Starting /dee2/code/volunteer_pipeline.sh SRR6958421 current disk space = 1548579053568 free memory = 1603479788 SRR6958421 SRAfilesize ef6462bfe28944ab315dafadf8c34cd7 SRR6958421.sra SRR6958421.sra file validated SRR6958421 is paired end SRR6958421 is conventional basespace SRR6958421 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5135 32.0 18.0 33.0 18.0 34.0 2 30.265 31.0 27.0 33.0 27.0 34.0 3 32.1285 33.0 31.0 33.0 29.0 34.0 4 32.67375 33.0 33.0 34.0 31.0 34.0 5 33.0995 33.0 33.0 34.0 33.0 34.0 6 36.875 38.0 37.0 38.0 36.0 38.0 7 37.37025 38.0 38.0 38.0 37.0 38.0 8 37.6105 38.0 38.0 38.0 38.0 38.0 9 37.32975 38.0 38.0 38.0 37.0 38.0 10-14 37.2808 38.0 38.0 38.0 36.8 38.0 15-19 37.587050000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.4841 38.0 38.0 38.0 37.6 38.0 25-29 37.56765 38.0 38.0 38.0 37.6 38.0 30-34 37.6238 38.0 38.0 38.0 38.0 38.0 35-39 37.56485 38.0 38.0 38.0 37.8 38.0 40-44 37.5642 38.0 38.0 38.0 37.8 38.0 45-49 37.432249999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.4139 38.0 38.0 38.0 37.0 38.0 55-59 37.196600000000004 38.0 38.0 38.0 36.4 38.0 60-64 37.30310000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.24105 38.0 38.0 38.0 36.2 38.0 70-74 36.76955 38.0 38.0 38.0 34.8 38.0 75-79 37.1848 38.0 38.0 38.0 36.2 38.0 80-84 37.10265 38.0 38.0 38.0 36.0 38.0 85-89 37.0458 38.0 38.0 38.0 36.0 38.0 90-94 36.9852 38.0 38.0 38.0 35.6 38.0 95-99 36.966899999999995 38.0 38.0 38.0 35.8 38.0 100-104 36.81515 38.0 38.0 38.0 35.0 38.0 105-109 36.67645 38.0 38.0 38.0 34.2 38.0 110-114 36.572500000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.364599999999996 38.0 37.4 38.0 33.8 38.0 120-124 36.3318 38.0 37.6 38.0 33.8 38.0 125-129 36.109300000000005 38.0 37.2 38.0 33.2 38.0 130-134 35.959 38.0 36.6 38.0 32.8 38.0 135-139 35.658699999999996 38.0 36.0 38.0 31.4 38.0 140-144 35.394 38.0 35.6 38.0 30.8 38.0 145-149 34.637899999999995 38.0 35.0 38.0 28.0 38.0 150-151 30.591 35.5 28.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 2.0 24 3.0 25 7.0 26 6.0 27 13.0 28 18.0 29 13.0 30 35.0 31 44.0 32 51.0 33 97.0 34 179.0 35 281.0 36 739.0 37 2506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.57941550190597 11.33418043202033 9.783989834815756 46.30241423125794 2 19.175 13.925 39.300000000000004 27.6 3 20.810405202601302 15.307653826913455 26.138069034517258 37.74387193596798 4 24.224999999999998 24.8 23.625 27.35 5 25.3 31.05 24.3 19.35 6 22.7 34.725 23.5 19.075 7 15.825 26.674999999999997 39.4 18.099999999999998 8 19.075 25.7 30.599999999999998 24.625 9 18.525 22.3 35.425000000000004 23.75 10-14 20.979999999999997 29.185 27.485 22.35 15-19 20.945 27.72 27.750000000000004 23.585 20-24 21.245 28.605000000000004 27.215 22.935 25-29 21.65 29.020000000000003 26.845000000000002 22.485 30-34 21.4 28.754999999999995 27.060000000000002 22.785 35-39 21.945 27.325 27.655 23.075000000000003 40-44 22.365 27.994999999999997 26.590000000000003 23.05 45-49 21.195 27.735 27.48 23.59 50-54 21.8 28.78 26.565 22.855 55-59 21.415 27.92 26.724999999999998 