Starting /dee2/code/volunteer_pipeline.sh SRR6958428 current disk space = 1548315365376 free memory = 1601602912 SRR6958428 SRAfilesize ad47e0e5350cb55b163346e84d0f2199 SRR6958428.sra SRR6958428.sra file validated SRR6958428 is paired end SRR6958428 is conventional basespace SRR6958428 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.5955 32.0 25.0 33.0 18.0 33.0 2 28.5295 31.0 27.0 33.0 18.0 33.0 3 30.574 31.0 29.0 33.0 27.0 33.0 4 31.08075 33.0 31.0 33.0 28.0 33.0 5 31.89625 33.0 32.0 33.0 31.0 34.0 6 36.459 38.0 37.0 38.0 34.0 38.0 7 37.164 38.0 38.0 38.0 36.0 38.0 8 37.0995 38.0 38.0 38.0 36.0 38.0 9 37.1485 38.0 38.0 38.0 36.0 38.0 10-14 37.3193 38.0 38.0 38.0 36.8 38.0 15-19 37.4049 38.0 38.0 38.0 37.0 38.0 20-24 37.28609999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.060050000000004 38.0 38.0 38.0 36.2 38.0 30-34 37.0005 38.0 38.0 38.0 36.0 38.0 35-39 36.8297 38.0 38.0 38.0 35.2 38.0 40-44 36.92614999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.8234 38.0 38.0 38.0 35.0 38.0 50-54 36.480650000000004 38.0 38.0 38.0 33.8 38.0 55-59 36.4858 38.0 38.0 38.0 33.8 38.0 60-64 36.74715 38.0 38.0 38.0 34.6 38.0 65-69 36.735699999999994 38.0 38.0 38.0 35.0 38.0 70-74 36.45245 38.0 38.0 38.0 34.0 38.0 75-79 35.966300000000004 38.0 36.8 38.0 31.8 38.0 80-84 35.70675 38.0 36.6 38.0 30.4 38.0 85-89 35.9563 38.0 37.0 38.0 32.2 38.0 90-94 36.0473 38.0 37.0 38.0 32.8 38.0 95-99 35.722950000000004 38.0 36.6 38.0 31.4 38.0 100-104 34.946600000000004 38.0 35.4 38.0 27.4 38.0 105-109 34.5857 38.0 35.0 38.0 25.8 38.0 110-114 34.7334 38.0 35.0 38.0 26.4 38.0 115-119 34.564150000000005 38.0 35.0 38.0 25.6 38.0 120-124 34.34355 38.0 34.2 38.0 24.8 38.0 125-129 34.08155 38.0 34.0 38.0 22.4 38.0 130-134 33.7935 38.0 34.0 38.0 22.2 38.0 135-139 33.028800000000004 37.6 33.2 38.0 16.0 38.0 140-144 32.23415 36.6 32.2 38.0 14.2 38.0 145-149 30.208599999999997 35.8 28.4 38.0 8.6 38.0 150-151 25.15725 32.5 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 3.0 16 4.0 17 4.0 18 5.0 19 7.0 20 7.0 21 3.0 22 8.0 23 15.0 24 12.0 25 28.0 26 16.0 27 48.0 28 51.0 29 61.0 30 78.0 31 114.0 32 131.0 33 205.0 34 291.0 35 530.0 36 1044.0 37 1329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.532831001076424 11.302475780409042 7.965554359526372 35.199138858988164 2 21.925 11.15 32.574999999999996 34.35 3 21.4 15.0 25.575 38.025 4 24.85 19.650000000000002 24.075 31.424999999999997 5 25.8 25.674999999999997 24.125 24.4 6 24.349999999999998 29.425 23.474999999999998 22.75 7 18.275 25.025 37.1 19.6 8 20.825 25.025 27.725 26.424999999999997 9 20.225 22.650000000000002 31.424999999999997 25.7 10-14 21.69 26.779999999999998 26.265 25.264999999999997 15-19 22.56 25.245 26.32 25.874999999999996 20-24 22.42 25.595000000000002 25.965 26.02 25-29 22.650000000000002 25.419999999999998 25.6 26.33 30-34 22.89 25.245 24.915000000000003 26.950000000000003 35-39 23.05 25.4 24.97 26.58 40-44 22.34 24.855 25.7 27.105 45-49 22.74 25.845000000000002 24.82 26.595000000000002 50-54 23.14 25.485000000000003 25.275 26.1 55-59 22.78 25.474999999999998 25.374999999999996 26.369999999999997 60-64 23.01 24.845 25.345000000000002 26.8 65-69 23.115 24.84 25.165 26.88 70-74 22.945 24.97 25.035 27.05 75-79 23.84 24.67 25.19 26.3 80-84 22.53 24.695 26.255 26.52 85-89 23.435 24.865000000000002 25.074999999999996 26.625 90-94 23.34 25.155 25.165 26.340000000000003 95-99 23.32 24.635 25.509999999999998 26.534999999999997 100-104 23.080000000000002 24.82 25.77 26.33 105-109 23.419999999999998 24.435000000000002 25.335 26.810000000000002 110-114 23.53 24.13 25.4 26.939999999999998 115-119 23.415 25.014999999999997 25.095 26.474999999999998 120-124 23.1 24.72 25.430000000000003 26.75 125-129 24.15 24.46 24.779999999999998 26.61 130-134 23.505000000000003 25.215 24.845 26.435 135-139 22.985 25.230000000000004 25.055 26.729999999999997 140-144 23.61 25.53 24.485 26.375 145-149 24.22 25.52 24.349999999999998 25.91 150-151 23.7375 24.65 24.5 27.