Starting /dee2/code/volunteer_pipeline.sh SRR6958425 current disk space = 1548400267264 free memory = 1600083024 SRR6958425 SRAfilesize 398b96b9376abe6452d2eef96a606259 SRR6958425.sra SRR6958425.sra file validated SRR6958425 is paired end SRR6958425 is conventional basespace SRR6958425 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.40775 31.0 25.0 33.0 18.0 34.0 2 29.20875 31.0 27.0 33.0 25.0 33.0 3 31.71175 33.0 31.0 33.0 28.0 34.0 4 32.76325 33.0 33.0 33.0 32.0 34.0 5 33.19525 33.0 33.0 34.0 33.0 34.0 6 37.08375 38.0 37.0 38.0 36.0 38.0 7 37.51275 38.0 38.0 38.0 37.0 38.0 8 37.6135 38.0 38.0 38.0 38.0 38.0 9 36.87375 38.0 38.0 38.0 36.0 38.0 10-14 37.3934 38.0 38.0 38.0 36.8 38.0 15-19 37.5184 38.0 38.0 38.0 37.6 38.0 20-24 37.5539 38.0 38.0 38.0 37.8 38.0 25-29 37.339099999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.662850000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.53855 38.0 38.0 38.0 37.6 38.0 40-44 37.6342 38.0 38.0 38.0 38.0 38.0 45-49 37.577549999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.4419 38.0 38.0 38.0 37.4 38.0 55-59 37.1564 38.0 38.0 38.0 36.2 38.0 60-64 36.9459 38.0 38.0 38.0 35.4 38.0 65-69 37.2947 38.0 38.0 38.0 37.0 38.0 70-74 37.243 38.0 38.0 38.0 36.8 38.0 75-79 37.3414 38.0 38.0 38.0 37.0 38.0 80-84 37.205149999999996 38.0 38.0 38.0 36.2 38.0 85-89 37.152550000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.1353 38.0 38.0 38.0 36.0 38.0 95-99 37.03095 38.0 38.0 38.0 35.6 38.0 100-104 36.808550000000004 38.0 38.0 38.0 35.2 38.0 105-109 36.83215 38.0 38.0 38.0 35.2 38.0 110-114 36.5668 38.0 38.0 38.0 34.4 38.0 115-119 36.573 38.0 38.0 38.0 34.0 38.0 120-124 36.49399999999999 38.0 38.0 38.0 34.0 38.0 125-129 36.19345 38.0 37.6 38.0 33.6 38.0 130-134 36.00655 38.0 37.0 38.0 33.2 38.0 135-139 35.89475 38.0 36.6 38.0 32.8 38.0 140-144 35.51825 38.0 36.0 38.0 31.0 38.0 145-149 34.988350000000004 38.0 35.4 38.0 29.4 38.0 150-151 31.574624999999997 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 0.0 18 1.0 19 2.0 20 0.0 21 3.0 22 3.0 23 1.0 24 3.0 25 5.0 26 11.0 27 8.0 28 18.0 29 23.0 30 27.0 31 31.0 32 44.0 33 83.0 34 131.0 35 235.0 36 693.0 37 2673.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.090295796574985 10.404774260508562 9.029579657498703 42.47535028541775 2 20.150000000000002 14.174999999999999 36.449999999999996 29.225 3 18.55 16.150000000000002 26.674999999999997 38.625 4 24.2 23.65 22.975 29.175 5 25.224999999999998 30.075000000000003 24.0 20.7 6 21.6 34.449999999999996 23.474999999999998 20.474999999999998 7 16.650000000000002 26.900000000000002 38.625 17.825 8 18.925 24.925 32.05 24.099999999999998 9 19.15 22.7 34.65 23.5 10-14 21.67 28.000000000000004 26.834999999999997 23.494999999999997 15-19 21.77 27.01 26.974999999999998 24.245 20-24 21.345 27.425 27.115000000000002 24.115000000000002 25-29 21.615000000000002 27.229999999999997 27.105 24.05 30-34 21.61 26.605 27.134999999999998 24.65 35-39 22.395 27.375 26.72 23.51 40-44 22.125 27.27 26.43 24.175 45-49 21.625 26.945000000000004 27.224999999999998 24.205 50-54 21.86046511627907 27.38184546136534 26.87671917979495 23.88097024256064 55-59 