38.0 38.0 34.2 38.0 80-84 36.306850000000004 38.0 37.4 38.0 33.4 38.0 85-89 36.23505 38.0 37.4 38.0 33.4 38.0 90-94 36.2859 38.0 37.6 38.0 33.2 38.0 95-99 36.3269 38.0 37.4 38.0 33.6 38.0 100-104 36.0773 38.0 37.0 38.0 32.8 38.0 105-109 35.708749999999995 38.0 36.4 38.0 30.8 38.0 110-114 35.7328 38.0 36.0 38.0 31.0 38.0 115-119 35.647999999999996 38.0 36.0 38.0 31.0 38.0 120-124 35.4622 38.0 36.0 38.0 30.0 38.0 125-129 35.09675 38.0 35.4 38.0 28.6 38.0 130-134 34.8149 38.0 35.0 38.0 27.6 38.0 135-139 34.5421 38.0 35.0 38.0 26.2 38.0 140-144 34.1327 38.0 34.4 38.0 24.4 38.0 145-149 33.071299999999994 38.0 33.8 38.0 17.6 38.0 150-151 28.329625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 5.0 23 10.0 24 14.0 25 17.0 26 20.0 27 31.0 28 47.0 29 48.0 30 53.0 31 70.0 32 118.0 33 152.0 34 226.0 35 354.0 36 835.0 37 1990.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.224362311296204 8.01665799062988 9.39614783966684 43.36283185840708 2 23.406924234821876 11.364776718514802 35.900652282990464 29.327646763672853 3 20.125 14.975 24.7 40.2 4 24.75 23.1 22.55 29.599999999999998 5 28.13440320962889 26.10330992978937 23.8716148445336 21.890672016048143 6 22.2 32.775 22.975 22.05 7 18.2 24.875 38.550000000000004 18.375 8 22.375 23.25 29.525000000000002 24.85 9 20.3 21.0 34.55 24.15 10-14 22.065 26.915 25.845000000000002 25.174999999999997 15-19 22.66 25.105 26.625 25.61 20-24 22.6 25.6 26.21 25.590000000000003 25-29 22.439999999999998 25.53 26.105 25.924999999999997 30-34 23.255 24.97 26.090000000000003 25.685000000000002 35-39 22.835 25.46 26.540000000000003 25.165 40-44 22.865 25.27 26.340000000000003 25.525 45-49 22.830000000000002 25.205 25.75 26.215 50-54 23.330000000000002 25.155 25.985000000000003 25.53 55-59 23.200000000000003 25.424999999999997 26.25 25.124999999999996 60-64 23.535 25.7 25.845000000000002 24.92 65-69 23.105 25.415 26.19 25.290000000000003 70-74 23.32 24.81 26.465 25.405 75-79 23.400000000000002 24.955 25.755 25.89 80-84 23.095 24.95 25.88 26.075 85-89 23.419999999999998 25.380000000000003 25.64 25.56 90-94 23.0 25.09 26.375 25.535000000000004 95-99 23.11 24.925 26.3 25.665 100-104 23.155 25.19 26.174999999999997 25.480000000000004 105-109 23.34 24.365000000000002 25.840000000000003 26.455000000000002 110-114 23.535 24.785 26.029999999999998 25.650000000000002 115-119 24.01 25.09 25.650000000000002 25.25 120-124 23.5 25.185000000000002 25.69 25.624999999999996 125-129 24.154999999999998 24.34 26.07 25.435000000000002 130-134 24.310000000000002 24.92 25.045 25.724999999999998 135-139 23.48 25.0 25.779999999999998 25.740000000000002 140-144 24.169999999999998 24.29 26.0 25.540000000000003 145-149 23.515 25.39 25.88 25.215 150-151 23.13666541400476 23.9634222723287 26.531379180759114 26.36853313290743 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 4.0 30 7.5 31 10.5 32 13.5 33 15.5 34 21.5 35 33.0 36 49.5 37 68.5 38 86.5 39 103.0 40 125.5 41 154.0 42 180.5 43 192.5 44 206.0 45 211.0 46 209.5 47 204.5 48 200.0 49 185.0 50 173.0 51 168.0 52 143.0 53 118.5 54 104.5 55 100.0 56 96.0 57 93.5 58 80.0 59 68.5 60 66.0 61 65.0 62 60.5 63 59.0 64 60.5 65 48.0 66 33.5 67 36.5 68 31.5 69 21.5 70 19.0 71 14.0 72 11.0 73 9.5 74 11.0 75 10.5 76 6.0 77 3.5 78 2.0 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.95 2 0.35000000000000003 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26896899420217 98.45 2 0.6301991429291656 1.25 3 0.10083186286866651 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.2249999999999996 0.0 0.0 0.0 0.0 138-139 