Starting /dee2/code/volunteer_pipeline.sh SRR6958426 current disk space = 1548400267264 free memory = 1600087400 SRR6958426 SRAfilesize ba9cddc571313987b532e5276b6b070d SRR6958426.sra SRR6958426.sra file validated SRR6958426 is paired end SRR6958426 is conventional basespace SRR6958426 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.8795 33.0 31.0 33.0 18.0 34.0 2 31.891 33.0 31.0 33.0 28.0 34.0 3 31.53675 33.0 31.0 33.0 28.0 34.0 4 32.28175 33.0 32.0 33.0 31.0 34.0 5 32.26475 33.0 33.0 33.0 31.0 34.0 6 36.7505 38.0 37.0 38.0 34.0 38.0 7 37.2435 38.0 38.0 38.0 36.0 38.0 8 37.292 38.0 38.0 38.0 37.0 38.0 9 37.35725 38.0 38.0 38.0 37.0 38.0 10-14 37.3835 38.0 38.0 38.0 37.0 38.0 15-19 37.359300000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.4233 38.0 38.0 38.0 37.0 38.0 25-29 37.343849999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.24135 38.0 38.0 38.0 36.6 38.0 35-39 36.9385 38.0 38.0 38.0 35.6 38.0 40-44 37.02065 38.0 38.0 38.0 36.0 38.0 45-49 37.08879999999999 38.0 38.0 38.0 36.0 38.0 50-54 37.0338 38.0 38.0 38.0 35.8 38.0 55-59 36.86695 38.0 38.0 38.0 35.0 38.0 60-64 36.943200000000004 38.0 38.0 38.0 35.4 38.0 65-69 36.933949999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.9504 38.0 38.0 38.0 35.4 38.0 75-79 36.6992 38.0 38.0 38.0 34.4 38.0 80-84 36.4149 38.0 37.6 38.0 33.6 38.0 85-89 36.3298 38.0 37.6 38.0 33.8 38.0 90-94 36.45145 38.0 37.8 38.0 33.8 38.0 95-99 36.401050000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.1126 38.0 37.0 38.0 33.0 38.0 105-109 35.77195 38.0 36.6 38.0 31.6 38.0 110-114 35.67925 38.0 36.0 38.0 31.0 38.0 115-119 35.65295 38.0 36.2 38.0 31.0 38.0 120-124 35.425850000000004 38.0 36.0 38.0 29.8 38.0 125-129 34.9072 38.0 35.0 38.0 27.6 38.0 130-134 34.766149999999996 38.0 35.0 38.0 27.4 38.0 135-139 34.435050000000004 38.0 34.8 38.0 25.8 38.0 140-144 34.10940000000001 38.0 34.6 38.0 25.2 38.0 145-149 32.76055 38.0 33.4 38.0 16.8 38.0 150-151 28.163375000000002 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 3.0 20 2.0 21 6.0 22 6.0 23 3.0 24 11.0 25 18.0 26 24.0 27 23.0 28 36.0 29 41.0 30 47.0 31 63.0 32 91.0 33 139.0 34 248.0 35 387.0 36 887.0 37 1960.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.43444730077121 9.177377892030849 7.712082262210797 43.67609254498714 2 21.4 12.875 37.425000000000004 28.299999999999997 3 20.75 13.850000000000001 26.375 39.025 4 24.075 23.5 22.5 29.925 5 25.15 28.975 24.325 21.55 6 23.3 31.374999999999996 23.65 21.675 7 17.025000000000002 24.7 39.6 18.675 8 20.8 23.150000000000002 31.2 24.85 9 19.825 21.175 34.150000000000006 24.85 10-14 22.075 27.105 26.005 24.815 15-19 22.935 26.015 25.69 25.36 20-24 21.755 26.405 26.39 25.45 25-29 22.295 25.759999999999998 26.805 25.14 30-34 21.945 25.8 26.76 25.495 35-39 22.24 26.19 25.874999999999996 25.695 40-44 22.055 25.979999999999997 26.66 25.305 45-49 22.755 26.21 25.95 25.085 50-54 22.535 25.814999999999998 26.275 25.374999999999996 55-59 22.435 25.650000000000002 26.085 25.83 60-64 22.365 26.369999999999997 25.695 25.569999999999997 65-69 22.759999999999998 25.615 26.515 25.11 70-74 22.71 25.874999999999996 26.13 25.285000000000004 75-79 