21.49107455372769 26.471323566178306 27.876393819690986 24.16120806040302 60-64 21.41321198179727 26.959043856578486 27.224083612541882 24.40366054908236 65-69 21.25 27.195000000000004 26.955000000000002 24.6 70-74 22.055 26.640000000000004 27.13 24.175 75-79 21.915000000000003 26.545 27.134999999999998 24.404999999999998 80-84 21.85 26.76 26.985 24.404999999999998 85-89 21.75 27.395000000000003 26.685 24.169999999999998 90-94 22.15 27.38 26.16 24.310000000000002 95-99 22.28 27.065 26.61 24.044999999999998 100-104 21.838275741361205 26.944041606240937 26.819022853428017 24.398659798969845 105-109 21.978296744511677 27.199079861979296 26.8440266039906 23.978596789518427 110-114 22.078766951909124 27.293199219336433 26.72771856077666 23.90031526797778 115-119 22.428457074244545 27.62157294376626 26.30078046828097 23.649189513708222 120-124 22.25 26.474999999999998 27.105 24.169999999999998 125-129 21.578841915447804 26.312362252053695 27.249048286916448 24.85974754558205 130-134 21.61337136566081 26.627633488465197 26.907871690937295 24.851123454936697 135-139 22.27 26.58 26.755000000000003 24.395 140-144 22.005 26.63 26.26 25.105 145-149 21.805 27.229999999999997 26.495 24.47 150-151 22.237499999999997 26.375 26.474999999999998 24.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.0 28 1.5 29 5.0 30 12.0 31 14.0 32 19.0 33 32.5 34 42.0 35 46.5 36 60.0 37 84.0 38 107.0 39 142.0 40 179.0 41 194.0 42 216.5 43 226.5 44 254.0 45 260.5 46 241.5 47 232.0 48 205.5 49 194.5 50 178.0 51 155.0 52 131.0 53 102.5 54 78.5 55 80.0 56 77.0 57 64.5 58 56.5 59 45.0 60 40.0 61 35.5 62 31.0 63 25.5 64 20.5 65 19.5 66 17.0 67 14.0 68 10.5 69 9.5 70 6.5 71 4.5 72 6.0 73 5.5 74 3.5 75 1.5 76 2.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.025 55-59 0.005 60-64 0.015 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.015 110-114 0.08499999999999999 115-119 0.06 120-124 0.0 125-129 0.18 130-134 0.08499999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.9874999999999998 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.7874999999999996 0.0 0.0 0.0 0.0 138-139 3.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGGAAT 10 0.0068661636 144.75 2 CGAGGTT 10 0.0068661636 144.75 8 TCGAGGT 10 0.0068661636 144.75 7 GAGGTTC 10 0.0068661636 144.75 9 >>END_MODULE SRR6958425 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958425_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.236 34.0 33.0 34.0 33.0 34.0 2 33.3425 34.0 33.0 34.0 33.0 34.0 3 33.39625 34.0 33.0 34.0 33.0 34.0 4 33.37675 34.0 33.0 34.0 33.0 34.0 5 33.4315 34.0 33.0 34.0 33.0 34.0 6 37.615 38.0 38.0 38.0 38.0 38.0 7 37.60475 38.0 38.0 38.0 38.0 38.0 8 37.587 38.0 38.0 38.0 38.0 38.0 9 33.68225 38.0 33.0 38.0 16.0 38.0 10-14 37.24575 38.0 37.8 38.0 36.0 38.0 15-19 36.0593 38.0 37.0 38.0 31.4 38.0 20-24 37.46975 38.0 38.0 38.0 37.8 38.0 25-29 37.485549999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5538 38.0 38.0 38.0 38.0 38.0 35-39 37.55890000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.51595 38.0 38.0 38.0 38.0 38.0 45-49 37.4661 38.0 38.0 38.0 38.0 38.0 50-54 36.66725 38.0 38.0 38.0 34.0 38.0 55-59 