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.0 28 1.5 29 4.0 30 5.0 31 7.0 32 14.0 33 20.0 34 22.5 35 36.5 36 53.5 37 73.0 38 100.0 39 113.0 40 112.0 41 142.5 42 166.5 43 167.5 44 185.5 45 208.5 46 207.0 47 192.0 48 190.5 49 174.0 50 158.5 51 153.5 52 137.5 53 121.5 54 107.0 55 95.5 56 90.0 57 80.5 58 72.0 59 60.5 60 61.5 61 69.5 62 71.0 63 65.5 64 52.5 65 47.5 66 42.5 67 37.0 68 39.5 69 39.0 70 37.5 71 33.5 72 29.0 73 29.5 74 23.0 75 16.0 76 10.5 77 7.0 78 7.0 79 4.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.2125 0.0 0.0 0.0 0.0 124-125 2.4749999999999996 0.0 0.0 0.0 0.0 126-127 2.7874999999999996 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 4.0 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGAA 10 0.006841402 144.925 3 AAAGAAA 10 0.006841402 144.925 4 >>END_MODULE SRR6958428 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958428_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5425 33.0 33.0 34.0 32.0 34.0 2 32.51925 33.0 33.0 34.0 32.0 34.0 3 32.47125 33.0 33.0 34.0 31.0 34.0 4 32.3235 33.0 33.0 34.0 31.0 34.0 5 32.29025 33.0 33.0 34.0 31.0 34.0 6 36.11175 38.0 38.0 38.0 33.0 38.0 7 36.18375 38.0 38.0 38.0 33.0 38.0 8 36.13875 38.0 38.0 38.0 33.0 38.0 9 36.1615 38.0 38.0 38.0 33.0 38.0 10-14 36.1662 38.0 38.0 38.0 33.4 38.0 15-19 36.27515 38.0 38.0 38.0 34.0 38.0 20-24 36.364999999999995 38.0 38.0 38.0 34.2 38.0 25-29 36.3883 38.0 38.0 38.0 34.4 38.0 30-34 36.37885 38.0 38.0 38.0 34.6 38.0 35-39 36.1294 38.0 38.0 38.0 33.8 38.0 40-44 36.07095 38.0 38.0 38.0 33.6 38.0 45-49 35.95345 38.0 38.0 38.0 33.0 38.0 50-54 36.0159 38.0 38.0 38.0 33.6 38.0 55-59 36.08935 38.0 38.0 38.0 33.8 38.0 60-64 36.0048 38.0 38.0 38.0 33.4 38.0 65-69 35.825399999999995 38.0 38.0 38.0 32.8 38.0 70-74 35.7916 38.0 38.0 38.0 32.6 38.0 75-79 35.569300000000005 38.0 37.2 38.0 30.8 38.0 80-84 35.53915 38.0 37.0 38.0 31.0 38.0 85-89 35.4921 38.0 37.2 38.0 31.0 38.0 90-94 35.380649999999996 38.0 37.0 38.0 30.2 38.0 95-99 35.191199999999995 38.0 36.6 38.0 29.2 38.0 100-104 34.9253 38.0 36.2 38.0 28.0 38.0 105-109 34.60235 38.0 35.4 38.0 25.8 38.0 110-114 34.451750000000004 38.0 35.2 38.0 24.8 38.0 115-119 34.40505 38.0 35.0 38.0 25.0 38.0 120-124 34.22695 38.0 35.0 38.0 24.2 38.0 125-129 33.77685 38.0 34.8 38.0 20.6 38.0 130-134 33.376450000000006 38.0 34.0 38.0 18.6 38.0 135-139 32.935649999999995 38.0 33.6 38.0 14.4 38.0 140-144 32.1594 38.0 31.8 38.0 13.2 38.0 145-149 31.026600000000002 37.6 30.4 38.0 8.6 38.0 150-151 25.741 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 14.0 4 9.0 5 4.0 6 4.0 7 7.0 8 3.0 9 2.0 10 4.0 11 3.0 12 5.0 13 5.0 14 2.0 15 2.0 16 2.0 17 2.0 18 5.0 19 8.0 20 5.0 21 3.0 22 18.0 23 22.0 24 30.0 25 29.0 26 27.0 27 41.0 28 40.0 29 58.0 30 64.0 31 103.0 32 101.0 33 145.0 34 227.0 35 353.0 36 736.0 37 1890.