Starting /dee2/code/volunteer_pipeline.sh SRR6958422 current disk space = 1548599357440 free memory = 1600039740 SRR6958422 SRAfilesize 922ef7aae5e72b1e2b9e471c3cc167da SRR6958422.sra SRR6958422.sra file validated SRR6958422 is paired end SRR6958422 is conventional basespace SRR6958422 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.56225 33.0 30.0 33.0 18.0 33.0 2 30.305 31.0 29.0 33.0 25.0 34.0 3 30.61375 33.0 29.0 33.0 27.0 34.0 4 31.16675 33.0 31.0 33.0 28.0 34.0 5 31.4935 33.0 32.0 33.0 28.0 33.0 6 36.493 38.0 37.0 38.0 34.0 38.0 7 36.86425 38.0 38.0 38.0 35.0 38.0 8 37.157 38.0 38.0 38.0 36.0 38.0 9 37.3875 38.0 38.0 38.0 37.0 38.0 10-14 37.370999999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.3875 38.0 38.0 38.0 37.0 38.0 20-24 37.4066 38.0 38.0 38.0 37.0 38.0 25-29 37.3677 38.0 38.0 38.0 37.0 38.0 30-34 37.228300000000004 38.0 38.0 38.0 36.6 38.0 35-39 37.07489999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.97255 38.0 38.0 38.0 35.8 38.0 45-49 37.070899999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.11775 38.0 38.0 38.0 36.0 38.0 55-59 36.79195 38.0 38.0 38.0 34.8 38.0 60-64 36.9077 38.0 38.0 38.0 35.0 38.0 65-69 36.90984999999999 38.0 38.0 38.0 35.2 38.0 70-74 36.86835 38.0 38.0 38.0 34.8 38.0 75-79 36.60795 38.0 38.0 38.0 34.2 38.0 80-84 36.31935 38.0 37.4 38.0 33.6 38.0 85-89 36.164899999999996 38.0 37.0 38.0 32.8 38.0 90-94 36.33205 38.0 37.2 38.0 33.8 38.0 95-99 36.21395 38.0 37.0 38.0 33.2 38.0 100-104 36.1476 38.0 37.0 38.0 33.0 38.0 105-109 35.748599999999996 38.0 36.4 38.0 31.4 38.0 110-114 35.37930000000001 38.0 35.8 38.0 29.2 38.0 115-119 35.3337 38.0 35.4 38.0 29.4 38.0 120-124 35.1834 38.0 35.2 38.0 29.0 38.0 125-129 34.84865 38.0 35.0 38.0 27.4 38.0 130-134 34.588350000000005 38.0 35.0 38.0 26.0 38.0 135-139 34.50345 38.0 35.0 38.0 26.2 38.0 140-144 33.842200000000005 38.0 34.0 38.0 23.0 38.0 145-149 32.36215000000001 36.8 32.8 38.0 14.2 38.0 150-151 28.283125 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 0.0 17 0.0 18 2.0 19 1.0 20 2.0 21 4.0 22 3.0 23 7.0 24 5.0 25 15.0 26 20.0 27 17.0 28 39.0 29 52.0 30 54.0 31 89.0 32 110.0 33 170.0 34 235.0 35 430.0 36 969.0 37 1771.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.18257261410788 9.854771784232366 8.843360995850622 40.11929460580913 2 24.525 11.899999999999999 35.325 28.249999999999996 3 20.674999999999997 16.35 25.424999999999997 37.55 4 24.3 23.25 24.349999999999998 28.1 5 23.53088272068017 28.532133033258315 25.18129532383096 22.755688922230558 6 22.525000000000002 32.2 24.525 20.75 7 17.95 23.549999999999997 39.6 18.9 8 19.925 24.375 30.45 25.25 9 19.975 21.325 34.625 24.075 10-14 22.38 26.915 26.26 24.445 15-19 21.98 26.005 26.450000000000003 25.564999999999998 20-24 21.66 26.61 26.85 24.88 25-29 21.815 26.345000000000002 26.345000000000002 25.495 30-34 22.59 25.8 26.945000000000004 24.665 35-39 22.36 25.585 27.05 25.005 40-44 22.38 26.240000000000002 26.435 24.945 45-49 22.54 25.185000000000002 26.815 25.46 50-54 22.095000000000002 25.82 26.99 25.095 55-59 23.105 26.165 26.46 24.27 60-64 22.05 26.16 26.77 25.019999999999996 65-69 22.37 25.44 26.845000000000002 25.345000000000002 70-74 23.0 26.13 26.105 24.765 75-79 22.425 25.795 26.290000000000003 25.490000000000002 80-84 22.295 25.869999999999997 26.715 