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGAGC 10 0.006585701 146.75949 2 >>END_MODULE SRR6958418 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958418_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8705 33.0 33.0 34.0 32.0 34.0 2 32.86825 33.0 33.0 34.0 32.0 34.0 3 32.82675 33.0 33.0 34.0 32.0 34.0 4 32.80725 34.0 33.0 34.0 32.0 34.0 5 32.80025 34.0 33.0 34.0 32.0 34.0 6 36.91 38.0 38.0 38.0 35.0 38.0 7 36.98875 38.0 38.0 38.0 36.0 38.0 8 36.84825 38.0 38.0 38.0 35.0 38.0 9 36.8955 38.0 38.0 38.0 36.0 38.0 10-14 36.7423 38.0 38.0 38.0 34.6 38.0 15-19 36.72075 38.0 38.0 38.0 34.8 38.0 20-24 36.76875 38.0 38.0 38.0 34.8 38.0 25-29 36.83325 38.0 38.0 38.0 35.4 38.0 30-34 36.95525 38.0 38.0 38.0 35.8 38.0 35-39 36.8743 38.0 38.0 38.0 35.4 38.0 40-44 36.712 38.0 38.0 38.0 34.8 38.0 45-49 36.65675 38.0 38.0 38.0 34.6 38.0 50-54 36.6823 38.0 38.0 38.0 34.8 38.0 55-59 36.78245 38.0 38.0 38.0 35.0 38.0 60-64 36.71195 38.0 38.0 38.0 35.0 38.0 65-69 36.5409 38.0 38.0 38.0 34.0 38.0 70-74 36.45155 38.0 38.0 38.0 34.0 38.0 75-79 36.37230000000001 38.0 38.0 38.0 33.8 38.0 80-84 36.206450000000004 38.0 38.0 38.0 33.0 38.0 85-89 36.0355 38.0 37.4 38.0 32.6 38.0 90-94 35.9975 38.0 37.0 38.0 32.6 38.0 95-99 35.82815000000001 38.0 37.0 38.0 31.2 38.0 100-104 35.7433 38.0 37.0 38.0 31.0 38.0 105-109 35.480000000000004 38.0 36.4 38.0 29.4 38.0 110-114 35.212650000000004 38.0 36.0 38.0 28.6 38.0 115-119 35.229400000000005 38.0 36.0 38.0 29.0 38.0 120-124 35.056700000000006 38.0 35.6 38.0 28.0 38.0 125-129 34.869749999999996 38.0 35.0 38.0 27.6 38.0 130-134 34.54 38.0 35.0 38.0 25.8 38.0 135-139 34.003699999999995 38.0 34.4 38.0 22.6 38.0 140-144 33.72805 38.0 34.0 38.0 22.2 38.0 145-149 32.8948 38.0 33.8 38.0 15.8 38.0 150-151 28.496875 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 3.0 14 1.0 15 3.0 16 7.0 17 6.0 18 4.0 19 4.0 20 4.0 21 4.0 22 12.0 23 23.0 24 14.0 25 21.0 26 28.0 27 28.0 28 43.0 29 47.0 30 52.0 31 96.0 32 108.0 33 156.0 34 210.0 35 317.0 36 689.0 37 2112.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.275 16.675 11.924999999999999 38.125 2 28.375 22.1 29.549999999999997 19.975 3 21.8 25.424999999999997 27.625 25.15 4 25.374999999999996 30.475 21.099999999999998 23.05 5 29.299999999999997 31.3 19.525000000000002 19.875 6 23.325000000000003 36.675000000000004 20.125 19.875 7 22.675 20.8 32.9 23.625 8 24.7 22.875 25.5 26.924999999999997 9 23.849999999999998 22.775000000000002 28.725 24.65 10-14 26.07 26.33 23.555 24.044999999999998 15-19 25.485000000000003 25.590000000000003 24.474999999999998 24.45 20-24 25.445 25.545 24.425 24.585 25-29 25.650000000000002 25.895000000000003 24.175 24.279999999999998 30-34 25.540000000000003 25.430000000000003 24.705 24.325 35-39 25.31 25.900000000000002 24.065 24.725 40-44 25.615 25.385 24.310000000000002 24.69 45-49 25.36 25.790000000000003 24.099999999999998 24.75 50-54 26.009999999999998 25.069999999999997 24.740000000000002 24.18 55-59 25.77 25.424999999999997 24.560000000000002 24.245 60-64 26.224999999999998 25.259999999999998 24.815 23.7 65-69 25.66 25.779999999999998 24.279999999999998 24.279999999999998 70-74 26.06 25.19 24.46 24.29 75-79 25.55 25.305 24.45 24.695 80-84 26.229999999999997 25.979999999999997 24.169999999999998 23.62 85-89 26.8 25.465 24.0 23.735 90-94 25.785000000000004 25.94 24.3 23.974999999999998 95-99 25.724999999999998 25.765 24.765 23.745 100-104 26.045 25.465 24.154999999999998 24.335 105-109 25.47 25.865 24.875 23.79 110-114 25.55 25.785000000000004 24.785 23.880000000000003 115-119 26.69 25.52 24.34 23.45 120-124 