23.94 60-64 21.315 28.01 27.315 23.36 65-69 21.765 27.455000000000002 26.900000000000002 23.880000000000003 70-74 21.54 27.515 26.715 24.23 75-79 20.77 27.644999999999996 27.605 23.98 80-84 21.13 27.74 26.895000000000003 24.235 85-89 21.485000000000003 27.73 26.729999999999997 24.055 90-94 21.654999999999998 27.555000000000003 27.495000000000005 23.294999999999998 95-99 21.990000000000002 27.16 26.995 23.855 100-104 21.564312862572514 28.450690138027607 26.510302060412084 23.4746949389878 105-109 21.205 28.144999999999996 27.02 23.630000000000003 110-114 21.959881946876095 27.837526887099195 26.802060927417337 23.400530238607374 115-119 21.81072018417497 28.57714829087633 27.185826535208445 22.426304989740252 120-124 21.825 26.900000000000002 27.189999999999998 24.085 125-129 22.295673076923077 27.44391025641026 26.637620192307693 23.622796474358974 130-134 21.38175996798239 27.610185602081145 27.25999299614788 23.748061433788585 135-139 21.654999999999998 27.334999999999997 26.640000000000004 24.37 140-144 21.745 27.41 26.61 24.235 145-149 22.075 27.305 26.395000000000003 24.224999999999998 150-151 22.25 27.237499999999997 25.7125 24.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.5 27 4.0 28 4.5 29 6.5 30 15.0 31 22.0 32 24.5 33 30.5 34 48.0 35 67.0 36 87.0 37 111.5 38 123.5 39 154.5 40 185.5 41 201.0 42 228.0 43 239.0 44 254.5 45 254.5 46 237.0 47 248.5 48 234.0 49 191.0 50 160.0 51 128.5 52 109.5 53 102.0 54 84.0 55 70.5 56 62.0 57 49.5 58 40.5 59 36.5 60 30.5 61 24.0 62 21.5 63 16.5 64 16.0 65 16.5 66 14.0 67 11.5 68 7.0 69 3.5 70 3.5 71 4.0 72 3.5 73 3.0 74 2.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.045 115-119 0.095 120-124 0.0 125-129 0.16 130-134 0.055 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.3875000000000002 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.7874999999999996 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACGTA 10 0.006832588 144.9875 2 >>END_MODULE SRR6958421 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958421_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.205 33.0 33.0 34.0 33.0 34.0 2 33.33475 34.0 33.0 34.0 33.0 34.0 3 33.318 34.0 33.0 34.0 33.0 34.0 4 33.2565 34.0 33.0 34.0 33.0 34.0 5 33.38875 34.0 33.0 34.0 33.0 34.0 6 37.4495 38.0 38.0 38.0 38.0 38.0 7 37.50425 38.0 38.0 38.0 38.0 38.0 8 37.5255 38.0 38.0 38.0 38.0 38.0 9 37.437 38.0 38.0 38.0 38.0 38.0 10-14 36.866 38.0 37.8 38.0 35.0 38.0 15-19 37.384499999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.44825 38.0 38.0 38.0 38.0 38.0 25-29 37.48935 38.0 38.0 38.0 38.0 38.0 30-34 37.59015 38.0 38.0 38.0 38.0 38.0 35-39 36.847300000000004 38.0 38.0 38.0 35.4 38.0 40-44 37.48100000000001 38.0 38.0 38.0 37.8 38.0 45-49 37.2606 38.0 38.0 38.0 37.0 38.0 50-54 37.0323 38.0 38.0 38.0 35.6 38.0 55-59 36.83605 38.0 37.8 38.0 34.8 38.0 60-64 37.4608 38.0 38.0 38.0 38.0 38.0 65-69 37.28240000000001 38.0 38.0 38.0 37.4 38.0 70-74 37.41 38.0 38.0 38.0 37.4 38.0 75-79 37.15405 38.0 38.0 38.0 36.6 38.0 80-84 37.372049999999994 38.0 38.0 