22.825 25.585 26.415 25.174999999999997 80-84 22.35 25.88 26.33 25.44 85-89 22.225 24.545 26.529999999999998 26.700000000000003 90-94 23.05 25.85 25.825 25.275 95-99 23.525 25.035 26.665 24.775 100-104 22.98 25.56 26.479999999999997 24.98 105-109 23.135 25.545 26.13 25.19 110-114 22.79 25.415 26.419999999999998 25.374999999999996 115-119 23.23 25.540000000000003 26.145000000000003 25.085 120-124 22.765 26.035000000000004 25.335 25.865 125-129 23.565 24.915000000000003 26.490000000000002 25.03 130-134 22.715 26.325 25.77 25.19 135-139 22.705000000000002 25.0 26.66 25.635 140-144 23.105 25.374999999999996 25.91 25.61 145-149 22.82 25.665 25.900000000000002 25.615 150-151 23.193298324581146 25.581395348837212 25.44386096524131 25.78144536134033 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.5 28 4.0 29 4.5 30 5.5 31 10.5 32 17.5 33 22.5 34 30.0 35 44.0 36 55.0 37 71.0 38 81.5 39 105.0 40 138.0 41 166.0 42 185.0 43 187.0 44 201.5 45 221.0 46 222.5 47 219.5 48 208.0 49 183.0 50 175.5 51 155.0 52 124.5 53 115.0 54 111.5 55 101.0 56 97.0 57 89.5 58 75.5 59 74.5 60 76.5 61 75.5 62 58.0 63 40.5 64 44.5 65 46.0 66 35.0 67 23.5 68 19.0 69 17.5 70 18.0 71 12.0 72 7.5 73 8.0 74 6.0 75 3.5 76 0.5 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 2.0999999999999996 0.0 0.0 0.0 0.0 136-137 2.2750000000000004 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAATG 10 0.006832588 144.9875 7 >>END_MODULE SRR6958426 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958426_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90675 33.0 33.0 34.0 32.0 34.0 2 32.989 33.0 33.0 34.0 32.0 34.0 3 32.9705 34.0 33.0 34.0 32.0 34.0 4 32.97375 34.0 33.0 34.0 32.0 34.0 5 32.95375 34.0 33.0 34.0 32.0 34.0 6 37.137 38.0 38.0 38.0 36.0 38.0 7 37.022 38.0 38.0 38.0 36.0 38.0 8 36.895 38.0 38.0 38.0 36.0 38.0 9 37.0595 38.0 38.0 38.0 36.0 38.0 10-14 36.94879999999999 38.0 38.0 38.0 36.0 38.0 15-19 36.9365 38.0 38.0 38.0 36.0 38.0 20-24 36.95185 38.0 38.0 38.0 36.0 38.0 25-29 37.06485 38.0 38.0 38.0 36.0 38.0 30-34 36.9976 38.0 38.0 38.0 36.0 38.0 35-39 36.911699999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.8202 38.0 38.0 38.0 35.6 38.0 45-49 36.904050000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.836149999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.775600000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.76495 38.0 38.0 38.0 34.8 38.0 65-69 36.65559999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.534349999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.32395 38.0 38.0 38.0 33.6 38.0 80-84 36.21825 38.0 37.8 38.0 33.4 38.0 85-89 36.126349999999995 38.0 37.4 38.0 33.2 38.0 90-94 36.157450000000004 38.0 37.8 38.0 33.4 38.0 95-99 35.9718 38.0 37.2 38.0 32.8 38.0 100-104 35.7109 38.0 37.0 38.0 31.4 38.0 105-109 35.53605 38.0 36.8 38.0 30.6 38.0 110-114 35.25665 38.0 36.0 38.0 28.6 38.0 115-119 35.0105 38.0 35.6 38.0 28.0 38.0 120-124 35.0372 38.0 35.4 38.0 28.2 38.0 125-129 34.7102 38.0 35.0 38.0 27.2 38.0 130-134 34.17015 38.0 34.6 38.0 23.4 38.0 135-139 33.688849999999995 38.0 34.0 38.0 21.8 38.0 140-144 33.43265 38.0 33.6 38.0 21.8 38.0 145-149 32.336 38.0 32.4 38.0 13.2 38.0 150-151 27.561500000000002 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 2.0 5 0.0 6 1.0 7 0.0 8 3.0 9 0.0 10 1.0 11 1.0 12 4.0 13 1.0 14 2.0 15 3.0 16 3.0 17 5.0 18 3.0 19 7.0 20 6.0 21 12.0 22 8.0 23 8.0 24 17.0 25 27.0 26 25.0 27 26.0 28 32.0 29 55.0 30 54.0 31 60.0 32 110.0 33 140.0 34 207.0 35 358.0 36 821.0 37 1995.