26.32 25.779999999999998 24.48 23.419999999999998 125-129 26.179999999999996 26.055 24.165 23.599999999999998 130-134 26.345000000000002 26.284999999999997 24.01 23.36 135-139 25.895000000000003 25.929999999999996 24.625 23.549999999999997 140-144 26.43 25.515 24.605 23.45 145-149 26.384999999999998 26.165 24.41 23.04 150-151 25.91108328115216 26.186599874765186 24.98434564809017 22.917971195992486 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 3.0 27 5.0 28 4.0 29 4.5 30 9.0 31 11.0 32 8.5 33 11.0 34 19.0 35 26.0 36 34.5 37 43.5 38 63.5 39 96.0 40 113.5 41 132.5 42 164.0 43 181.5 44 189.0 45 187.0 46 182.0 47 193.5 48 192.5 49 182.0 50 181.5 51 156.5 52 135.0 53 126.0 54 110.0 55 101.0 56 95.0 57 96.5 58 100.5 59 90.0 60 84.5 61 92.5 62 85.0 63 69.0 64 58.0 65 55.0 66 55.0 67 47.0 68 38.0 69 32.5 70 32.5 71 30.0 72 20.0 73 16.5 74 13.0 75 8.0 76 5.0 77 2.5 78 3.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9083523736989 97.39999999999999 2 0.8885503935008886 1.7500000000000002 3 0.12693577050012694 0.375 4 0.0 0.0 5 0.05077430820005078 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02538715410002539 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 9 0.22499999999999998 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.2249999999999996 0.0 0.0 0.0 0.0 138-139 2.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384267 spots for SRR6958418.sra Written 1384267 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra Read 1384265 spots for SRR6958418.sra Written 1384265 spots for SRR6958418.sra SRR ids: ['SRR6958418.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p_ldrziy SRR6958418.sra spots: 27685302 blocks: [[1, 1384265], [1384266, 2768530], [2768531, 4152795], [4152796, 5537060], [5537061, 6921325], [6921326, 8305590], [8305591, 9689855], [9689856, 11074120], [11074121, 12458385], [12458386, 13842650], [13842651, 15226915], [15226916, 16611180], [16611181, 17995445], [17995446, 19379710], [19379711, 20763975], [20763976, 22148240], [22148241, 23532505], [23532506, 24916770], [24916771, 26301035], [26301036, 27685302]] SRR6958418 file size 9359940 SRR6958418 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958418 SRR6958418_1.fastq SRR6958418_2.fastq Input file: SRR6958418_1.fastq Paired file: SRR6958418_2.fastq trimmed: SRR6958418-trimmed-pair1.fastq, SRR6958418-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:41:58 2024 >> started Fri Dec 6 22:42:26 2024 >> done (28.615s) 27685302 read pairs processed; of these: 14608 ( 0.05%) short read pairs filtered out after trimming by size control 9825 ( 0.04%) empty read pairs filtered out after trimming by size control 27660869 (99.91%) read pairs available; of these: 9679727 (34.99%) trimmed read pairs available after processing 17981142 (65.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 12 0.00% 24 9 0.00% 25 12 0.00% 26 12 0.00% 27 7 0.00% 28 12 0.00% 29 8 0.00% 30 12 0.00% 31 11 0.00% 32 15 0.00% 33 15 0.00% 34 9 0.00% 35 13 0.00% 36 9 0.00% 37 18 0.00% 38 18 0.00% 39 13 0.00% 40 10 0.00% 41 19 0.00% 42 29 0.00% 43 21 0.00% 44 20 0.00% 45 25 0.00% 46 23 0.00% 47 44 0.00% 48 44 0.00% 49 40 0.00% 50 54 0.00% 51 55 0.00% 52 50 0.00% 53 61 0.00% 54 58 0.00% 55 79 0.00% 56 83 0.00% 57 91 0.00% 58 105 0.00% 59 103 0.00% 60 124 0.00% 61 129 0.00% 62 149 0.00% 63 141 0.00% 64 182 0.00% 65 194 0.00% 66 195 0.00% 67 251 0.00% 68 270 0.00% 69 323 0.00% 70 316 0.00% 71 367 0.00% 72 384 0.00% 73 436 0.00% 74 490 0.00% 75 589 0.00% 76 574 0.00% 77 683 0.00% 78 771 0.00% 79 837 0.00% 80 921 0.00% 81 