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.025000000000006 20.599999999999998 10.6 25.775 2 29.182295573893473 24.706176544136035 24.85621405351338 21.255313828457115 3 24.087043521760883 26.563281640820406 25.56278139069535 23.78689344672336 4 26.826826826826828 31.03103103103103 19.66966966966967 22.47247247247247 5 27.213606803401703 32.89144572286143 19.259629814907452 20.635317658829415 6 23.78094523630908 34.308577144286076 21.8304576144036 20.080020005001252 7 23.150000000000002 21.125 32.775 22.95 8 26.106526631657918 22.83070767691923 22.705676419104776 28.35708927231808 9 23.400000000000002 23.7 27.05 25.85 10-14 26.68667166791698 25.906476619154787 23.10577644411103 24.301075268817204 15-19 26.6753350670134 25.69013802760552 23.789757951590317 23.84476895379076 20-24 26.22893434015102 26.258938840826122 23.68855328299245 23.823573536030406 25-29 26.914037105565836 25.59383907586138 23.83357503625544 23.65854878231735 30-34 26.34526905381076 25.5251050210042 24.60492098419684 23.524704940988197 35-39 26.57765776577658 25.762576257625764 23.27232723272327 24.387438743874387 40-44 26.575 25.324999999999996 24.044999999999998 24.055 45-49 26.49632481624081 25.486274313715683 24.26621331066553 23.751187559377968 50-54 27.222722272227223 25.452545254525454 23.862386238623863 23.462346234623464 55-59 26.631331566578332 25.02125106255313 24.376218810940546 23.971198559928 60-64 27.110422084416886 25.76515303060612 23.729745949189837 23.39467893578716 65-69 26.535307061412283 25.08501700340068 24.56491298259652 23.814762952590517 70-74 27.159073861079165 24.993749062359356 24.593689053358002 23.25348802320348 75-79 27.05541108221644 25.09501900380076 24.499899979995998 23.349669933986796 80-84 27.246362318115906 25.706285314265713 23.981199059953 23.06615330766538 85-89 27.057705770577055 25.007500750075007 24.477447744774476 23.457345734573458 90-94 26.44396659498925 24.833725058758812 24.83872580887133 23.883582537380608 95-99 26.23393509026354 26.108916337450616 23.96359453918088 23.693554033104967 100-104 27.137713771377136 25.58255825582558 24.012401240124014 23.26732673267327 105-109 26.766338316915846 25.151257562878143 24.441222061103055 23.641182059102956 110-114 26.837683768376834 25.40754075407541 24.597459745974597 23.157315731573156 115-119 27.2163608180409 25.17625881294065 24.286214310715536 23.321166058302914 120-124 27.084999999999997 25.195 24.375 23.345 125-129 26.919999999999998 25.485000000000003 24.315 23.28 130-134 27.525 25.874999999999996 24.145 22.455 135-139 26.87 24.59 25.385 23.155 140-144 27.816390819540977 25.771288564428225 24.516225811290564 21.896094804740237 145-149 27.62 25.635 24.32 22.425 150-151 27.17839729966246 26.215776972121514 24.6530816352044 21.952744093011624 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.0 27 2.5 28 5.0 29 5.0 30 5.5 31 7.0 32 7.0 33 13.0 34 22.0 35 28.0 36 35.5 37 50.0 38 69.5 39 87.0 40 101.5 41 125.5 42 147.5 43 161.5 44 179.5 45 200.0 46 201.0 47 209.0 48 212.0 49 179.0 50 157.5 51 141.5 52 124.0 53 123.0 54 124.0 55 120.0 56 110.0 57 89.5 58 82.5 59 80.0 60 75.5 61 78.5 62 67.0 63 54.5 64 63.5 65 59.0 66 54.0 67 51.0 68 48.0 69 51.0 70 45.0 71 36.0 72 26.0 73 19.5 74 17.0 75 15.0 76 10.5 77 8.5 78 5.0 79 2.