25.119999999999997 85-89 22.650000000000002 25.840000000000003 26.040000000000003 25.47 90-94 23.06 25.785000000000004 26.025 25.130000000000003 95-99 22.264999999999997 26.125 26.634999999999998 24.975 100-104 22.415 25.44 26.455000000000002 25.69 105-109 22.835 25.485000000000003 26.724999999999998 24.955 110-114 22.495 25.729999999999997 26.455000000000002 25.319999999999997 115-119 22.720000000000002 25.865 26.029999999999998 25.385 120-124 23.16 25.6 26.369999999999997 24.87 125-129 22.509999999999998 25.785000000000004 26.615 25.09 130-134 23.125 26.424999999999997 25.495 24.955 135-139 22.75 26.32 26.009999999999998 24.92 140-144 22.675 25.955000000000002 26.1 25.27 145-149 23.565 25.825 25.395 25.215 150-151 22.11105552776388 25.22511255627814 27.00100050025013 25.662831415707853 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 3.0 29 7.0 30 9.5 31 11.5 32 15.5 33 23.5 34 33.0 35 39.5 36 51.0 37 63.5 38 84.5 39 120.5 40 144.5 41 174.5 42 205.0 43 221.0 44 233.0 45 239.5 46 247.5 47 232.5 48 198.5 49 162.0 50 156.0 51 152.5 52 134.5 53 125.5 54 99.0 55 75.5 56 79.0 57 84.5 58 65.5 59 56.5 60 57.0 61 52.5 62 45.5 63 40.5 64 42.0 65 39.0 66 31.5 67 28.0 68 24.5 69 20.0 70 15.5 71 11.0 72 9.5 73 7.5 74 9.5 75 7.5 76 2.5 77 1.5 78 1.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0125 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.025 0.025 0.0 0.0 0.0 90-91 0.025 0.025 0.0 0.0 0.0 92-93 0.07500000000000001 0.025 0.0 0.0 0.0 94-95 0.1 0.025 0.0 0.0 0.0 96-97 0.1375 0.025 0.0 0.0 0.0 98-99 0.15 0.025 0.0 0.0 0.0 100-101 0.15 0.025 0.0 0.0 0.0 102-103 0.15 0.025 0.0 0.0 0.0 104-105 0.15 0.025 0.0 0.0 0.0 106-107 0.15 0.025 0.0 0.0 0.0 108-109 0.175 0.025 0.0 0.0 0.0 110-111 0.2375 0.025 0.0 0.0 0.0 112-113 0.3375 0.025 0.0 0.0 0.0 114-115 0.4125 0.025 0.0 0.0 0.0 116-117 0.5375 0.025 0.0 0.0 0.0 118-119 0.625 0.025 0.0 0.0 0.0 120-121 0.75 0.025 0.0 0.0 0.0 122-123 0.8625 0.025 0.0 0.0 0.0 124-125 1.0 0.025 0.0 0.0 0.0 126-127 1.15 0.025 0.0 0.0 0.0 128-129 1.3624999999999998 0.025 0.0 0.0 0.0 130-131 1.5625 0.025 0.0 0.0 0.0 132-133 1.675 0.025 0.0 0.0 0.0 134-135 1.9 0.025 0.0 0.0 0.0 136-137 2.1125 0.025 0.0 0.0 0.0 138-139 2.35 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958422 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958422_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89225 33.0 33.0 34.0 32.0 34.0 2 32.88625 33.0 33.0 34.0 32.0 34.0 3 32.77825 33.0 33.0 34.0 32.0 34.0 4 32.84025 33.0 33.0 34.0 32.0 34.0 5 32.952 34.0 33.0 34.0 32.0 34.0 6 37.11125 38.0 38.0 38.0 36.0 38.0 7 36.995 38.0 38.0 38.0 36.0 38.0 8 37.105 38.0 38.0 38.0 36.0 38.0 9 36.96375 38.0 38.0 38.0 36.0 38.0 10-14 36.86370000000001 38.0 38.0 38.0 35.6 38.0 15-19 36.833600000000004 38.0 38.0 38.0 35.2 38.0 20-24 36.8765 38.0 38.0 38.0 35.4 38.0 25-29 36.94805 38.0 38.0 38.0 35.8 38.0 30-34 36.9745 38.0 38.0 38.0 36.0 38.0 35-39 36.83275 38.0 38.0 38.0 35.4 38.0 40-44 36.76815 38.0 38.0 38.0 35.0 38.0 45-49 36.7005 38.0 38.0 38.0 35.0 38.0 50-54 36.71925 38.0 38.0 38.0 35.0 38.0 55-59 36.6727 38.0 38.0 38.0 34.6 38.0 60-64 36.73949999999999 38.0 38.0 38.0 34.8 38.0 65-69 36.457899999999995 38.0 38.0 38.0 33.8 38.0 70-74 36.4 38.0 38.0 38.0 34.0 38.0 75-79 36.16795 38.0 37.6 38.0 32.8 38.0 80-84 36.109300000000005 38.0 37.2 