37.381350000000005 38.0 38.0 38.0 37.8 38.0 60-64 37.39625000000001 38.0 38.0 38.0 38.0 38.0 65-69 37.4294 38.0 38.0 38.0 38.0 38.0 70-74 37.352199999999996 38.0 38.0 38.0 37.8 38.0 75-79 37.32025 38.0 38.0 38.0 37.0 38.0 80-84 37.34074999999999 38.0 38.0 38.0 37.6 38.0 85-89 37.304050000000004 38.0 38.0 38.0 37.2 38.0 90-94 37.186 38.0 38.0 38.0 37.0 38.0 95-99 37.13955 38.0 38.0 38.0 37.0 38.0 100-104 35.8957 38.0 36.4 38.0 30.2 38.0 105-109 36.9128 38.0 38.0 38.0 35.8 38.0 110-114 34.513600000000004 37.8 33.8 38.0 25.0 38.0 115-119 36.7177 38.0 38.0 38.0 35.2 38.0 120-124 35.130700000000004 38.0 35.2 38.0 28.6 38.0 125-129 36.6185 38.0 38.0 38.0 35.0 38.0 130-134 33.3939 37.6 32.0 38.0 21.8 38.0 135-139 34.7971 38.0 35.2 38.0 26.4 38.0 140-144 35.258700000000005 38.0 35.8 38.0 30.2 38.0 145-149 35.4439 38.0 37.6 38.0 31.0 38.0 150-151 32.01625 36.0 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 2.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 2.0 18 2.0 19 3.0 20 1.0 21 2.0 22 2.0 23 3.0 24 10.0 25 6.0 26 12.0 27 9.0 28 13.0 29 26.0 30 26.0 31 27.0 32 53.0 33 66.0 34 128.0 35 267.0 36 856.0 37 2471.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.25 19.75 11.700000000000001 33.300000000000004 2 28.875 23.549999999999997 29.625 17.95 3 21.725 27.0 28.199999999999996 23.075000000000003 4 25.525 32.15 21.325 21.0 5 26.424999999999997 33.225 22.6 17.75 6 22.675 37.974999999999994 20.724999999999998 18.625 7 21.75 19.275000000000002 36.85 22.125 8 23.400000000000002 24.325 26.1 26.174999999999997 9 22.8 24.7 28.050000000000004 24.45 10-14 25.380000000000003 27.725 24.29 22.605 15-19 24.795 26.979999999999997 25.82 22.405 20-24 24.375 27.115000000000002 25.91 22.6 25-29 25.11 26.540000000000003 25.705 22.645 30-34 24.435000000000002 26.86 25.8 22.905 35-39 24.345 27.175 25.790000000000003 22.689999999999998 40-44 25.15 26.275 26.375 22.2 45-49 24.46 26.705000000000002 26.025 22.81 50-54 24.325 26.765 26.61 22.3 55-59 25.230000000000004 26.224999999999998 26.39 22.155 60-64 24.545 26.745 26.345000000000002 22.365 65-69 24.01 26.895000000000003 26.955000000000002 22.14 70-74 24.845 26.565 25.924999999999997 22.665 75-79 24.755 26.565 26.545 22.134999999999998 80-84 24.685000000000002 27.005000000000003 26.495 21.815 85-89 24.6 26.395000000000003 26.97 22.035 90-94 24.635 26.815 26.534999999999997 22.015 95-99 24.255 26.915 26.784999999999997 22.045 100-104 24.165 26.950000000000003 26.495 22.39 105-109 24.705 27.265 26.495 21.535 110-114 24.305 27.785 26.169999999999998 21.740000000000002 115-119 24.395 27.05 26.395000000000003 22.16 120-124 25.014999999999997 27.339999999999996 25.88 21.765 125-129 24.46 27.22 26.495 21.825 130-134 25.155 26.845000000000002 26.665 21.335 135-139 24.59 27.395000000000003 26.26 21.755 140-144 24.815 27.37 26.05 21.765 145-149 25.419999999999998 27.51 26.215 20.855 150-151 24.637500000000003 27.6125 26.237500000000004 21.512500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 3.0 28 4.0 29 5.5 30 10.5 31 14.0 32 16.5 33 21.5 34 32.0 35 42.5 36 57.0 37 75.0 38 97.0 39 122.5 40 146.0 41 175.5 42 211.5 43 224.5 44 247.0 45 246.0 46 216.0 