Starting /dee2/code/volunteer_pipeline.sh SRR6958419 current disk space = 1548577386496 free memory = 1602368412 SRR6958419 SRAfilesize 58affcb69bf3530b26ca206e6b68babb SRR6958419.sra SRR6958419.sra file validated SRR6958419 is paired end SRR6958419 is conventional basespace SRR6958419 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958419_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.37175 32.0 25.0 33.0 18.0 33.0 2 23.0535 18.0 18.0 29.0 18.0 31.0 3 26.11375 28.0 18.0 30.0 18.0 31.0 4 28.359 29.0 27.0 31.0 25.0 33.0 5 31.449 32.0 32.0 33.0 28.0 33.0 6 35.509 37.0 35.0 38.0 31.0 38.0 7 36.50825 38.0 37.0 38.0 34.0 38.0 8 36.35875 38.0 37.0 38.0 33.0 38.0 9 37.061 38.0 38.0 38.0 35.0 38.0 10-14 37.25485 38.0 38.0 38.0 36.6 38.0 15-19 37.3579 38.0 38.0 38.0 37.0 38.0 20-24 37.3983 38.0 38.0 38.0 37.2 38.0 25-29 37.379949999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.30535 38.0 38.0 38.0 37.0 38.0 35-39 37.29465 38.0 38.0 38.0 36.8 38.0 40-44 37.36175000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.30884999999999 38.0 38.0 38.0 36.8 38.0 50-54 37.17230000000001 38.0 38.0 38.0 36.2 38.0 55-59 36.99045 38.0 38.0 38.0 36.0 38.0 60-64 36.7112 38.0 38.0 38.0 35.8 38.0 65-69 37.093300000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.0874 38.0 38.0 38.0 36.0 38.0 75-79 37.0176 38.0 38.0 38.0 35.8 38.0 80-84 36.89365 38.0 38.0 38.0 35.4 38.0 85-89 36.787600000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.7444 38.0 38.0 38.0 34.8 38.0 95-99 36.6661 38.0 38.0 38.0 34.2 38.0 100-104 36.48875 38.0 38.0 38.0 34.0 38.0 105-109 36.28415 38.0 37.8 38.0 33.6 38.0 110-114 36.20345 38.0 37.6 38.0 33.4 38.0 115-119 35.9862 38.0 37.0 38.0 33.0 38.0 120-124 35.768600000000006 38.0 36.6 38.0 31.2 38.0 125-129 35.69905 38.0 36.4 38.0 31.0 38.0 130-134 35.31925 38.0 36.0 38.0 30.6 38.0 135-139 34.6135 38.0 35.0 38.0 27.0 38.0 140-144 34.1065 38.0 33.8 38.0 24.8 38.0 145-149 33.6415 38.0 33.4 38.0 21.4 38.0 150-151 28.247374999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 1.0 20 1.0 21 2.0 22 7.0 23 5.0 24 12.0 25 14.0 26 17.0 27 21.0 28 31.0 29 43.0 30 58.0 31 62.0 32 95.0 33 115.0 34 173.0 35 327.0 36 862.0 37 2145.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.55 22.6 7.225 39.625 2 17.804451112778192 26.30657664416104 24.406101525381345 31.48287071767942 3 20.375 18.4 23.150000000000002 38.074999999999996 4 22.675 25.95 21.575 29.799999999999997 5 26.0 28.675 22.325 23.0 6 23.3 31.775 22.825 22.1 7 16.275000000000002 24.95 40.625 18.15 8 21.025 23.674999999999997 28.65 26.650000000000002 9 19.425 23.075000000000003 32.324999999999996 25.174999999999997 10-14 22.078311746762015 26.704005600840127 25.993899084862733 25.22378356753513 15-19 22.345000000000002 25.25 26.740000000000002 25.665 20-24 22.585 25.3 26.369999999999997 25.745 25-29 22.189999999999998 25.865 26.665 25.28 30-34 22.09 26.0 25.97 25.94 35-39 22.665 26.145000000000003 25.790000000000003 25.4 40-44 22.884999999999998 25.15 26.14 25.825 45-49 22.58 25.275 26.450000000000003 25.695 50-54 22.155 25.419999999999998 26.275 26.150000000000002 55-59 22.52609393817744 25.456643918105176 26.565636290646328 25.451625853071057 60-64 22.83162621726626 25.626923659114993 25.83884151571724 25.702608607901507 65-69 22.955000000000002 26.284999999999997 26.115 24.645 70-74 22.375 25.580000000000002 26.3 25.745 75-79 22.99 25.185000000000002 26.46 25.365 80-84 22.29 25.52 