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.1 5 0.05 6 0.025 7 0.0 8 0.025 9 0.0 10-14 0.025 15-19 0.02 20-24 0.015 25-29 0.015 30-34 0.02 35-39 0.01 40-44 0.0 45-49 0.005 50-54 0.01 55-59 0.005 60-64 0.02 65-69 0.02 70-74 0.015 75-79 0.02 80-84 0.005 85-89 0.01 90-94 0.015 95-99 0.015 100-104 0.01 105-109 0.005 110-114 0.01 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14054600606673 98.05 2 0.6572295247724975 1.3 3 0.1769464105156724 0.525 4 0.0 0.0 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGACACAGCCACGAATTTGCAGTGTACGCAGTTCTAGTAAACAAGAACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.2625 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7875 0.0 0.0 0.0 0.0 134-135 4.175 0.0 0.0 0.0 0.0 136-137 4.6375 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACAAT 10 0.006830828 145.0 8 >>END_MODULE Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra Read 864737 spots for SRR6958428.sra Written 864737 spots for SRR6958428.sra SRR ids: ['SRR6958428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5mlo_wox SRR6958428.sra spots: 17294740 blocks: [[1, 864737], [864738, 1729474], [1729475, 2594211], [2594212, 3458948], [3458949, 4323685], [4323686, 5188422], [5188423, 6053159], [6053160, 6917896], [6917897, 7782633], [7782634, 8647370], [8647371, 9512107], [9512108, 10376844], [10376845, 11241581], [11241582, 12106318], [12106319, 12971055], [12971056, 13835792], [13835793, 14700529], [14700530, 15565266], [15565267, 16430003], [16430004, 17294740]] SRR6958428 file size 5838919 SRR6958428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958428 SRR6958428_1.fastq SRR6958428_2.fastq Input file: SRR6958428_1.fastq Paired file: SRR6958428_2.fastq trimmed: SRR6958428-trimmed-pair1.fastq, SRR6958428-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:57:02 2024 >> started Fri Dec 6 22:57:21 2024 >> done (18.945s) 17294740 read pairs processed; of these: 48437 ( 0.28%) short read pairs filtered out after trimming by size control 44798 ( 0.26%) empty read pairs filtered out after trimming by size control 17201505 (99.46%) read pairs available; of these: 7610686 (44.24%) trimmed read pairs available after processing 9590819 (55.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 9 0.00% 21 9 0.00% 22 8 0.00% 23 6 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 7 0.00% 28 7 0.00% 29 12 0.00% 30 10 0.00% 31 5 0.00% 32 8 0.00% 33 7 0.00% 34 7 0.00% 35 13 0.00% 36 6 0.00% 37 13 0.00% 38 17 0.00% 39 15 0.00% 40 16 0.00% 41 19 0.00% 42 25 0.00% 43 31 0.00% 44 14 0.00% 45 19 0.00% 46 28 0.00% 47 29 0.00% 48 30 0.00% 49 31 0.00% 50 30 0.00% 51 33 0.00% 52 45 0.00% 53 59 0.00% 54 56 0.00% 55 73 0.00% 56 67 0.00% 57 83 0.00% 58 103 0.00% 59 94 0.00% 60 109 0.00% 61 102 0.00% 62 132 0.00% 63 160 0.00% 64 166 0.00% 65 185 0.00% 66 214 0.00% 67 235 0.00% 68 270 0.00% 69 286 0.00% 70 377 0.00% 71 417 0.00% 72 475 0.00% 73 488 0.00% 74 550 0.00% 75 607 0.00% 76 735 0.00% 77 848 0.00% 78 851 0.00% 79 993 0.01% 80 1148 0.01% 81 1304 0.01% 82 1520 0.01% 83 1826 0.01% 84 3723 0.02% 85 4863 0.03% 86 4912 0.03% 87 5066 0.03% 88 5047 0.03% 89 5004 0.03% 90 5395 0.03% 91 5603 0.03% 92 5803 0.03% 93 5991 0.03% 94 6639 0.04% 95 7064 0.04% 96 7456 0.04% 97 7917 0.05% 98 8308 0.05% 99 8932 0.05% 100 9555 0.06% 101 10042 0.06% 102 10588 0.06% 103 11456 0.07% 104 12289 0.07% 105 12962 0.08% 106 13866 0.08% 107 14584 0.08% 108 15304 0.09% 109 15981 0.09% 110 16745 0.10% 111 18009 0.10% 112 19315 0.11% 113 20125 0.12% 114 21692 0.13% 115 22842 0.13% 116 24322 0.14% 117 25088 0.15% 118 26105 0.15% 119 27616 0.16% 120 28399 0.17% 121 29814 0.17% 122 31766 0.18% 123 33025 0.19% 124 35611 0.21% 125 37567 0.22% 126 38827 0.23% 127 41018 0.24% 128 42345 0.25% 129 44558 0.26% 130 46306 0.27% 131 49106 0.29% 132 51486 0.30% 133 54481 0.32% 134 57290 0.33% 135 60497 0.35% 136 63671 0.37% 137 68009 0.40% 138 72144 0.42% 139 75947 0.44% 140 82257 0.48% 141 88182 0.51% 142 97331 0.57% 143 109681 0.64% 144 126878 0.74% 145 149076 0.87% 146 185197 1.08% 147 246237 1.43% 148 370965 2.16% 149 765729 4.45% 150 3966007 23.06% 151 9590819 55.76% 17201505 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=34 prefix-density=0.94 prefix-fanout=2.1 sequence=GAGCTGGAGCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=249.94 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=28.