47 224.5 48 218.5 49 192.5 50 180.5 51 160.5 52 132.5 53 116.5 54 100.0 55 78.0 56 67.5 57 73.0 58 70.0 59 67.0 60 64.5 61 48.0 62 39.0 63 43.0 64 35.5 65 20.5 66 20.0 67 18.0 68 11.5 69 14.5 70 11.5 71 4.5 72 4.0 73 4.0 74 2.5 75 2.0 76 1.0 77 1.0 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.25113008538422904 0.5 3 0.10045203415369162 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.425 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAGA 10 0.006830828 145.0 2 >>END_MODULE Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729876 spots for SRR6958425.sra Written 729876 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra Read 729857 spots for SRR6958425.sra Written 729857 spots for SRR6958425.sra SRR ids: ['SRR6958425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2suxf6hq SRR6958425.sra spots: 14597159 blocks: [[1, 729857], [729858, 1459714], [1459715, 2189571], [2189572, 2919428], [2919429, 3649285], [3649286, 4379142], [4379143, 5108999], [5109000, 5838856], [5838857, 6568713], [6568714, 7298570], [7298571, 8028427], [8028428, 8758284], [8758285, 9488141], [9488142, 10217998], [10217999, 10947855], [10947856, 11677712], [11677713, 12407569], [12407570, 13137426], [13137427, 13867283], [13867284, 14597159]] SRR6958425 file size 4924797 SRR6958425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958425 SRR6958425_1.fastq SRR6958425_2.fastq Input file: SRR6958425_1.fastq Paired file: SRR6958425_2.fastq trimmed: SRR6958425-trimmed-pair1.fastq, SRR6958425-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:50:37 2024 >> started Fri Dec 6 22:50:53 2024 >> done (16.202s) 14597159 read pairs processed; of these: 5293 ( 0.04%) short read pairs filtered out after trimming by size control 4500 ( 0.03%) empty read pairs filtered out after trimming by size control 14587366 (99.93%) read pairs available; of these: 5816656 (39.87%) trimmed read pairs available after processing 8770710 (60.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 1 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 4 0.00% 32 3 0.00% 33 4 0.00% 34 5 0.00% 35 6 0.00% 36 3 0.00% 37 8 0.00% 38 7 0.00% 39 7 0.00% 40 6 0.00% 41 5 0.00% 42 9 0.00% 43 9 0.00% 44 9 0.00% 45 10 0.00% 46 6 0.00% 47 4 0.00% 48 13 0.00% 49 14 0.00% 50 17 0.00% 51 15 0.00% 52 19 0.00% 53 17 0.00% 54 17 0.00% 55 24 0.00% 56 18 0.00% 57 24 0.00% 58 33 0.00% 59 35 0.00% 60 42 0.00% 61 39 0.00% 62 55 0.00% 63 53 0.00% 64 74 0.00% 65 64 0.00% 66 76 0.00% 67 105 0.00% 68 104 0.00% 69 133 0.00% 70 126 0.00% 71 112 0.00% 72 157 0.00% 73 192 0.00% 74 227 0.00% 75 260 0.00% 76 302 0.00% 77 361 0.00% 78 345 0.00% 79 387 0.00% 80 479 0.00% 81 502 0.00% 82 622 0.00% 83 714 0.00% 84 940 0.01% 85 1119 0.01% 86 1135 0.01% 87 1372 0.01% 88 1605 0.01% 89 1628 0.01% 90 1765 0.01% 91 1883 0.01% 92 2105 0.01% 93 2263 0.02% 94 2420 0.02% 95 2830 0.02% 96 2962 0.02% 97 3302 0.02% 98 3593 0.02% 99 4365 0.03% 100 4680 0.03% 101 5487 0.04% 102 4589 0.03% 103 4868 0.03% 104 5187 0.04% 105 5559 0.04% 106 5976 0.04% 107 6464 0.04% 108 6972 0.05% 109 7423 0.05% 110 7714 0.05% 111 8318 0.06% 112 8486 0.06% 113 9232 0.06% 114 9902 0.07% 