26.36 25.83 85-89 23.064999999999998 25.21 26.279999999999998 25.445 90-94 23.515 24.95 26.419999999999998 25.115 95-99 23.150000000000002 25.264999999999997 25.955000000000002 25.629999999999995 100-104 23.385 25.009999999999998 26.224999999999998 25.380000000000003 105-109 23.69 25.169999999999998 25.71 25.430000000000003 110-114 23.65 24.87 26.729999999999997 24.75 115-119 23.200000000000003 25.55 26.009999999999998 25.240000000000002 120-124 23.335 25.205 26.229999999999997 25.230000000000004 125-129 23.285 24.97 26.46 25.285000000000004 130-134 23.435 24.94 25.94 25.685000000000002 135-139 23.044999999999998 25.430000000000003 25.82 25.705 140-144 23.41 25.465 25.405 25.72 145-149 23.605 24.46 26.1 25.835 150-151 24.1625 24.375 25.837500000000002 25.624999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.5 29 3.5 30 7.0 31 10.0 32 13.0 33 16.5 34 25.0 35 39.5 36 55.0 37 80.5 38 89.5 39 100.5 40 127.5 41 140.0 42 178.0 43 215.0 44 212.5 45 218.0 46 232.0 47 222.5 48 211.0 49 194.5 50 174.0 51 169.0 52 135.0 53 111.5 54 117.5 55 96.5 56 77.5 57 74.5 58 67.5 59 72.5 60 72.0 61 58.0 62 54.5 63 53.0 64 52.5 65 44.5 66 31.5 67 28.0 68 27.0 69 20.5 70 14.5 71 14.0 72 11.0 73 9.5 74 7.5 75 4.0 76 3.5 77 2.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.36 60-64 0.905 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 3.0 0.0 0.0 0.0 0.0 136-137 3.225 0.0 0.0 0.0 0.0 138-139 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958419 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958419_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74125 33.0 33.0 34.0 32.0 34.0 2 32.88575 33.0 33.0 34.0 32.0 34.0 3 32.91375 33.0 33.0 34.0 32.0 34.0 4 32.88925 34.0 33.0 34.0 32.0 34.0 5 32.86875 34.0 33.0 34.0 32.0 34.0 6 36.975 38.0 38.0 38.0 36.0 38.0 7 37.05875 38.0 38.0 38.0 37.0 38.0 8 36.9355 38.0 38.0 38.0 36.0 38.0 9 36.99725 38.0 38.0 38.0 36.0 38.0 10-14 36.98975 38.0 38.0 38.0 36.0 38.0 15-19 36.934749999999994 38.0 38.0 38.0 36.0 38.0 20-24 36.93315 38.0 38.0 38.0 36.0 38.0 25-29 36.87165 38.0 38.0 38.0 36.0 38.0 30-34 36.85265 38.0 38.0 38.0 36.0 38.0 35-39 36.843849999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.83675 38.0 38.0 38.0 36.0 38.0 45-49 36.86675 38.0 38.0 38.0 36.0 38.0 50-54 36.79430000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.751099999999994 38.0 38.0 38.0 35.6 38.0 60-64 36.7097 38.0 38.0 38.0 35.4 38.0 65-69 36.6495 38.0 38.0 38.0 35.0 38.0 70-74 36.63105 38.0 38.0 38.0 35.0 38.0 75-79 36.6058 38.0 38.0 38.0 35.0 38.0 80-84 36.604 38.0 38.0 38.0 35.0 38.0 85-89 36.4089 38.0 38.0 38.0 34.0 38.0 90-94 36.33945 38.0 38.0 38.0 34.0 38.0 95-99 36.275800000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.21265 38.0 38.0 38.0 34.0 38.0 105-109 36.13605 38.0 38.0 38.0 34.0 38.0 110-114 35.85275 38.0 37.8 38.0 32.8 38.0 115-119 35.748900000000006 38.0 37.6 38.0 31.8 38.0 120-124 35.74294999999999 38.0 37.8 38.0 32.4 38.0 125-129 35.6849 38.0 37.0 38.0 32.2 38.0 130-134 35.431400000000004 38.0 36.4 38.0 31.0 38.0 135-139 35.160450000000004 38.0 36.0 38.0 30.2 38.0 140-144 34.853899999999996 38.0 36.0 38.0 29.6 38.0 145-149 34.117399999999996 38.0 34.4 38.0 26.0 38.0 150-151 30.086875 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 2.0 12 2.0 13 1.0 14 2.0 15 2.0 16 6.0 17 1.0 18 5.0 19 2.0 20 3.0 21 2.0 22 11.0 23 15.0 24 10.0 25 14.0 26 28.0 27 25.0 28 34.0 29 32.0 30 47.0 31 57.0 32 70.0 33 94.0 34 124.0 