38.0 37.4 38.0 85-89 37.36435 38.0 38.0 38.0 37.2 38.0 90-94 37.25625 38.0 38.0 38.0 37.0 38.0 95-99 37.21040000000001 38.0 38.0 38.0 37.0 38.0 100-104 36.5395 38.0 37.8 38.0 33.4 38.0 105-109 36.0892 38.0 37.2 38.0 30.2 38.0 110-114 36.78855 38.0 38.0 38.0 34.8 38.0 115-119 36.99225 38.0 38.0 38.0 36.0 38.0 120-124 36.8455 38.0 38.0 38.0 35.4 38.0 125-129 36.66785 38.0 38.0 38.0 35.0 38.0 130-134 36.49535 38.0 38.0 38.0 34.4 38.0 135-139 36.214800000000004 38.0 38.0 38.0 33.8 38.0 140-144 35.698 38.0 36.4 38.0 31.8 38.0 145-149 35.2997 38.0 36.8 38.0 31.0 38.0 150-151 31.006750000000004 35.5 29.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 3.0 17 1.0 18 1.0 19 3.0 20 4.0 21 1.0 22 4.0 23 3.0 24 3.0 25 10.0 26 5.0 27 17.0 28 13.0 29 18.0 30 33.0 31 35.0 32 50.0 33 58.0 34 100.0 35 207.0 36 501.0 37 2927.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.824999999999996 18.175 14.174999999999999 34.825 2 28.675 23.375 30.925000000000004 17.025000000000002 3 21.975 26.825 29.325000000000003 21.875 4 23.974999999999998 31.8 23.325000000000003 20.9 5 26.5 34.325 20.724999999999998 18.45 6 20.65 37.2 23.125 19.025 7 20.45 21.125 37.4 21.025 8 23.325000000000003 23.95 27.900000000000002 24.825 9 23.599999999999998 23.325000000000003 30.15 22.925 10-14 24.825 27.794999999999998 25.05 22.33 15-19 24.474999999999998 26.545 26.38 22.6 20-24 23.96 27.650000000000002 26.305 22.085 25-29 24.15 27.279999999999998 26.174999999999997 22.395 30-34 24.26 26.93 27.034999999999997 21.775 35-39 24.075 27.339999999999996 26.090000000000003 22.495 40-44 24.495 27.339999999999996 26.36 21.805 45-49 24.03 26.91 26.650000000000002 22.41 50-54 24.185000000000002 27.189999999999998 26.729999999999997 21.895 55-59 24.48 26.765 26.924999999999997 21.83 60-64 24.125 27.145000000000003 27.250000000000004 21.48 65-69 24.47 27.345000000000002 26.82 21.365000000000002 70-74 24.18 27.565 26.369999999999997 21.884999999999998 75-79 24.25 27.0 27.355 21.395 80-84 23.735 27.985 26.6 21.68 85-89 23.845 27.11 27.27 21.775 90-94 23.805 27.515 26.8 21.88 95-99 24.0 27.3 27.139999999999997 21.560000000000002 100-104 24.025 27.389999999999997 27.13 21.455 105-109 23.605 27.775 27.07 21.55 110-114 23.865 27.315 27.205000000000002 21.615000000000002 115-119 24.755 27.015 27.33 20.9 120-124 23.69 27.575 27.075 21.66 125-129 23.945 27.275 27.065 21.715 130-134 23.665 27.245 27.42 21.67 135-139 24.315 27.58 27.57 20.535 140-144 25.05 27.55 26.995 20.405 145-149 24.595 27.61 26.82 20.974999999999998 150-151 24.4375 27.224999999999998 27.6375 20.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 0.5 24 1.0 25 1.5 26 1.0 27 5.0 28 8.5 29 9.5 30 13.0 31 18.5 32 23.0 33 24.0 34 37.5 35 51.5 36 67.0 37 91.0 38 107.0 39 134.0 40 171.5 41 190.0 42 205.5 43 242.0 44 257.0 45 259.0 46 254.5 47 219.0 48 199.5 49 187.5 50 164.5 51 150.5 52 126.0 53 99.5 54 84.5 55 79.5 56 76.0 57 65.0 58 56.5 59 46.0 60 40.0 61 33.5 62 30.0 63 33.0 64 30.0 65 25.0 66 21.5 67 17.0 68 10.5 69 8.0 70 6.5 71 3.5 72 3.0 73 1.5 74 1.5 75 2.