Starting /dee2/code/volunteer_pipeline.sh SRR6958423 current disk space = 1548530454528 free memory = 1597377440 SRR6958423 SRAfilesize 6c8074d9b7b9c9009f2ac0110d7fb176 SRR6958423.sra SRR6958423.sra file validated SRR6958423 is paired end SRR6958423 is conventional basespace SRR6958423 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958423_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.11 32.0 25.0 33.0 18.0 34.0 2 31.45425 33.0 30.0 33.0 27.0 34.0 3 32.49375 33.0 33.0 34.0 30.0 34.0 4 32.3 33.0 33.0 33.0 31.0 34.0 5 32.77375 33.0 33.0 34.0 31.0 34.0 6 36.04225 37.0 36.0 38.0 33.0 38.0 7 36.92875 38.0 37.0 38.0 35.0 38.0 8 37.48475 38.0 38.0 38.0 37.0 38.0 9 37.0255 38.0 38.0 38.0 36.0 38.0 10-14 37.0727 38.0 38.0 38.0 35.8 38.0 15-19 37.55035 38.0 38.0 38.0 37.6 38.0 20-24 37.43435 38.0 38.0 38.0 37.6 38.0 25-29 37.4747 38.0 38.0 38.0 37.4 38.0 30-34 37.5391 38.0 38.0 38.0 37.6 38.0 35-39 37.510450000000006 38.0 38.0 38.0 37.6 38.0 40-44 37.576350000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.500249999999994 38.0 38.0 38.0 37.4 38.0 50-54 37.38195 38.0 38.0 38.0 36.8 38.0 55-59 37.12420000000001 38.0 38.0 38.0 36.2 38.0 60-64 37.2595 38.0 38.0 38.0 36.8 38.0 65-69 37.205799999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.092 38.0 38.0 38.0 35.8 38.0 75-79 36.8818 38.0 37.8 38.0 35.2 38.0 80-84 37.042950000000005 38.0 38.0 38.0 35.8 38.0 85-89 37.0184 38.0 38.0 38.0 35.8 38.0 90-94 36.7941 38.0 38.0 38.0 34.8 38.0 95-99 36.76115 38.0 38.0 38.0 34.8 38.0 100-104 36.5055 38.0 38.0 38.0 34.0 38.0 105-109 36.3673 38.0 37.6 38.0 34.0 38.0 110-114 36.1914 38.0 37.2 38.0 33.0 38.0 115-119 35.87185 38.0 36.6 38.0 31.8 38.0 120-124 35.794349999999994 38.0 36.4 38.0 31.8 38.0 125-129 35.3662 38.0 35.8 38.0 30.6 38.0 130-134 35.21849999999999 38.0 36.0 38.0 30.0 38.0 135-139 35.03155 38.0 35.2 38.0 28.8 38.0 140-144 34.449200000000005 38.0 33.8 38.0 26.8 38.0 145-149 33.311299999999996 38.0 33.2 38.0 21.0 38.0 150-151 27.565875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 2.0 19 1.0 20 0.0 21 4.0 22 2.0 23 5.0 24 6.0 25 6.0 26 14.0 27 13.0 28 18.0 29 30.0 30 33.0 31 51.0 32 92.0 33 124.0 34 203.0 35 355.0 36 874.0 37 2164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.54086104666151 9.951018303686517 9.358081979891725 42.15003866976025 2 21.45 12.4 37.425000000000004 28.725 3 19.575 15.75 25.0 39.675 4 23.075000000000003 24.099999999999998 23.674999999999997 29.15 5 25.025 28.875 24.95 21.15 6 22.45 33.074999999999996 24.425 20.05 7 16.75 25.650000000000002 39.625 17.974999999999998 8 20.25 24.975 30.625000000000004 24.15 9 19.925 23.025000000000002 33.575 23.474999999999998 10-14 22.085 27.250000000000004 26.63 24.035 15-19 22.405 26.245 26.735 24.615000000000002 20-24 22.45673702110633 26.89306792037611 26.567970391117335 24.08222466740022 25-29 21.89 27.125 26.419999999999998 24.565 30-34 22.145 26.640000000000004 26.674999999999997 24.54 35-39 21.615000000000002 26.590000000000003 27.42 24.375 40-44 21.985 26.729999999999997 27.189999999999998 24.095 45-49 22.31111555577779 26.3713185659283 26.97134856742837 24.34621731086554 50-54 22.235 26.82 26.46 24.485 55-59 21.92609630481524 26.30131506575329 26.521326066303313 25.251262563128158 60-64 22.011100555027753 26.246312315615782 26.45632281614081 25.28626431321566 65-69 22.491124556227813 26.306315315765787 26.936346817340866 24.26621331066553 70-74 22.125 26.665 27.04 24.169999999999998 75-79 22.305 26.245 26.75 24.7 80-84 22.035 26.375 26.595000000000002 24.995 85-89 22.21 26.810000000000002 26.105 24.875 90-94 21.975 26.47 26.900000000000002 24.654999999999998 95-99 22.085 26.435 26.650000000000002 24.83 100-104 22.696348174087046 26.62831415707854 26.548274137068535 24.127063531765884 105-109 