35 201.0 36 498.0 37 2686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 20.1 11.175 29.075 2 28.457114278569644 24.23105776444111 25.806451612903224 21.50537634408602 3 23.111555777888945 26.788394197098548 26.96348174087044 23.13656828414207 4 25.481370342585645 30.332583145786447 21.180295073768445 23.005751437859466 5 27.35683920980245 31.757939484871216 19.929982495623904 20.955238809702426 6 22.536268134067033 36.16808404202101 20.135067533766886 21.160580290145074 7 21.68584292146073 21.935967983991997 31.990995497748877 24.387193596798397 8 23.56178089044522 24.137068534267133 23.461730865432717 28.83941970985493 9 23.36168084042021 22.811405702851424 27.263631815907953 26.563281640820406 10-14 25.907953976988495 26.30815407703852 23.47673836918459 24.307153576788394 15-19 25.273900645354946 26.58462154184802 24.33338336084847 23.808094451948573 20-24 25.574065736154882 26.629646305468007 23.412877082395315 24.383410875981788 25-29 26.008004002001 26.098049024512253 24.27713856928464 23.6168084042021 30-34 25.500300180108066 27.081248749249546 24.279567740644385 23.138883329998 35-39 26.03932162689479 25.729151033068188 24.373405372955126 23.858121967081892 40-44 26.27445094802141 26.074340887488116 24.18830356696183 23.46290459752864 45-49 25.467733866933468 26.143071535767888 24.327163581790895 24.062031015507753 50-54 26.173086543271634 25.83791895947974 24.41720860430215 23.571785892946473 55-59 25.957978989494745 25.842921460730366 24.312156078039017 23.88694347173587 60-64 25.423983190754917 25.86422532392816 24.63354845164841 24.078243033668517 65-69 25.44272136068034 25.667833916958475 24.937468734367183 23.951975987993997 70-74 25.6328164082041 25.912956478239117 24.682341170585293 23.771885942971487 75-79 25.387693846923458 26.078039019509752 24.752376188094047 23.781890945472735 80-84 26.11936565110811 26.05432988143479 24.788633748561708 23.03767071889539 85-89 25.937968984492244 25.887943971985994 24.947473736868435 23.226613306653327 90-94 25.685411246748046 26.200720432259356 24.68481088653192 23.429057434460677 95-99 25.55661179766848 26.627307750037527 24.110671936758894 23.705408515535098 100-104 25.774330748061047 26.014510883162373 24.998749061796346 23.212409306980238 105-109 25.73672887376795 26.277080102066343 24.716065442537648 23.270125581628058 110-114 25.677974582207547 26.483538476933855 24.467126988892225 23.37135995196638 115-119 26.009305117814797 26.259442693481418 24.568512681975086 23.1627395067287 120-124 26.410846507904743 26.47088252951771 24.0944566740044 23.023814288573146 125-129 26.24312156078039 25.967983991995997 24.64232116058029 23.14657328664332 130-134 26.244434438941415 25.984291360248136 24.74861173645505 23.022662464355395 135-139 25.982991495747875 26.16808404202101 24.917458729364682 22.93146573286643 140-144 26.063031515757878 26.8384192096048 24.3671835917959 22.73136568284142 145-149 26.788394197098548 25.652826413206604 25.372686343171587 22.18609304652326 150-151 26.538269134567283 26.95097548774387 24.387193596798397 22.123561780890444 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 3.5 29 5.5 30 7.0 31 7.0 32 11.5 33 14.5 34 24.0 35 30.5 36 38.0 37 64.5 38 73.5 39 79.0 40 123.0 41 146.5 42 170.0 43 179.0 44 184.0 45 214.5 46 216.5 47 208.0 48 186.5 49 158.0 50 159.0 51 167.0 52 148.5 53 127.5 54 115.5 55 108.0 56 96.0 57 99.5 58 98.5 59 72.0 60 63.5 61 74.0 62 72.0 63 58.0 64 50.0 65 56.0 66 53.5 67 43.5 68 40.0 69 36.0 70 31.0 71 26.0 72 19.0 73 12.5 74 9.0 75 5.5 76 3.0 77 2.