Starting /dee2/code/volunteer_pipeline.sh SRR6958424 current disk space = 1548516507648 free memory = 1600154292 SRR6958424 SRAfilesize ce1023c9e0ea7cd866a4a30952624295 SRR6958424.sra SRR6958424.sra file validated SRR6958424 is paired end SRR6958424 is conventional basespace SRR6958424 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.95025 32.0 18.0 33.0 2.0 33.0 2 27.198 29.0 25.0 31.0 18.0 33.0 3 29.667 31.0 28.0 33.0 25.0 33.0 4 29.6985 32.0 30.0 33.0 25.0 33.0 5 31.22725 32.0 32.0 33.0 28.0 33.0 6 36.494 38.0 36.0 38.0 34.0 38.0 7 37.31675 38.0 38.0 38.0 36.0 38.0 8 37.49025 38.0 38.0 38.0 37.0 38.0 9 37.55 38.0 38.0 38.0 37.0 38.0 10-14 37.4234 38.0 38.0 38.0 37.2 38.0 15-19 37.4129 38.0 38.0 38.0 37.2 38.0 20-24 37.38575 38.0 38.0 38.0 37.2 38.0 25-29 36.945100000000004 38.0 38.0 38.0 35.6 38.0 30-34 37.36055 38.0 38.0 38.0 37.2 38.0 35-39 37.2793 38.0 38.0 38.0 36.8 38.0 40-44 37.22155 38.0 38.0 38.0 36.4 38.0 45-49 37.201449999999994 38.0 38.0 38.0 36.6 38.0 50-54 37.17629999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.2594 38.0 38.0 38.0 36.8 38.0 60-64 37.307199999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.2455 38.0 38.0 38.0 36.8 38.0 70-74 37.154900000000005 38.0 38.0 38.0 36.4 38.0 75-79 37.238600000000005 38.0 38.0 38.0 36.2 38.0 80-84 37.072399999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.7505 38.0 38.0 38.0 34.8 38.0 90-94 35.63725 38.0 37.0 38.0 28.8 38.0 95-99 35.81365 38.0 37.0 38.0 31.0 38.0 100-104 35.73075 38.0 36.8 38.0 31.0 38.0 105-109 35.79860000000001 38.0 37.4 38.0 31.2 38.0 110-114 35.77065 38.0 37.0 38.0 30.8 38.0 115-119 36.18725 38.0 37.8 38.0 33.6 38.0 120-124 36.316649999999996 38.0 38.0 38.0 33.8 38.0 125-129 36.37815 38.0 38.0 38.0 34.0 38.0 130-134 36.0637 38.0 37.4 38.0 33.4 38.0 135-139 35.934900000000006 38.0 37.0 38.0 32.8 38.0 140-144 34.8788 38.0 35.0 38.0 28.4 38.0 145-149 34.055899999999994 38.0 34.0 38.0 25.8 38.0 150-151 30.895000000000003 36.5 29.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 3.0 20 3.0 21 1.0 22 5.0 23 7.0 24 8.0 25 7.0 26 16.0 27 16.0 28 28.0 29 45.0 30 45.0 31 72.0 32 74.0 33 124.0 34 182.0 35 288.0 36 751.0 37 2321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.207232267037554 8.873435326842838 7.37134909596662 34.54798331015299 2 28.4 11.65 31.95 28.000000000000004 3 22.605651412853213 15.178794698674668 22.43060765191298 39.784946236559136 4 27.775 22.525000000000002 20.3 29.4 5 28.025 25.275 24.425 22.275 6 22.75 30.275000000000002 23.549999999999997 23.425 7 19.35 23.150000000000002 38.125 19.375 8 20.175 23.474999999999998 29.299999999999997 27.05 9 19.975 20.549999999999997 34.875 24.6 10-14 23.79 26.415 25.424999999999997 24.37 15-19 23.605 24.445 26.265 25.685000000000002 20-24 23.728559283892583 25.388808321248185 25.653848077211585 25.228784317647644 25-29 23.62 24.93 25.75 25.7 30-34 23.061153057652884 25.04625231261563 25.726286314315715 26.16630831541577 35-39 23.395 24.875 25.955000000000002 25.775 40-44 23.66 25.185000000000002 25.825 25.330000000000002 45-49 23.235 25.295 