22.685 26.615 26.465 24.235 110-114 22.49461071840377 27.24720509349777 26.23452148192711 24.023662706171354 115-119 22.242812781728936 26.9057397575879 26.73044175097666 24.121005709706502 120-124 22.436827620715537 26.4848636477358 26.41481110833125 24.663497623217413 125-129 22.34373432326678 25.945620547807767 26.678037523828635 25.032607605096818 130-134 22.421906287545053 26.141369643572286 26.977372847416902 24.45935122146576 135-139 22.195 26.174999999999997 26.515 25.115 140-144 22.185 26.665 25.805 25.345000000000002 145-149 22.925 26.479999999999997 26.35 24.245 150-151 23.2125 25.45 25.4 25.937500000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 0.0 27 1.5 28 4.5 29 8.0 30 7.0 31 10.5 32 18.5 33 22.5 34 26.5 35 35.5 36 59.5 37 83.5 38 108.0 39 134.5 40 159.5 41 170.5 42 177.5 43 220.5 44 251.0 45 256.5 46 247.0 47 234.0 48 225.0 49 183.0 50 156.5 51 156.5 52 134.0 53 120.0 54 102.5 55 80.5 56 79.5 57 72.0 58 62.5 59 53.5 60 49.5 61 52.0 62 40.5 63 33.0 64 37.0 65 29.0 66 19.0 67 17.0 68 14.0 69 7.5 70 7.0 71 7.5 72 6.5 73 5.5 74 3.5 75 2.0 76 2.0 77 1.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.265 115-119 0.16999999999999998 120-124 0.075 125-129 0.33 130-134 0.12 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.9000000000000004 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958423 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958423_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44775 33.0 33.0 34.0 28.0 34.0 2 31.8095 33.0 33.0 34.0 27.0 34.0 3 32.615 33.0 33.0 34.0 28.0 34.0 4 31.36375 33.0 32.0 34.0 25.0 34.0 5 32.57 33.0 33.0 34.0 28.0 34.0 6 37.0085 38.0 38.0 38.0 36.0 38.0 7 37.30175 38.0 38.0 38.0 37.0 38.0 8 37.333 38.0 38.0 38.0 37.0 38.0 9 37.38575 38.0 38.0 38.0 38.0 38.0 10-14 37.416700000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.349000000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.409200000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.4416 38.0 38.0 38.0 38.0 38.0 30-34 37.447199999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.3531 38.0 38.0 38.0 37.4 38.0 40-44 37.1054 38.0 38.0 38.0 36.4 38.0 45-49 36.78965000000001 38.0 37.8 38.0 34.6 38.0 50-54 36.31665 38.0 36.8 38.0 31.2 38.0 55-59 37.2428 38.0 38.0 38.0 36.8 38.0 60-64 37.34910000000001 38.0 38.0 38.0 37.2 38.0 65-69 37.244099999999996 38.0 38.0 38.0 37.0 38.0 70-74 36.280499999999996 38.0 37.8 38.0 32.8 38.0 75-79 36.9379 38.0 38.0 38.0 36.0 38.0 80-84 35.11335 38.0 36.0 38.0 24.4 38.0 85-89 36.9176 38.0 37.8 38.0 35.8 38.0 90-94 36.9611 38.0 38.0 38.0 36.0 38.0 95-99 36.93145 38.0 38.0 38.0 35.8 38.0 100-104 36.76235 38.0 38.0 38.0 35.4 38.0 105-109 36.5518 38.0 38.0 38.0 34.2 38.0 110-114 36.52855 38.0 38.0 38.0 34.2 38.0 115-119 36.57155 38.0 38.0 38.0 34.6 38.0 120-124 36.39985 38.0 38.0 38.0 33.6 38.0 125-129 35.99225 38.0 37.8 38.0 32.8 38.0 130-134 35.70524999999999 38.0 37.0 38.0 31.6 38.0 135-139 34.806850000000004 38.0 35.4 38.0 26.8 38.0 140-144 32.65705 37.6 31.0 38.0 20.0 38.0 145-149 32.261700000000005 38.0 32.0 38.0 15.0 38.0 150-151 27.67275 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 2.0 18 5.0 19 3.0 20 5.0 21 4.0 22 3.0 23 6.0 24 8.0 25 11.0 26 19.0 27 16.0 28 29.0 29 33.0 30 38.0 31 50.0 32 87.0 33 92.0 34 168.0 35 334.0 36 869.0 37 2209.