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.800000000000004 16.650000000000002 13.075000000000001 36.475 2 28.482120530132534 23.25581395348837 28.632158039509875 19.629907476869217 3 19.959979989995 26.688344172086044 29.264632316158078 24.087043521760883 4 23.892919689767325 32.04903677758319 22.066549912434326 21.99149362021516 5 28.396297222917187 32.34926194645985 19.714786089567177 19.53965474105579 6 23.075000000000003 36.1 20.7 20.125 7 21.775 19.7 35.949999999999996 22.575 8 23.5 23.474999999999998 25.95 27.075 9 22.875 23.150000000000002 29.9 24.075 10-14 25.080000000000002 26.840000000000003 24.12 23.96 15-19 25.19 25.624999999999996 25.445 23.74 20-24 24.615000000000002 26.99 24.709999999999997 23.685000000000002 25-29 25.3 26.229999999999997 24.9 23.57 30-34 25.230000000000004 26.135 25.014999999999997 23.62 35-39 25.72 25.88 24.79 23.61 40-44 25.745 25.595000000000002 25.155 23.505000000000003 45-49 24.935 26.735 24.63 23.7 50-54 25.185000000000002 26.85 24.8 23.165 55-59 25.85 26.465 24.32 23.365 60-64 25.39 26.465 24.335 23.810000000000002 65-69 25.835 26.05 25.19 22.925 70-74 25.685000000000002 25.845000000000002 25.3 23.169999999999998 75-79 25.424999999999997 25.82 25.745 23.01 80-84 25.25 26.13 25.119999999999997 23.5 85-89 25.380000000000003 26.290000000000003 25.19 23.14 90-94 24.82 26.25 25.19 23.74 95-99 26.51 25.430000000000003 25.264999999999997 22.795 100-104 25.415 25.845000000000002 25.569999999999997 23.169999999999998 105-109 25.415 26.035000000000004 25.369999999999997 23.18 110-114 25.82 26.669999999999998 24.875 22.634999999999998 115-119 25.575 25.924999999999997 25.785000000000004 22.715 120-124 25.655 26.179999999999996 25.465 22.7 125-129 25.840000000000003 26.66 25.06 22.439999999999998 130-134 25.96 26.435 25.4 22.205 135-139 25.345000000000002 26.314999999999998 25.46 22.88 140-144 25.695 26.72 24.85 22.735 145-149 25.755 26.43 25.155 22.66 150-151 25.95 26.4625 25.0375 22.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 1.0 27 1.5 28 4.5 29 6.0 30 6.0 31 8.5 32 14.0 33 20.0 34 27.5 35 39.5 36 54.5 37 63.0 38 81.0 39 109.0 40 129.0 41 152.0 42 178.5 43 193.5 44 201.5 45 219.0 46 211.5 47 192.5 48 188.5 49 180.5 50 175.5 51 151.0 52 130.5 53 120.0 54 99.0 55 96.5 56 99.5 57 100.5 58 88.5 59 77.0 60 69.0 61 55.5 62 53.0 63 51.5 64 49.5 65 49.0 66 41.0 67 33.0 68 34.5 69 36.0 70 30.0 71 22.0 72 16.5 73 11.5 74 8.0 75 3.0 76 3.0 77 4.5 78 3.