1026 0.00% 82 1213 0.00% 83 1432 0.01% 84 2187 0.01% 85 2676 0.01% 86 2812 0.01% 87 3127 0.01% 88 3266 0.01% 89 3488 0.01% 90 3654 0.01% 91 3761 0.01% 92 4021 0.01% 93 4350 0.02% 94 4647 0.02% 95 4865 0.02% 96 5257 0.02% 97 5719 0.02% 98 5961 0.02% 99 6382 0.02% 100 7018 0.03% 101 7548 0.03% 102 8021 0.03% 103 8578 0.03% 104 9199 0.03% 105 9516 0.03% 106 10558 0.04% 107 11173 0.04% 108 11851 0.04% 109 12876 0.05% 110 13531 0.05% 111 14125 0.05% 112 15186 0.05% 113 16171 0.06% 114 17187 0.06% 115 18684 0.07% 116 19740 0.07% 117 20718 0.07% 118 21810 0.08% 119 23014 0.08% 120 24449 0.09% 121 25723 0.09% 122 27107 0.10% 123 28387 0.10% 124 30692 0.11% 125 32175 0.12% 126 34157 0.12% 127 36021 0.13% 128 37779 0.14% 129 40376 0.15% 130 42523 0.15% 131 45092 0.16% 132 48465 0.18% 133 51565 0.19% 134 55245 0.20% 135 59125 0.21% 136 64025 0.23% 137 68340 0.25% 138 73635 0.27% 139 80495 0.29% 140 88203 0.32% 141 96434 0.35% 142 109483 0.40% 143 124908 0.45% 144 145543 0.53% 145 178773 0.65% 146 225064 0.81% 147 309390 1.12% 148 486055 1.76% 149 996444 3.60% 150 5658131 20.46% 151 17981142 65.01% 27660869 reads passed initial QC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=17 prefix-density=1.04 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=37.59 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=15 prefix-density=0.76 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=48.48 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.3 sequence=ACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGA SRR6958418 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:43:16 Started mapping on | Dec 06 22:43:18 Finished on | Dec 06 22:45:54 Mapping speed, Million of reads per hour | 638.33 Number of input reads | 27660869 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 27036749 Uniquely mapped reads % | 97.74% Average mapped length | 297.99 Number of splices: Total | 32588761 Number of splices: Annotated (sjdb) | 30755139 Number of splices: GT/AG | 32158165 Number of splices: GC/AG | 381702 Number of splices: AT/AC | 11772 Number of splices: Non-canonical | 37122 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227049 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 18753 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 406760 406760 406760 N_multimapping 227049 227049 227049 N_noFeature 883987 26263049 1104812 N_ambiguous 667652 3602 116956 UnstrandedReadsAssigned:25485110 PositiveStrandReadsAssigned:770098 NegativeStrandReadsAssigned:25814981 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958418 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958418-trimmed-pair1.fastq SRR6958418-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,660,869 reads, 25,811,070 reads pseudoaligned [quant] estimated average fragment length: 281.264 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958418.ke.tsv 35125 SRR6958418.se.tsv 88098 total ==> SRR6958418.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.318 0 0 PNS24247 1044 763.736 83.3413 6.19783 PNS24249 1928 1647.74 53.4384 1.842 PNS24246 1044 763.736 83.3413 6.19783 PNS24248 1044 763.736 83.3413 6.19783 PNS24244 1471 1190.74 28.5377 1.36121 PNS24243 293 76.0306 0 0 KQK14069 1603 1322.74 6355.15 272.882 KQK14071 474 211.902 95.4136 25.5739 ==> SRR6958418.se.tsv <== BRADI_1g14170v3 7096 BRADI_1g53295v3 350 BRADI_1g59795v3 332 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 257 BRADI_1g74790v3 133 BRADI_1g09890v3 0 BRADI_1g77505v3 377 BRADI_1g48960v3 0 SRR6958418 completed mapping pipeline successfully