38.0 32.6 38.0 85-89 35.974799999999995 38.0 37.2 38.0 32.2 38.0 90-94 35.81955000000001 38.0 37.0 38.0 31.8 38.0 95-99 35.78675 38.0 37.0 38.0 31.2 38.0 100-104 35.638850000000005 38.0 36.8 38.0 31.0 38.0 105-109 35.27985 38.0 35.8 38.0 29.2 38.0 110-114 35.09505 38.0 35.8 38.0 28.2 38.0 115-119 34.9473 38.0 35.2 38.0 27.8 38.0 120-124 34.765699999999995 38.0 35.0 38.0 27.2 38.0 125-129 34.5216 38.0 35.0 38.0 25.8 38.0 130-134 34.14919999999999 38.0 34.6 38.0 23.8 38.0 135-139 33.5669 38.0 33.8 38.0 20.4 38.0 140-144 33.0707 38.0 33.2 38.0 17.0 38.0 145-149 32.0227 37.8 31.4 38.0 13.2 38.0 150-151 27.519625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 2.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 3.0 12 2.0 13 1.0 14 2.0 15 0.0 16 4.0 17 3.0 18 1.0 19 4.0 20 4.0 21 6.0 22 12.0 23 12.0 24 18.0 25 20.0 26 32.0 27 33.0 28 39.0 29 55.0 30 59.0 31 89.0 32 117.0 33 168.0 34 224.0 35 374.0 36 832.0 37 1873.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.25881470367592 18.929732433108278 11.552888222055515 34.25856464116029 2 29.349999999999998 24.349999999999998 29.625 16.675 3 22.255563890972745 25.23130782695674 28.457114278569644 24.056014003500874 4 25.025 31.125000000000004 21.275 22.575 5 27.93198299574894 33.50837709427357 20.030007501875467 18.529632408102024 6 23.075000000000003 36.375 21.45 19.1 7 22.225 19.725 36.1 21.95 8 23.674999999999997 23.625 25.75 26.950000000000003 9 23.925 22.05 28.025 26.0 10-14 25.16 27.63 24.01 23.200000000000003 15-19 25.4 26.13 24.865000000000002 23.605 20-24 24.990000000000002 26.545 25.27 23.195 25-29 24.77 26.125 24.92 24.185000000000002 30-34 25.009999999999998 26.435 25.275 23.28 35-39 25.005 26.724999999999998 24.98 23.29 40-44 25.77 26.02 24.87 23.34 45-49 25.06 26.179999999999996 25.380000000000003 23.380000000000003 50-54 25.505 26.135 25.335 23.025000000000002 55-59 25.040000000000003 26.150000000000002 25.330000000000002 23.48 60-64 24.69 26.55 25.595000000000002 23.165 65-69 24.745 25.985000000000003 25.91 23.36 70-74 25.205 25.66 25.185000000000002 23.95 75-79 24.98 26.340000000000003 25.715 22.965 80-84 25.415 25.790000000000003 25.665 23.13 85-89 25.740000000000002 26.005 24.975 23.28 90-94 25.374999999999996 25.825 25.385 23.415 95-99 25.009999999999998 26.784999999999997 25.305 22.900000000000002 100-104 25.22 26.155 25.185000000000002 23.44 105-109 25.275 26.125 26.174999999999997 22.425 110-114 25.314999999999998 26.279999999999998 25.215 23.189999999999998 115-119 25.82 25.900000000000002 25.75 22.53 120-124 25.785000000000004 26.33 25.330000000000002 22.555 125-129 25.014999999999997 26.56 25.629999999999995 22.795 130-134 25.509999999999998 26.43 25.845000000000002 22.215 135-139 25.645 25.985000000000003 26.075 22.295 140-144 25.6 26.590000000000003 25.16 22.650000000000002 145-149 25.074999999999996 26.345000000000002 25.495 23.085 150-151 26.050525262631314 26.463231615807903 25.662831415707853 21.823411705852926 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 2.0 26 2.5 27 3.0 28 6.0 29 7.0 30 6.0 31 10.5 32 18.0 33 21.0 34 26.5 35 33.5 36 50.0 37 69.5 38 80.0 39 107.0 40 144.0 41 153.5 42 171.5 43 200.5 44 219.5 45 232.0 46 210.0 47 199.0 48 189.0 49 182.0 50 179.5 51 159.5 52 140.0 53 109.5 54 95.5 55 93.5 56 91.5 57 92.0 58 76.5 59 64.0 60 58.5 61 52.5 62 54.0 63 52.0 64 49.5 65 41.5 66 40.5 67 39.5 68 30.5 69 31.0 70 28.0 71 23.0 72 17.5 73 12.0 74 7.5 75 4.0 76 4.0 77 3.5 78 1.