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.025 19.925 12.25 33.800000000000004 2 28.599999999999998 24.9 28.525 17.974999999999998 3 21.625 26.5 29.175 22.7 4 24.325 32.275 21.4 22.0 5 27.175 34.55 20.3 17.974999999999998 6 21.85 37.65 21.4 19.1 7 21.2 20.275000000000002 36.725 21.8 8 23.525 22.95 26.325 27.200000000000003 9 24.425 21.95 28.65 24.975 10-14 24.759999999999998 27.345000000000002 24.335 23.56 15-19 24.775 26.805 25.985000000000003 22.435 20-24 24.98 26.75 25.169999999999998 23.1 25-29 24.785 26.825 25.7 22.689999999999998 30-34 24.57 26.38 26.174999999999997 22.875 35-39 24.935 25.85 26.13 23.085 40-44 25.369999999999997 26.595000000000002 25.775 22.259999999999998 45-49 24.404999999999998 26.240000000000002 26.41 22.945 50-54 25.019999999999996 26.284999999999997 25.775 22.919999999999998 55-59 24.884999999999998 26.314999999999998 25.540000000000003 23.26 60-64 24.88 26.22 26.195 22.705000000000002 65-69 24.84 26.495 25.919999999999998 22.745 70-74 25.09 26.83 25.64 22.439999999999998 75-79 24.19 26.419999999999998 26.46 22.93 80-84 23.990000000000002 26.755000000000003 26.595000000000002 22.66 85-89 25.39 26.634999999999998 25.895000000000003 22.08 90-94 24.955 27.015 25.615 22.415 95-99 24.62 27.474999999999998 25.735000000000003 22.17 100-104 24.665 26.369999999999997 26.115 22.85 105-109 24.8 26.484999999999996 26.045 22.67 110-114 24.610000000000003 26.834999999999997 26.135 22.42 115-119 25.045 26.88 25.89 22.185 120-124 25.295 26.915 26.005 21.785 125-129 25.679999999999996 26.77 25.96 21.59 130-134 25.395 27.384999999999998 24.815 22.405 135-139 25.105 26.665 26.200000000000003 22.03 140-144 25.525 26.384999999999998 26.215 21.875 145-149 26.150000000000002 27.034999999999997 25.275 21.54 150-151 25.137500000000003 26.2625 26.474999999999998 22.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 1.0 27 1.0 28 5.0 29 6.0 30 7.5 31 13.0 32 16.5 33 20.0 34 23.5 35 39.0 36 54.5 37 72.5 38 95.0 39 114.5 40 144.5 41 185.0 42 210.0 43 223.0 44 229.0 45 224.0 46 233.0 47 222.5 48 199.5 49 178.5 50 159.5 51 152.0 52 132.0 53 121.5 54 109.0 55 90.0 56 83.5 57 72.0 58 64.0 59 65.0 60 66.5 61 64.0 62 53.5 63 34.5 64 28.5 65 32.5 66 30.5 67 26.5 68 22.0 69 20.0 70 16.5 71 11.5 72 8.5 73 5.5 74 4.0 75 2.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 1.8625 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATTCT 10 0.006830828 145.0 6 >>END_MODULE Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688430 spots for SRR6958423.sra Written 688430 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra Read 688411 spots for SRR6958423.sra Written 688411 spots for SRR6958423.sra SRR ids: ['SRR6958423.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8fcw3mc1 SRR6958423.sra spots: 13768239 blocks: [[1, 688411], [688412, 1376822], [1376823, 2065233], [2065234, 2753644], [2753645, 3442055], [3442056, 4130466], [4130467, 4818877], [4818878, 5507288], [5507289, 6195699], [6195700, 6884110], [6884111, 7572521], [7572522, 8260932], [8260933, 8949343], [8949344, 9637754], [9637755, 10326165], [10326166, 11014576], [11014577, 11702987], [11702988, 12391398], [12391399, 13079809], [13079810, 13768239]] SRR6958423 file size 4643904 SRR6958423 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958423 SRR6958423_1.fastq SRR6958423_2.fastq Input file: SRR6958423_1.fastq Paired file: SRR6958423_2.fastq trimmed: SRR6958423-trimmed-pair1.fastq, SRR6958423-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:46:37 2024 >> started Fri Dec 6 22:46:52 2024 >> done (14.469s) 13768239 read pairs processed; of these: 7541 ( 0.05%) short read pairs filtered out after trimming by size control 7355 ( 0.05%) empty read pairs filtered out after trimming by size control 13753343 (99.89%) read pairs available; of these: 5908033 (42.96%) trimmed read pairs available after processing 7845310 (57.