25.365 26.105 50-54 23.445 25.445 25.135 25.974999999999998 55-59 23.85238523852385 25.28252825282528 25.292529252925295 25.57255725572557 60-64 23.48 24.54 25.645 26.334999999999997 65-69 23.825 24.675 25.135 26.365 70-74 23.47 24.865000000000002 25.235000000000003 26.43 75-79 23.87 24.745 25.705 25.679999999999996 80-84 24.031201560078003 24.861243062153108 25.261263063153155 25.84629231461573 85-89 23.84 24.695 25.195 26.27 90-94 24.065 24.154999999999998 25.695 26.085 95-99 24.224999999999998 24.26 25.240000000000002 26.275 100-104 23.936196809840492 25.09125456272814 24.936246812340617 26.036301815090756 105-109 24.77 24.474999999999998 24.785 25.97 110-114 23.880000000000003 25.11 25.75 25.259999999999998 115-119 24.135 24.759999999999998 24.825 26.279999999999998 120-124 24.275 24.485 25.180000000000003 26.06 125-129 24.12 24.345 25.415 26.119999999999997 130-134 24.46 24.6 25.474999999999998 25.465 135-139 23.91 24.905 25.56 25.624999999999996 140-144 24.759999999999998 24.775 24.735 25.729999999999997 145-149 24.275 24.805 24.8 26.119999999999997 150-151 24.5625 24.6625 24.725 26.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 4.0 29 4.0 30 5.0 31 9.0 32 11.5 33 16.0 34 32.0 35 40.0 36 41.0 37 55.5 38 74.5 39 102.0 40 121.5 41 136.5 42 164.5 43 182.5 44 182.0 45 198.5 46 210.5 47 193.0 48 168.5 49 153.0 50 162.5 51 152.5 52 126.5 53 110.0 54 108.0 55 110.0 56 105.0 57 97.5 58 83.5 59 91.0 60 86.0 61 73.5 62 76.0 63 67.0 64 62.5 65 57.0 66 55.5 67 52.5 68 45.0 69 44.5 70 34.0 71 22.5 72 20.5 73 20.5 74 13.0 75 5.0 76 3.0 77 1.5 78 1.0 79 1.0 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.125 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.725 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.2249999999999996 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958424 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958424_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99125 33.0 33.0 34.0 32.0 34.0 2 33.061 34.0 33.0 34.0 32.0 34.0 3 33.09425 34.0 33.0 34.0 32.0 34.0 4 33.063 34.0 33.0 34.0 32.0 34.0 5 32.859 34.0 33.0 34.0 32.0 34.0 6 37.08675 38.0 38.0 38.0 36.0 38.0 7 37.1665 38.0 38.0 38.0 37.0 38.0 8 37.088 38.0 38.0 38.0 36.0 38.0 9 37.21075 38.0 38.0 38.0 37.0 38.0 10-14 36.722150000000006 38.0 38.0 38.0 34.4 38.0 15-19 36.6665 38.0 38.0 38.0 34.2 38.0 20-24 36.62075 38.0 38.0 38.0 34.8 38.0 25-29 36.836850000000005 38.0 38.0 38.0 35.6 38.0 30-34 36.70740000000001 38.0 37.8 38.0 34.6 38.0 35-39 37.1544 38.0 38.0 38.0 36.6 38.0 40-44 36.84425 38.0 37.8 38.0 35.0 38.0 45-49 36.3656 38.0 37.6 38.0 32.4 38.0 50-54 36.05395 38.0 36.2 38.0 32.0 38.0 55-59 36.236850000000004 38.0 37.4 38.0 32.8 38.0 60-64 33.93575 37.2 32.4 38.0 24.2 38.0 65-69 36.495 38.0 37.8 38.0 34.0 38.0 70-74 35.65145 38.0 37.0 38.0 29.4 38.0 75-79 36.0518 38.0 37.6 38.0 32.4 38.0 80-84 34.379200000000004 37.8 33.8 38.0 25.8 38.0 85-89 35.7255 38.0 37.2 38.0 30.8 38.0 90-94 36.21810000000001 38.0 37.8 38.0 33.4 38.0 95-99 34.38295 37.2 31.6 38.0 28.0 38.0 100-104 36.09625 38.0 37.2 38.0 