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24204143506822 98.2 2 0.5305709954522486 1.05 3 0.17685699848408287 0.525 4 0.025265285497726126 0.1 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5375 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.3624999999999998 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.675 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.125 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCTGC 10 0.006830828 145.0 145 >>END_MODULE Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099292 spots for SRR6958422.sra Written 1099292 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra Read 1099279 spots for SRR6958422.sra Written 1099279 spots for SRR6958422.sra SRR ids: ['SRR6958422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t46rgjve SRR6958422.sra spots: 21985593 blocks: [[1, 1099279], [1099280, 2198558], [2198559, 3297837], [3297838, 4397116], [4397117, 5496395], [5496396, 6595674], [6595675, 7694953], [7694954, 8794232], [8794233, 9893511], [9893512, 10992790], [10992791, 12092069], [12092070, 13191348], [13191349, 14290627], [14290628, 15389906], [15389907, 16489185], [16489186, 17588464], [17588465, 18687743], [18687744, 19787022], [19787023, 20886301], [20886302, 21985593]] SRR6958422 file size 7428495 SRR6958422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958422 SRR6958422_1.fastq SRR6958422_2.fastq Input file: SRR6958422_1.fastq Paired file: SRR6958422_2.fastq trimmed: SRR6958422-trimmed-pair1.fastq, SRR6958422-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:46:12 2024 >> started Fri Dec 6 22:46:37 2024 >> done (25.217s) 21985593 read pairs processed; of these: 13052 ( 0.06%) short read pairs filtered out after trimming by size control 10629 ( 0.05%) empty read pairs filtered out after trimming by size control 21961912 (99.89%) read pairs available; of these: 7750216 (35.29%) trimmed read pairs available after processing 14211696 (64.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 7 0.00% 22 5 0.00% 23 6 0.00% 24 4 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 6 0.00% 29 6 0.00% 30 5 0.00% 31 4 0.00% 32 7 0.00% 33 6 0.00% 34 6 0.00% 35 9 0.00% 36 12 0.00% 37 10 0.00% 38 12 0.00% 39 7 0.00% 40 17 0.00% 41 8 0.00% 42 9 0.00% 43 14 0.00% 44 17 0.00% 45 18 0.00% 46 18 0.00% 47 15 0.00% 48 21 0.00% 49 33 0.00% 50 17 0.00% 51 30 0.00% 52 32 0.00% 53 30 0.00% 54 38 0.00% 55 51 0.00% 56 56 0.00% 57 55 0.00% 58 60 0.00% 59 72 0.00% 60 87 0.00% 61 98 0.00% 62 135 0.00% 63 146 0.00% 64 183 0.00% 65 118 0.00% 66 142 0.00% 67 149 0.00% 68 199 0.00% 69 217 0.00% 70 314 0.00% 71 317 0.00% 72 302 0.00% 73 355 0.00% 74 379 0.00% 75 435 0.00% 76 451 0.00% 77 557 0.00% 78 620 0.00% 79 667 0.00% 80 726 0.00% 81 813 0.00% 82 956 0.00% 83 1129 0.01% 84 1736 0.01% 85 2196 0.01% 86 2285 0.01% 87 2430 0.01% 88 2644 0.01% 89 2767 0.01% 90 3070 0.01% 91 3361 0.02% 92 3283 0.01% 93 3405 0.02% 94 3967 0.02% 95 3949 0.02% 96 4229 0.02% 97 4547 0.02% 98 4878 0.02% 99 5198 0.02% 100 5613 0.03% 101 5933 0.03% 102 6458 0.03% 103 6791 0.03% 104 7203 0.03% 105 7794 0.04% 106 8375 0.04% 107 8805 0.04% 108 9204 0.04% 109 9950 0.05% 110 