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.025 5 0.025 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.055 20-24 0.055 25-29 0.05 30-34 0.06 35-39 0.055 40-44 0.055 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.055 65-69 0.05 70-74 0.05 75-79 0.05 80-84 0.055 85-89 0.05 90-94 0.06 95-99 0.065 100-104 0.075 105-109 0.065 110-114 0.06999999999999999 115-119 0.055 120-124 0.06 125-129 0.05 130-134 0.055 135-139 0.05 140-144 0.05 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.6557377049180327 1.3 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025220680958385876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6000000000000001 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.8999999999999999 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.425 0.0 0.0 0.0 0.0 132-133 2.65 0.0 0.0 0.0 0.0 134-135 3.025 0.0 0.0 0.0 0.0 136-137 3.225 0.0 0.0 0.0 0.0 138-139 3.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804186 spots for SRR6958419.sra Written 804186 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra Read 804168 spots for SRR6958419.sra Written 804168 spots for SRR6958419.sra SRR ids: ['SRR6958419.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kq_0p8zf SRR6958419.sra spots: 16083378 blocks: [[1, 804168], [804169, 1608336], [1608337, 2412504], [2412505, 3216672], [3216673, 4020840], [4020841, 4825008], [4825009, 5629176], [5629177, 6433344], [6433345, 7237512], [7237513, 8041680], [8041681, 8845848], [8845849, 9650016], [9650017, 10454184], [10454185, 11258352], [11258353, 12062520], [12062521, 12866688], [12866689, 13670856], [13670857, 14475024], [14475025, 15279192], [15279193, 16083378]] SRR6958419 file size 5428428 SRR6958419 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958419 SRR6958419_1.fastq SRR6958419_2.fastq Input file: SRR6958419_1.fastq Paired file: SRR6958419_2.fastq trimmed: SRR6958419-trimmed-pair1.fastq, SRR6958419-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:42:29 2024 >> started Fri Dec 6 22:42:51 2024 >> done (21.552s) 16083378 read pairs processed; of these: 26303 ( 0.16%) short read pairs filtered out after trimming by size control 24556 ( 0.15%) empty read pairs filtered out after trimming by size control 16032519 (99.68%) read pairs available; of these: 6067885 (37.85%) trimmed read pairs available after processing 9964634 (62.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 3 0.00% 24 5 0.00% 25 5 0.00% 26 4 0.00% 27 7 0.00% 28 3 0.00% 29 7 0.00% 30 4 0.00% 31 6 0.00% 32 6 0.00% 33 2 0.00% 34 2 0.00% 35 6 0.00% 36 9 0.00% 37 7 0.00% 38 6 0.00% 39 8 0.00% 40 8 0.00% 41 11 0.00% 42 8 0.00% 43 9 0.00% 44 10 0.00% 45 16 0.00% 46 14 0.00% 47 23 0.00% 48 11 0.00% 49 23 0.00% 50 22 0.00% 51 23 0.00% 52 32 0.00% 53 21 0.00% 54 35 0.00% 55 29 0.00% 56 42 0.00% 57 41 0.00% 58 63 0.00% 59 62 0.00% 60 70 0.00% 61 63 0.00% 62 81 0.00% 63 101 0.00% 64 110 0.00% 65 117 0.00% 66 141 0.00% 67 155 0.00% 68 178 0.00% 69 205 0.00% 70 215 0.00% 71 217 0.00% 72 276 0.00% 73 314 0.00% 74 369 0.00% 75 402 0.00% 76 482 0.00% 77 498 0.00% 78 593 0.00% 79 683 0.00% 80 751 0.00% 81 840 0.01% 82 995 0.01% 83 1187 0.01% 84 2031 0.01% 85 2610 0.02% 86 2799 0.02% 87 2802 0.02% 88 2817 0.02% 89 3088 0.02% 90 3205 0.02% 91 3452 0.02% 92 3608 0.02% 93 3797 0.02% 94 4221 0.03% 95 4545 0.03% 96 4753 