32.6 38.0 105-109 36.32415 38.0 38.0 38.0 34.0 38.0 110-114 35.89254999999999 38.0 37.8 38.0 32.8 38.0 115-119 35.7504 38.0 37.4 38.0 32.2 38.0 120-124 35.084050000000005 38.0 36.2 38.0 28.0 38.0 125-129 34.13655 38.0 34.0 38.0 23.2 38.0 130-134 34.3331 38.0 34.4 38.0 23.6 38.0 135-139 35.0663 38.0 35.6 38.0 29.8 38.0 140-144 34.2432 38.0 34.4 38.0 24.0 38.0 145-149 34.369350000000004 38.0 35.2 38.0 27.6 38.0 150-151 29.647750000000002 35.0 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 2.0 5 0.0 6 0.0 7 1.0 8 4.0 9 0.0 10 0.0 11 2.0 12 2.0 13 4.0 14 3.0 15 3.0 16 3.0 17 1.0 18 4.0 19 8.0 20 5.0 21 4.0 22 10.0 23 13.0 24 19.0 25 22.0 26 21.0 27 44.0 28 38.0 29 42.0 30 56.0 31 80.0 32 110.0 33 149.0 34 179.0 35 392.0 36 935.0 37 1840.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.575 17.849999999999998 13.200000000000001 32.375 2 29.25 24.349999999999998 26.674999999999997 19.725 3 23.325000000000003 25.275 27.400000000000002 24.0 4 25.6 30.675 19.825 23.9 5 27.625 31.35 19.775000000000002 21.25 6 23.225 36.85 19.575 20.349999999999998 7 22.125 19.5 34.425 23.95 8 23.925 23.849999999999998 23.325000000000003 28.9 9 24.325 22.3 28.15 25.224999999999998 10-14 26.025 25.85 22.845 25.28 15-19 25.715 25.735000000000003 23.91 24.64 20-24 25.41 25.105 24.325 25.16 25-29 25.88 25.779999999999998 24.025 24.315 30-34 25.5 24.945 24.665 24.89 35-39 25.77 25.330000000000002 24.060000000000002 24.84 40-44 25.89 25.509999999999998 23.485 25.115 45-49 25.745 25.505 23.645 25.105 50-54 25.86 24.815 24.7 24.625 55-59 26.515 25.205 23.75 24.529999999999998 60-64 25.865 25.064999999999998 24.310000000000002 24.759999999999998 65-69 25.324999999999996 25.324999999999996 24.060000000000002 25.290000000000003 70-74 25.735000000000003 24.48 24.51 25.275 75-79 25.465 25.03 24.605 24.9 80-84 26.314999999999998 25.374999999999996 23.645 24.665 85-89 26.025 24.915000000000003 24.36 24.7 90-94 25.840000000000003 25.040000000000003 24.355 24.765 95-99 25.85 25.119999999999997 24.855 24.175 100-104 26.99 24.865000000000002 23.965 24.18 105-109 25.795 25.19 24.515 24.5 110-114 26.825 25.445 23.93 23.799999999999997 115-119 26.27 24.625 24.185000000000002 24.92 120-124 26.32 25.4 24.29 23.990000000000002 125-129 26.314999999999998 25.755 23.810000000000002 24.12 130-134 26.596329816490826 25.401270063503173 23.966198309915494 24.036201810090503 135-139 26.35 25.330000000000002 24.305 24.015 140-144 26.290000000000003 25.88 24.154999999999998 23.674999999999997 145-149 27.250000000000004 25.314999999999998 24.135 23.3 150-151 26.5 26.437500000000004 23.7125 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 2.0 28 3.5 29 4.0 30 4.0 31 6.5 32 11.5 33 16.5 34 16.5 35 23.0 36 37.0 37 51.5 38 67.5 39 88.5 40 118.5 41 142.5 42 152.0 43 171.0 44 179.0 45 174.0 46 177.5 47 166.5 48 165.5 49 179.5 50 173.5 51 149.0 52 128.0 53 119.5 54 115.5 55 112.0 56 103.5 57 95.5 58 95.0 59 92.0 60 94.5 61 85.0 62 76.0 63 79.5 64 79.5 65 69.5 66 63.0 67 56.5 68 47.5 69 46.0 70 40.5 71 37.0 72 26.5 73 17.5 74 12.0 75 6.5 76 5.5 77 4.5 78 2.5 79 2.