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.7874999999999996 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556835 spots for SRR6958421.sra Written 556835 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra Read 556824 spots for SRR6958421.sra Written 556824 spots for SRR6958421.sra SRR ids: ['SRR6958421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n3gopxz5 SRR6958421.sra spots: 11136491 blocks: [[1, 556824], [556825, 1113648], [1113649, 1670472], [1670473, 2227296], [2227297, 2784120], [2784121, 3340944], [3340945, 3897768], [3897769, 4454592], [4454593, 5011416], [5011417, 5568240], [5568241, 6125064], [6125065, 6681888], [6681889, 7238712], [7238713, 7795536], [7795537, 8352360], [8352361, 8909184], [8909185, 9466008], [9466009, 10022832], [10022833, 10579656], [10579657, 11136491]] SRR6958421 file size 3752091 SRR6958421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958421 SRR6958421_1.fastq SRR6958421_2.fastq Input file: SRR6958421_1.fastq Paired file: SRR6958421_2.fastq trimmed: SRR6958421-trimmed-pair1.fastq, SRR6958421-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:40:14 2024 >> started Fri Dec 6 22:40:26 2024 >> done (11.280s) 11136491 read pairs processed; of these: 4472 ( 0.04%) short read pairs filtered out after trimming by size control 2163 ( 0.02%) empty read pairs filtered out after trimming by size control 11129856 (99.94%) read pairs available; of these: 3704688 (33.29%) trimmed read pairs available after processing 7425168 (66.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 1 0.00% 26 4 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 7 0.00% 35 3 0.00% 36 2 0.00% 37 3 0.00% 38 4 0.00% 39 5 0.00% 40 4 0.00% 41 4 0.00% 42 9 0.00% 43 3 0.00% 44 8 0.00% 45 7 0.00% 46 4 0.00% 47 5 0.00% 48 6 0.00% 49 13 0.00% 50 9 0.00% 51 13 0.00% 52 11 0.00% 53 18 0.00% 54 12 0.00% 55 13 0.00% 56 26 0.00% 57 29 0.00% 58 31 0.00% 59 27 0.00% 60 43 0.00% 61 42 0.00% 62 44 0.00% 63 38 0.00% 64 42 0.00% 65 65 0.00% 66 86 0.00% 67 72 0.00% 68 85 0.00% 69 103 0.00% 70 114 0.00% 71 121 0.00% 72 119 0.00% 73 137 0.00% 74 178 0.00% 75 192 0.00% 76 254 0.00% 77 272 0.00% 78 281 0.00% 79 327 0.00% 80 390 0.00% 81 469 0.00% 82 480 0.00% 83 593 0.01% 84 734 0.01% 85 882 0.01% 86 960 0.01% 87 1060 0.01% 88 1189 0.01% 89 1328 0.01% 90 1327 0.01% 91 1589 0.01% 92 1700 0.02% 93 1716 0.02% 94 1966 0.02% 95 2142 0.02% 96 2187 0.02% 97 2429 0.02% 98 2632 0.02% 99 2748 0.02% 100 3197 0.03% 101 3420 0.03% 102 3685 0.03% 103 3849 0.03% 104 4302 0.04% 105 4396 0.04% 106 4808 0.04% 107 5050 0.05% 108 5422 0.05% 109 5914 0.05% 110 5991 0.05% 111 6474 0.06% 112 6835 0.06% 113 7429 0.07% 114 8033 0.07% 115 8415 0.08% 116 8812 0.08% 117 9214 0.08% 118 9629 0.09% 119 9953 0.09% 120 10485 0.09% 121 10934 0.10% 122 11709 0.11% 123 12405 0.11% 124 13055 0.12% 125 13522 0.12% 126 14108 0.13% 127 14975 0.13% 128 15540 0.14% 129 16357 0.15% 130 17514 0.16% 131 18258 0.16% 132 18877 0.17% 133 20318 0.18% 134 21028 0.19% 135 22480 0.20% 136 23876 0.21% 137 