0.03% 97 5280 0.03% 98 5433 0.03% 99 5804 0.04% 100 6468 0.04% 101 6766 0.04% 102 7261 0.05% 103 7858 0.05% 104 8616 0.05% 105 9014 0.06% 106 9698 0.06% 107 10079 0.06% 108 10927 0.07% 109 11433 0.07% 110 12133 0.08% 111 12678 0.08% 112 13636 0.09% 113 14288 0.09% 114 15476 0.10% 115 16232 0.10% 116 17323 0.11% 117 18234 0.11% 118 19280 0.12% 119 20036 0.12% 120 20798 0.13% 121 21448 0.13% 122 22834 0.14% 123 24003 0.15% 124 25338 0.16% 125 26714 0.17% 126 27945 0.17% 127 29056 0.18% 128 30344 0.19% 129 31521 0.20% 130 32993 0.21% 131 34151 0.21% 132 36271 0.23% 133 38808 0.24% 134 40583 0.25% 135 42484 0.26% 136 45385 0.28% 137 47542 0.30% 138 49847 0.31% 139 53504 0.33% 140 56432 0.35% 141 60806 0.38% 142 66827 0.42% 143 73304 0.46% 144 83764 0.52% 145 98943 0.62% 146 122839 0.77% 147 174957 1.09% 148 233497 1.46% 149 487769 3.04% 150 3609840 22.52% 151 9964634 62.15% 16032519 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=5.56 fanout-score-rank=14 prefix-density=0.74 prefix-fanout=3.8 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=235.19 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.4 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=6.18 fanout-score-rank=18 prefix-density=0.55 prefix-fanout=3.9 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=101.39 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=18.1 sequence=CAAGAAGAAGGT SRR6958419 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:43:51 Started mapping on | Dec 06 22:43:52 Finished on | Dec 06 22:45:28 Mapping speed, Million of reads per hour | 601.22 Number of input reads | 16032519 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15458352 Uniquely mapped reads % | 96.42% Average mapped length | 296.62 Number of splices: Total | 18681925 Number of splices: Annotated (sjdb) | 17566132 Number of splices: GT/AG | 18420895 Number of splices: GC/AG | 219375 Number of splices: AT/AC | 7766 Number of splices: Non-canonical | 33889 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195388 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 5061 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 391298 391298 391298 N_multimapping 195388 195388 195388 N_noFeature 497679 15056971 596073 N_ambiguous 361642 1895 59772 UnstrandedReadsAssigned:14599031 PositiveStrandReadsAssigned:399486 NegativeStrandReadsAssigned:14802507 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958419 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958419-trimmed-pair1.fastq SRR6958419-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,032,519 reads, 14,787,421 reads pseudoaligned [quant] estimated average fragment length: 264.175 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR6958419.ke.tsv 35125 SRR6958419.se.tsv 88098 total ==> SRR6958419.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.326 0 0 PNS24247 1044 780.825 40.9308 5.14311 PNS24249 1928 1664.83 41.2711 2.43224 PNS24246 1044 780.825 40.9308 5.14311 PNS24248 1044 780.825 40.9308 5.14311 PNS24244 1471 1207.83 42.9364 3.4878 PNS24243 293 84.0583 1 1.16721 KQK14069 1603 1339.83 1704.6 124.826 KQK14071 474 225.432 22.1711 9.64943 ==> SRR6958419.se.tsv <== BRADI_1g14170v3 1881 BRADI_1g53295v3 1203 BRADI_1g59795v3 79 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 383 BRADI_1g74790v3 105 BRADI_1g09890v3 0 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR6958419 completed mapping pipeline successfully