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80559085133417 97.2 2 0.9148665819567979 1.7999999999999998 3 0.17789072426937738 0.525 4 0.05082592121982211 0.2 5 0.025412960609911054 0.125 6 0.025412960609911054 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.35 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.375 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 140-144 >>END_MODULE Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019379 spots for SRR6958424.sra Written 1019379 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra Read 1019361 spots for SRR6958424.sra Written 1019361 spots for SRR6958424.sra SRR ids: ['SRR6958424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kkpyck31 SRR6958424.sra spots: 20387238 blocks: [[1, 1019361], [1019362, 2038722], [2038723, 3058083], [3058084, 4077444], [4077445, 5096805], [5096806, 6116166], [6116167, 7135527], [7135528, 8154888], [8154889, 9174249], [9174250, 10193610], [10193611, 11212971], [11212972, 12232332], [12232333, 13251693], [13251694, 14271054], [14271055, 15290415], [15290416, 16309776], [16309777, 17329137], [17329138, 18348498], [18348499, 19367859], [19367860, 20387238]] SRR6958424 file size 6886865 SRR6958424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958424 SRR6958424_1.fastq SRR6958424_2.fastq Input file: SRR6958424_1.fastq Paired file: SRR6958424_2.fastq trimmed: SRR6958424-trimmed-pair1.fastq, SRR6958424-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:48:52 2024 >> started Fri Dec 6 22:49:16 2024 >> done (24.295s) 20387238 read pairs processed; of these: 12563 ( 0.06%) short read pairs filtered out after trimming by size control 9567 ( 0.05%) empty read pairs filtered out after trimming by size control 20365108 (99.89%) read pairs available; of these: 6806550 (33.42%) trimmed read pairs available after processing 13558558 (66.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 6 0.00% 24 3 0.00% 25 2 0.00% 26 7 0.00% 27 2 0.00% 28 3 0.00% 29 3 0.00% 30 5 0.00% 31 8 0.00% 32 5 0.00% 33 6 0.00% 34 4 0.00% 35 7 0.00% 36 4 0.00% 37 7 0.00% 38 11 0.00% 39 9 0.00% 40 11 0.00% 41 15 0.00% 42 12 0.00% 43 14 0.00% 44 15 0.00% 45 17 0.00% 46 16 0.00% 47 17 0.00% 48 19 0.00% 49 22 0.00% 50 39 0.00% 51 34 0.00% 52 24 0.00% 53 34 0.00% 54 47 0.00% 55 45 0.00% 56 51 0.00% 57 38 0.00% 58 69 0.00% 59 96 0.00% 60 88 0.00% 61 126 0.00% 62 131 0.00% 63 154 0.00% 64 176 0.00% 65 176 0.00% 66 194 0.00% 67 213 0.00% 68 298 0.00% 69 269 0.00% 70 353 0.00% 71 355 0.00% 72 439 0.00% 73 480 0.00% 74 598 0.00% 75 665 0.00% 76 814 0.00% 77 839 0.00% 78 890 0.00% 79 1025 0.01% 80 1136 0.01% 81 1286 0.01% 82 1477 0.01% 83 1754 0.01% 84 2524 0.01% 85 2986 0.01% 86 3180 0.02% 87 3479 0.02% 88 3691 0.02% 89 3817 0.02% 90 4089 0.02% 91 4544 0.02% 92 4808 0.02% 93 5263 0.03% 94 5674 0.03% 95 6203 0.03% 96 6422 0.03% 97 6870 0.03% 98 7245 0.04% 99 7896 0.04% 100 8382 0.04% 101 9034 0.04% 102 9600 0.05% 103 10063 0.05% 104 10676 0.05% 105 11549 0.06% 106 12420 0.06% 107 13127 0.06% 108 13838 0.07% 109 14573 0.07% 110 