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=10.60 fanout-score-rank=17 prefix-density=2.16 prefix-fanout=3.6 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGCGCCTCGCAGTCGCAGGTTGCCTAGCTCGACTTGTGAGAGTTGAGCTACGTATAGTACCAGCTGGCCACCCTCTGAGAATACTATACTGTAATAAGATGAAGAAGAATAAAATTCCCACGATCACATGTACTGTTATACTGAGAGTAGAGTCTGTACCGTGGGATTTATACCGTACGTCGTTGTGTAAATTTCCTTTTAATTTGTTTGAATCGTGAATCGTATATGTATGTTCACATGTACACTGTGTTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=75.71 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.3 sequence=CGACGGCGAGGCGCCGCGCAGCAAGATCTTCTTCATCTCCTGGTCGCCGGAGACGGCGGAGGTGAGGAGCAAGATGGTGTACGCGAGCTCCAACGAAGGGTTCAAGAAGGAGCTGGACGGGACGCAGATCGACGTGCAAGCCACCGACCCCAGCGAGCTCACGCTCCAGATCCTCAAGGACCTCGCCGCCTAATCAGTCTTCTTTACCAACTCAAAATCATTGATCCCTCCTCGTGTGCGTGTTGTCACGTTGGCCCTGCCCCTTCGTGCGTGTGCAACAACAAGTTCCGTGCTTTACGGACCGGCGTTACGTACGTGGT SRR6958428 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:58:20 Started mapping on | Dec 06 22:58:20 Finished on | Dec 06 22:59:37 Mapping speed, Million of reads per hour | 804.23 Number of input reads | 17201505 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16513901 Uniquely mapped reads % | 96.00% Average mapped length | 295.26 Number of splices: Total | 16094890 Number of splices: Annotated (sjdb) | 15091829 Number of splices: GT/AG | 15900412 Number of splices: GC/AG | 151456 Number of splices: AT/AC | 6831 Number of splices: Non-canonical | 36191 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 139512 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 41878 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 1.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576344 576344 576344 N_multimapping 139512 139512 139512 N_noFeature 647349 16003326 833639 N_ambiguous 372522 2384 49740 UnstrandedReadsAssigned:15494030 PositiveStrandReadsAssigned:508191 NegativeStrandReadsAssigned:15630522 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958428 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958428-trimmed-pair1.fastq SRR6958428-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,201,505 reads, 15,612,280 reads pseudoaligned [quant] estimated average fragment length: 244.674 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR6958428.ke.tsv 35125 SRR6958428.se.tsv 88098 total ==> SRR6958428.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.638 138.985 16.6263 PNS24247 1044 800.326 38.4999 3.9859 PNS24249 1928 1684.33 178.489 8.7805 PNS24246 1044 800.326 38.4999 3.9859 PNS24248 1044 800.326 38.4999 3.9859 PNS24244 1471 1227.33 111.027 7.49552 PNS24243 293 89.6222 0 0 KQK14069 1603 1359.33 153.467 9.35457 KQK14071 474 239.188 1.79682 0.622445 ==> SRR6958428.se.tsv <== BRADI_1g14170v3 170 BRADI_1g53295v3 236 BRADI_1g59795v3 69 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 893 BRADI_1g74790v3 861 BRADI_1g09890v3 0 BRADI_1g77505v3 58 BRADI_1g48960v3 0 SRR6958428 completed mapping pipeline successfully