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19212320121181 98.225 2 0.7321383489017925 1.4500000000000002 3 0.0 0.0 4 0.050492299924261554 0.2 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0125 0.0 0.0 98-99 0.2 0.0 0.025 0.0 0.0 100-101 0.25 0.0 0.025 0.0 0.0 102-103 0.275 0.0 0.025 0.0 0.0 104-105 0.3 0.0 0.025 0.0 0.0 106-107 0.3 0.0 0.025 0.0 0.0 108-109 0.4 0.0 0.025 0.0 0.0 110-111 0.525 0.0 0.025 0.0 0.0 112-113 0.6125 0.0 0.025 0.0 0.0 114-115 0.6875 0.0 0.025 0.0 0.0 116-117 0.775 0.0 0.025 0.0 0.0 118-119 0.8625 0.0 0.025 0.0 0.0 120-121 0.9875 0.0 0.025 0.0 0.0 122-123 1.0625 0.0 0.025 0.0 0.0 124-125 1.1875 0.0 0.025 0.0 0.0 126-127 1.325 0.0 0.025 0.0 0.0 128-129 1.525 0.0 0.025 0.0 0.0 130-131 1.5875 0.0 0.025 0.0 0.0 132-133 1.775 0.0 0.025 0.0 0.0 134-135 2.0625 0.0 0.025 0.0 0.0 136-137 2.2 0.0 0.025 0.0 0.0 138-139 2.3375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255700 spots for SRR6958426.sra Written 1255700 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra Read 1255693 spots for SRR6958426.sra Written 1255693 spots for SRR6958426.sra SRR ids: ['SRR6958426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b6itforq SRR6958426.sra spots: 25113867 blocks: [[1, 1255693], [1255694, 2511386], [2511387, 3767079], [3767080, 5022772], [5022773, 6278465], [6278466, 7534158], [7534159, 8789851], [8789852, 10045544], [10045545, 11301237], [11301238, 12556930], [12556931, 13812623], [13812624, 15068316], [15068317, 16324009], [16324010, 17579702], [17579703, 18835395], [18835396, 20091088], [20091089, 21346781], [21346782, 22602474], [22602475, 23858167], [23858168, 25113867]] SRR6958426 file size 8488565 SRR6958426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958426 SRR6958426_1.fastq SRR6958426_2.fastq Input file: SRR6958426_1.fastq Paired file: SRR6958426_2.fastq trimmed: SRR6958426-trimmed-pair1.fastq, SRR6958426-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:54:00 2024 >> started Fri Dec 6 22:54:26 2024 >> done (26.223s) 25113867 read pairs processed; of these: 13387 ( 0.05%) short read pairs filtered out after trimming by size control 11151 ( 0.04%) empty read pairs filtered out after trimming by size control 25089329 (99.90%) read pairs available; of these: 8873365 (35.37%) trimmed read pairs available after processing 16215964 (64.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 7 0.00% 23 11 0.00% 24 10 0.00% 25 3 0.00% 26 3 0.00% 27 5 0.00% 28 6 0.00% 29 4 0.00% 30 4 0.00% 31 11 0.00% 32 8 0.00% 33 7 0.00% 34 11 0.00% 35 4 0.00% 36 10 0.00% 37 12 0.00% 38 12 0.00% 39 9 0.00% 40 12 0.00% 41 11 0.00% 42 10 0.00% 43 17 0.00% 44 12 0.00% 45 19 0.00% 46 21 0.00% 47 29 0.00% 48 25 0.00% 49 23 0.00% 50 37 0.00% 51 33 0.00% 52 40 0.00% 53 55 0.00% 54 48 0.00% 55 53 0.00% 56 59 0.00% 57 61 0.00% 58 84 0.00% 59 73 0.00% 60 96 0.00% 61 86 0.00% 62 117 0.00% 63 101 0.00% 64 165 0.00% 65 176 0.00% 66 198 0.00% 67 208 0.00% 68 228 0.00% 69 272 0.00% 70 304 0.00% 71 336 0.00% 72 362 0.00% 73 426 0.00% 74 445 0.00% 75 504 0.00% 76 599 0.00% 77 606 0.00% 78 752 0.00% 79 849 0.00% 80 945 0.00% 81 1014 0.00% 82 1198 0.00% 83 1411 0.01% 84 2102 0.01% 85 2550 0.01% 86 2624 0.01% 87 2797 0.01% 88 2926 0.01% 89 3018 0.01% 90 3300 0.01% 91 3481 0.01% 92 3753 0.01% 93 4103 0.02% 94 4446 0.02% 95 4671 0.02% 96 5138 0.02% 97 5370 0.02% 98 5682 0.02% 99 6036 0.02% 100 6487 0.03% 101 7111 0.03% 102 7460 0.03% 103 7903 0.03% 104 8473 0.03% 105 8961 0.04% 106 9664 0.04% 107 10089 0.04% 108 10674 0.04% 109 11566 0.05% 