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 6 0.00% 26 5 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 7 0.00% 31 3 0.00% 32 3 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 5 0.00% 37 5 0.00% 38 2 0.00% 39 6 0.00% 40 4 0.00% 41 11 0.00% 42 11 0.00% 43 4 0.00% 44 10 0.00% 45 5 0.00% 46 8 0.00% 47 11 0.00% 48 9 0.00% 49 19 0.00% 50 16 0.00% 51 15 0.00% 52 20 0.00% 53 26 0.00% 54 17 0.00% 55 25 0.00% 56 29 0.00% 57 36 0.00% 58 42 0.00% 59 39 0.00% 60 63 0.00% 61 71 0.00% 62 71 0.00% 63 79 0.00% 64 79 0.00% 65 81 0.00% 66 110 0.00% 67 125 0.00% 68 137 0.00% 69 165 0.00% 70 172 0.00% 71 208 0.00% 72 262 0.00% 73 280 0.00% 74 316 0.00% 75 356 0.00% 76 405 0.00% 77 472 0.00% 78 514 0.00% 79 579 0.00% 80 655 0.00% 81 697 0.01% 82 782 0.01% 83 939 0.01% 84 1130 0.01% 85 1509 0.01% 86 1573 0.01% 87 1796 0.01% 88 1860 0.01% 89 2026 0.01% 90 2089 0.02% 91 2283 0.02% 92 2548 0.02% 93 2696 0.02% 94 3053 0.02% 95 3326 0.02% 96 3519 0.03% 97 3731 0.03% 98 3953 0.03% 99 4288 0.03% 100 4611 0.03% 101 5041 0.04% 102 5380 0.04% 103 5679 0.04% 104 5927 0.04% 105 6504 0.05% 106 6996 0.05% 107 7236 0.05% 108 7899 0.06% 109 8162 0.06% 110 8670 0.06% 111 8976 0.07% 112 9591 0.07% 113 10305 0.07% 114 11119 0.08% 115 11643 0.08% 116 12361 0.09% 117 12988 0.09% 118 13332 0.10% 119 13996 0.10% 120 14694 0.11% 121 15475 0.11% 122 16085 0.12% 123 17250 0.13% 124 18056 0.13% 125 19102 0.14% 126 20191 0.15% 127 21111 0.15% 128 22332 0.16% 129 23712 0.17% 130 26037 0.19% 131 26340 0.19% 132 28030 0.20% 133 29852 0.22% 134 32052 0.23% 135 34078 0.25% 136 36776 0.27% 137 39545 0.29% 138 42281 0.31% 139 46240 0.34% 140 50727 0.37% 141 56112 0.41% 142 63208 0.46% 143 72906 0.53% 144 85104 0.62% 145 104421 0.76% 146 132694 0.96% 147 183269 1.33% 148 288239 2.10% 149 601142 4.37% 150 3515135 25.56% 151 7845310 57.04% 13753343 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=40.77 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=113.75 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958423 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:47:33 Started mapping on | Dec 06 22:47:33 Finished on | Dec 06 22:49:10 Mapping speed, Million of reads per hour | 510.43 Number of input reads | 13753343 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13241629 Uniquely mapped reads % | 96.28% Average mapped length | 297.26 Number of splices: Total | 15718156 Number of splices: Annotated (sjdb) | 14832721 Number of splices: GT/AG | 15512584 Number of splices: GC/AG | 181032 Number of splices: AT/AC | 6117 Number of splices: Non-canonical | 18423 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 176885 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 22318 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 1.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 337985 337985 337985 N_multimapping 176885 176885 176885 N_noFeature 521450 12875671 633768 N_ambiguous 306538 1928 53468 UnstrandedReadsAssigned:12413641 PositiveStrandReadsAssigned:364030 NegativeStrandReadsAssigned:12554393 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958423 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958423-trimmed-pair1.fastq SRR6958423-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,753,343 reads, 12,582,901 reads pseudoaligned [quant] estimated average fragment length: 249.328 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR6958423.ke.tsv 35125 SRR6958423.se.tsv 88098 total ==> SRR6958423.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.212 0 0 PNS24247 1044 795.672 44.8683 6.90395 PNS24249 1928 1679.67 47.0435 3.429 PNS24246 1044 795.672 44.8683 6.90395 PNS24248 1044 795.672 44.8683 6.90395 PNS24244 1471 1222.67 8.35165 0.836287 PNS24243 293 81.8813 0 0 KQK14069 1603 1354.67 4129.09 373.175 KQK14071 474 231.546 64.9406 34.3377 ==> SRR6958423.se.tsv <== BRADI_1g14170v3 4672 BRADI_1g53295v3 116 BRADI_1g59795v3 162 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 149 BRADI_1g74790v3 62 BRADI_1g09890v3 0 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR6958423 completed mapping pipeline successfully