115 10746 0.07% 116 11481 0.08% 117 11766 0.08% 118 12419 0.09% 119 12955 0.09% 120 13584 0.09% 121 14391 0.10% 122 15167 0.10% 123 16171 0.11% 124 17370 0.12% 125 18275 0.13% 126 18886 0.13% 127 20141 0.14% 128 21119 0.14% 129 22418 0.15% 130 23791 0.16% 131 25150 0.17% 132 26682 0.18% 133 28559 0.20% 134 30754 0.21% 135 33178 0.23% 136 35715 0.24% 137 37562 0.26% 138 40169 0.28% 139 44027 0.30% 140 48441 0.33% 141 52634 0.36% 142 60338 0.41% 143 67723 0.46% 144 79409 0.54% 145 98270 0.67% 146 125295 0.86% 147 176372 1.21% 148 282353 1.94% 149 591724 4.06% 150 3529567 24.20% 151 8770710 60.13% 14587366 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=23 prefix-density=0.54 prefix-fanout=2.7 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=79.74 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.0 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCGGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=27 prefix-density=0.45 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=22.77 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958425 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:51:38 Started mapping on | Dec 06 22:51:38 Finished on | Dec 06 22:54:00 Mapping speed, Million of reads per hour | 369.82 Number of input reads | 14587366 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14151274 Uniquely mapped reads % | 97.01% Average mapped length | 297.48 Number of splices: Total | 16895751 Number of splices: Annotated (sjdb) | 15903800 Number of splices: GT/AG | 16665694 Number of splices: GC/AG | 192760 Number of splices: AT/AC | 6864 Number of splices: Non-canonical | 30433 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 171633 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 4417 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.59% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 268211 268211 268211 N_multimapping 171633 171633 171633 N_noFeature 598310 13731751 721478 N_ambiguous 347093 1732 51373 UnstrandedReadsAssigned:13205871 PositiveStrandReadsAssigned:417791 NegativeStrandReadsAssigned:13378423 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958425 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958425-trimmed-pair1.fastq SRR6958425-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,587,366 reads, 13,351,477 reads pseudoaligned [quant] estimated average fragment length: 248.013 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR6958425.ke.tsv 35125 SRR6958425.se.tsv 88098 total ==> SRR6958425.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.483 0 0 PNS24247 1044 796.987 35.9683 5.31595 PNS24249 1928 1680.99 19.2942 1.35199 PNS24246 1044 796.987 35.9683 5.31595 PNS24248 1044 796.987 35.9683 5.31595 PNS24244 1471 1223.99 40.801 3.92651 PNS24243 293 80.9783 0 0 KQK14069 1603 1355.99 2047.25 177.839 KQK14071 474 232.408 35.5734 18.0296 ==> SRR6958425.se.tsv <== BRADI_1g14170v3 2461 BRADI_1g53295v3 1260 BRADI_1g59795v3 98 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 287 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 208 BRADI_1g48960v3 0 SRR6958425 completed mapping pipeline successfully