25464 0.23% 138 27096 0.24% 139 29196 0.26% 140 31585 0.28% 141 34055 0.31% 142 38280 0.34% 143 42665 0.38% 144 49113 0.44% 145 58841 0.53% 146 73250 0.66% 147 100336 0.90% 148 156071 1.40% 149 332761 2.99% 150 2274269 20.43% 151 7425168 66.71% 11129856 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=74.35 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=3.2 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=112.49 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.0 sequence=TCATCTTCCCCGCCGATGCCATCGCCCGGGCCAAGCACTACCTCTCCATGGCGCCCGGTGGTTTAGGTGCCTACAGTGACTCCCGAGGTATCCCCGGAGTTAGGAAGGAAGTTGCCGAGTTCATTCAGAGGCGTGACGGGTATCCGAGTGATCCGGAGCTTATTTACCTGACTGATGGTGCCAGCAAAGGTGTGATGCAAATGCTCAACGCCATTATCAGAAACGAGAGAGACGGGATTTTGGTCCCTGTTCCACAATACCCGCTTTATTCTGCAGCCATTTCTCTCTTTGGTGGCTCGCTTGTCCCATATTACTTAGAAGAAGAGGCTAACTGGGGACTCGACATTGTAACTACCCGGCAATCAGTAGCAGCTGCACGGTCCAAGGGGATGACTGTTCGAGCAATGGTGATTATTAATCCTGGAAACCCCACTGGCCAATGCCTAAGTGAAGCAAATATCAGGGAACTTCTGAATTTTTGTTATCAGGAAAACTTAGTTCTGCTTGCAGA SRR6958421 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:41:08 Started mapping on | Dec 06 22:41:09 Finished on | Dec 06 22:42:18 Mapping speed, Million of reads per hour | 580.69 Number of input reads | 11129856 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10899043 Uniquely mapped reads % | 97.93% Average mapped length | 298.04 Number of splices: Total | 13159512 Number of splices: Annotated (sjdb) | 12431564 Number of splices: GT/AG | 12989324 Number of splices: GC/AG | 148929 Number of splices: AT/AC | 5348 Number of splices: Non-canonical | 15911 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101546 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 3652 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 130969 130969 130969 N_multimapping 101546 101546 101546 N_noFeature 474160 10610898 559401 N_ambiguous 242533 1307 40416 UnstrandedReadsAssigned:10182350 PositiveStrandReadsAssigned:286838 NegativeStrandReadsAssigned:10299226 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958421 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958421-trimmed-pair1.fastq SRR6958421-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,129,856 reads, 10,303,602 reads pseudoaligned [quant] estimated average fragment length: 242.455 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR6958421.ke.tsv 35125 SRR6958421.se.tsv 88098 total ==> SRR6958421.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.868 0 0 PNS24247 1044 802.545 47.2192 9.14267 PNS24249 1928 1686.55 7.5297 0.693751 PNS24246 1044 802.545 47.2192 9.14267 PNS24248 1044 802.545 47.2192 9.14267 PNS24244 1471 1229.55 30.8126 3.89411 PNS24243 293 81.933 0 0 KQK14069 1603 1361.55 931.974 106.364 KQK14071 474 236.665 8.31422 5.45898 ==> SRR6958421.se.tsv <== BRADI_1g14170v3 1070 BRADI_1g53295v3 274 BRADI_1g59795v3 213 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 222 BRADI_1g74790v3 74 BRADI_1g09890v3 0 BRADI_1g77505v3 181 BRADI_1g48960v3 0 SRR6958421 completed mapping pipeline successfully