110 12262 0.05% 111 12710 0.05% 112 13677 0.05% 113 14530 0.06% 114 15082 0.06% 115 16589 0.07% 116 17588 0.07% 117 18491 0.07% 118 19646 0.08% 119 20262 0.08% 120 21766 0.09% 121 22590 0.09% 122 23811 0.09% 123 24911 0.10% 124 26838 0.11% 125 27953 0.11% 126 29620 0.12% 127 31645 0.13% 128 33320 0.13% 129 35017 0.14% 130 37413 0.15% 131 39230 0.16% 132 42287 0.17% 133 44897 0.18% 134 47683 0.19% 135 51409 0.20% 136 55050 0.22% 137 59830 0.24% 138 63627 0.25% 139 70039 0.28% 140 75503 0.30% 141 83260 0.33% 142 94862 0.38% 143 107605 0.43% 144 126781 0.51% 145 154461 0.62% 146 196481 0.78% 147 272061 1.08% 148 429270 1.71% 149 896882 3.57% 150 5323772 21.22% 151 16215964 64.63% 25089329 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=22 prefix-density=0.58 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=39.59 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=22 prefix-density=0.43 prefix-fanout=2.7 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=73.52 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.9 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958426 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:55:58 Started mapping on | Dec 06 22:55:59 Finished on | Dec 06 22:58:28 Mapping speed, Million of reads per hour | 606.19 Number of input reads | 25089329 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 23801046 Uniquely mapped reads % | 94.87% Average mapped length | 293.64 Number of splices: Total | 28331110 Number of splices: Annotated (sjdb) | 26722230 Number of splices: GT/AG | 27937583 Number of splices: GC/AG | 326742 Number of splices: AT/AC | 11525 Number of splices: Non-canonical | 55260 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293516 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 10720 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1002457 1002457 1002457 N_multimapping 293516 293516 293516 N_noFeature 939057 23112983 1118134 N_ambiguous 609016 3086 101745 UnstrandedReadsAssigned:22252973 PositiveStrandReadsAssigned:684977 NegativeStrandReadsAssigned:22581167 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=146 echo kmer=141 SRR6958426 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958426-trimmed-pair1.fastq SRR6958426-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,089,329 reads, 23,144,998 reads pseudoaligned [quant] estimated average fragment length: 272.815 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR6958426.ke.tsv 35125 SRR6958426.se.tsv 88098 total ==> SRR6958426.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.648 0 0 PNS24247 1044 772.185 79.8917 6.70769 PNS24249 1928 1656.19 56.0674 2.1948 PNS24246 1044 772.185 79.8917 6.70769 PNS24248 1044 772.185 79.8917 6.70769 PNS24244 1471 1199.19 73.2576 3.96059 PNS24243 293 77.6827 1 0.834581 KQK14069 1603 1331.19 4102.78 199.817 KQK14071 474 216.922 94.7936 28.3314 ==> SRR6958426.se.tsv <== BRADI_1g14170v3 4719 BRADI_1g53295v3 2294 BRADI_1g59795v3 176 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 481 BRADI_1g74790v3 169 BRADI_1g09890v3 0 BRADI_1g77505v3 402 BRADI_1g48960v3 0 SRR6958426 completed mapping pipeline successfully