10484 0.05% 111 11263 0.05% 112 11891 0.05% 113 13052 0.06% 114 13430 0.06% 115 14771 0.07% 116 15056 0.07% 117 15981 0.07% 118 16740 0.08% 119 17942 0.08% 120 18706 0.09% 121 19777 0.09% 122 20527 0.09% 123 22423 0.10% 124 23724 0.11% 125 24588 0.11% 126 26148 0.12% 127 27539 0.13% 128 29100 0.13% 129 30771 0.14% 130 32834 0.15% 131 34741 0.16% 132 36645 0.17% 133 39510 0.18% 134 41968 0.19% 135 44938 0.20% 136 48374 0.22% 137 52142 0.24% 138 55629 0.25% 139 61262 0.28% 140 66520 0.30% 141 73333 0.33% 142 82777 0.38% 143 95071 0.43% 144 111912 0.51% 145 139236 0.63% 146 181085 0.82% 147 241609 1.10% 148 383733 1.75% 149 824313 3.75% 150 4578358 20.85% 151 14211696 64.71% 21961912 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=25 prefix-density=0.61 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=73.89 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.0 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCGCCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCAGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=29 prefix-density=0.46 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=70.51 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.5 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958422 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:47:22 Started mapping on | Dec 06 22:47:22 Finished on | Dec 06 22:49:27 Mapping speed, Million of reads per hour | 632.50 Number of input reads | 21961912 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21563563 Uniquely mapped reads % | 98.19% Average mapped length | 298.24 Number of splices: Total | 25948987 Number of splices: Annotated (sjdb) | 24470910 Number of splices: GT/AG | 25614139 Number of splices: GC/AG | 306914 Number of splices: AT/AC | 10097 Number of splices: Non-canonical | 17837 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 142940 % of reads mapped to multiple loci | 0.65% Number of reads mapped to too many loci | 13236 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 263990 263990 263990 N_multimapping 142940 142940 142940 N_noFeature 814223 20960441 990350 N_ambiguous 509748 2863 83927 UnstrandedReadsAssigned:20239592 PositiveStrandReadsAssigned:600259 NegativeStrandReadsAssigned:20489286 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958422 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958422-trimmed-pair1.fastq SRR6958422-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,961,912 reads, 20,515,805 reads pseudoaligned [quant] estimated average fragment length: 279.396 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52973 SRR6958422.ke.tsv 35125 SRR6958422.se.tsv 88098 total ==> SRR6958422.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.264 0 0 PNS24247 1044 765.604 61.4943 6.01382 PNS24249 1928 1649.6 33.4618 1.51876 PNS24246 1044 765.604 61.4943 6.01382 PNS24248 1044 765.604 61.4943 6.01382 PNS24244 1471 1192.6 27.0553 1.69854 PNS24243 293 75.8025 0 0 KQK14069 1603 1324.6 5768.44 326.056 KQK14071 474 212.486 132.487 46.6835 ==> SRR6958422.se.tsv <== BRADI_1g14170v3 6820 BRADI_1g53295v3 344 BRADI_1g59795v3 332 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 226 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 291 BRADI_1g48960v3 0 SRR6958422 completed mapping pipeline successfully