15288 0.08% 111 16010 0.08% 112 16997 0.08% 113 17637 0.09% 114 18784 0.09% 115 20030 0.10% 116 21181 0.10% 117 21761 0.11% 118 23041 0.11% 119 23542 0.12% 120 24807 0.12% 121 25845 0.13% 122 26931 0.13% 123 27734 0.14% 124 29520 0.14% 125 30931 0.15% 126 32377 0.16% 127 33940 0.17% 128 35027 0.17% 129 36536 0.18% 130 38194 0.19% 131 39817 0.20% 132 41421 0.20% 133 44292 0.22% 134 45822 0.23% 135 48139 0.24% 136 50309 0.25% 137 53168 0.26% 138 56309 0.28% 139 60084 0.30% 140 63432 0.31% 141 68706 0.34% 142 76228 0.37% 143 84125 0.41% 144 94976 0.47% 145 110601 0.54% 146 133829 0.66% 147 176694 0.87% 148 265977 1.31% 149 528949 2.60% 150 4020929 19.74% 151 13558558 66.58% 20365108 reads passed initial QC criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=16 prefix-density=1.22 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=42.70 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=14 prefix-density=0.82 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=53.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958424 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:50:03 Started mapping on | Dec 06 22:50:03 Finished on | Dec 06 22:52:25 Mapping speed, Million of reads per hour | 516.30 Number of input reads | 20365108 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19761781 Uniquely mapped reads % | 97.04% Average mapped length | 297.21 Number of splices: Total | 22857569 Number of splices: Annotated (sjdb) | 21538627 Number of splices: GT/AG | 22558510 Number of splices: GC/AG | 264522 Number of splices: AT/AC | 8303 Number of splices: Non-canonical | 26234 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 168792 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 16439 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 442336 442336 442336 N_multimapping 168792 168792 168792 N_noFeature 613073 19181214 784040 N_ambiguous 489995 2806 81965 UnstrandedReadsAssigned:18658713 PositiveStrandReadsAssigned:577761 NegativeStrandReadsAssigned:18895776 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958424 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958424-trimmed-pair1.fastq SRR6958424-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,365,108 reads, 18,896,297 reads pseudoaligned [quant] estimated average fragment length: 269.364 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR6958424.ke.tsv 35125 SRR6958424.se.tsv 88098 total ==> SRR6958424.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.194 0 0 PNS24247 1044 775.636 47.8678 4.76353 PNS24249 1928 1659.64 46.4181 2.15883 PNS24246 1044 775.636 47.8678 4.76353 PNS24248 1044 775.636 47.8678 4.76353 PNS24244 1471 1202.64 38.9787 2.50171 PNS24243 293 84.943 0 0 KQK14069 1603 1334.64 5688.14 328.966 KQK14071 474 223.594 71.4451 24.6635 ==> SRR6958424.se.tsv <== BRADI_1g14170v3 6297 BRADI_1g53295v3 196 BRADI_1g59795v3 188 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 214 BRADI_1g74790v3 108 BRADI_1g09890v3 0 BRADI_1g77505v3 207 BRADI_1g48960v3 0 SRR6958424 completed mapping pipeline successfully