Starting /dee2/code/volunteer_pipeline.sh SRR6958429 current disk space = 1548279021568 free memory = 1603066868 SRR6958429 SRAfilesize 35874c83d1f067a991975ca28a156178 SRR6958429.sra SRR6958429.sra file validated SRR6958429 is paired end SRR6958429 is conventional basespace SRR6958429 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.4195 31.0 18.0 33.0 18.0 34.0 2 30.84225 31.0 29.0 33.0 27.0 34.0 3 32.27275 33.0 31.0 33.0 30.0 34.0 4 32.4365 33.0 33.0 33.0 31.0 34.0 5 32.4505 33.0 33.0 33.0 31.0 34.0 6 35.68025 37.0 36.0 38.0 31.0 38.0 7 36.80475 38.0 37.0 38.0 34.0 38.0 8 37.30575 38.0 38.0 38.0 36.0 38.0 9 37.4115 38.0 38.0 38.0 37.0 38.0 10-14 37.47855 38.0 38.0 38.0 37.0 38.0 15-19 37.5658 38.0 38.0 38.0 38.0 38.0 20-24 37.5743 38.0 38.0 38.0 38.0 38.0 25-29 37.50430000000001 38.0 38.0 38.0 37.6 38.0 30-34 37.4855 38.0 38.0 38.0 37.2 38.0 35-39 37.48835 38.0 38.0 38.0 37.2 38.0 40-44 37.43275 38.0 38.0 38.0 37.0 38.0 45-49 37.43925 38.0 38.0 38.0 37.0 38.0 50-54 37.35485 38.0 38.0 38.0 37.0 38.0 55-59 36.776599999999995 38.0 38.0 38.0 36.4 38.0 60-64 36.53085 38.0 38.0 38.0 36.0 38.0 65-69 36.96555 38.0 38.0 38.0 36.0 38.0 70-74 37.189800000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.145799999999994 38.0 38.0 38.0 36.0 38.0 80-84 37.03795 38.0 38.0 38.0 36.0 38.0 85-89 36.9462 38.0 38.0 38.0 35.2 38.0 90-94 36.882850000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.7132 38.0 38.0 38.0 34.4 38.0 100-104 36.5601 38.0 38.0 38.0 34.0 38.0 105-109 36.4655 38.0 38.0 38.0 34.0 38.0 110-114 36.3451 38.0 37.8 38.0 33.6 38.0 115-119 36.19685 38.0 38.0 38.0 33.4 38.0 120-124 35.822950000000006 38.0 36.8 38.0 31.4 38.0 125-129 35.34795 38.0 36.0 38.0 31.0 38.0 130-134 35.406349999999996 38.0 36.0 38.0 30.0 38.0 135-139 34.58155 38.0 34.8 38.0 27.0 38.0 140-144 34.165 38.0 33.8 38.0 25.6 38.0 145-149 33.386649999999996 38.0 33.0 38.0 21.4 38.0 150-151 28.181 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 6.0 20 1.0 21 4.0 22 4.0 23 7.0 24 4.0 25 12.0 26 13.0 27 13.0 28 26.0 29 31.0 30 44.0 31 54.0 32 71.0 33 106.0 34 199.0 35 325.0 36 811.0 37 2264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.375 9.175 9.6 35.85 2 24.956239059764943 10.927731932983246 33.00825206301575 31.10777694423606 3 21.425 15.5 25.35 37.724999999999994 4 25.974999999999998 23.9 22.1 28.025 5 27.1 24.85 24.3 23.75 6 25.5 29.45 24.875 20.175 7 20.275000000000002 22.125 38.3 19.3 8 22.0 22.975 29.175 25.85 9 20.599999999999998 22.400000000000002 32.925 24.075 10-14 23.455245909841395 25.496572772301995 25.57662480612398 25.471556511732622 15-19 23.57 24.11 25.95 26.369999999999997 20-24 23.43 24.695 25.615 26.26 25-29 23.845 24.495 25.629999999999995 26.029999999999998 30-34 23.715 24.755 25.245 26.284999999999997 35-39 23.635 24.815 25.535000000000004 26.015 40-44 24.18 24.37 25.335 26.115 45-49 23.53 24.37 26.26 25.840000000000003 50-54 23.9 24.42 25.080000000000002 26.6 55-59 24.250266402801035 24.311158471609073 25.630486629116554 25.808088496473335 60-64 24.2444319861373 24.127210641659445 25.233168543907038 26.395188828296213 65-69 24.02949142341258 24.541077339753233 25.243254087671787 26.186177149162404 70-74 23.68 24.09 25.919999999999998 26.31 75-79 24.025 23.955000000000002 25.2 26.82 80-84 24.0 24.349999999999998 25.405 26.245 85-89 24.43 24.11 25.465 25.995 90-94 24.83 24.15 25.064999999999998 25.955000000000002 95-99 24.92 23.98 25.355 25.745 100-104 24.505 24.335 24.685000000000002 26.474999999999998 105-109 25.0 24.51 24.325 26.165 110-114 24.45 23.849999999999998 25.945 25.755 115-119 24.42 23.885 25.045 26.650000000000002 120-124 24.765 23.880000000000003 25.430000000000003 25.924999999999997 125-129 24.9 23.845 25.040000000000003 26.215 130-134 24.395 24.25 24.98 26.375 135-139 24.745 24.075 24.875 26.305 140-144 24.865000000000002 24.224999999999998 24.515 26.395000000000003 145-149 24.685000000000002 24.795 24.474999999999998 26.045 150-151 24.275 23.5 25.387500000000003 26.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 0.0 27 2.0 28 2.5 29 2.0 30 4.5 31 7.5 32 10.0 33 16.0 34 20.5 35 29.0 36 38.0 37 45.0 38 68.5 39 91.0 40 112.0 41 137.0 42 155.5 43 177.0 44 194.0 45 199.0 46 199.0 47 199.0 48 181.5 49 156.5 50 162.5 51 160.5 52 132.5 53 113.0 54 106.0 55 106.0 56 106.5 57 106.0 58 91.0 59 76.5 60 81.5 61 83.0 62 76.5 63 66.5 64 62.0 65 63.5 66 61.0 67 58.5 68 50.0 69 40.0 70 35.0 71 30.0 72 23.5 73 18.0 74 15.5 75 10.5 76 5.5 77 3.0 78 1.5 79 1.5 80 1.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.065 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 1.465 60-64 1.8950000000000002 65-69 0.31 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06589245140115 98.1 2 0.8836152486745772 1.7500000000000002 3 0.050492299924261554 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.225 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.0999999999999996 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCATT 10 0.006830828 145.0 1 TCATTCC 10 0.006830828 145.0 3 >>END_MODULE SRR6958429 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958429_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96875 33.0 33.0 34.0 32.0 34.0 2 33.04725 34.0 33.0 34.0 32.0 34.0 3 33.13525 34.0 33.0 34.0 33.0 34.0 4 33.055 34.0 33.0 34.0 33.0 34.0 5 33.08575 34.0 33.0 34.0 33.0 34.0 6 37.238 38.0 38.0 38.0 37.0 38.0 7 37.278 38.0 38.0 38.0 37.0 38.0 8 37.26525 38.0 38.0 38.0 37.0 38.0 9 37.31425 38.0 38.0 38.0 37.0 38.0 10-14 37.27334999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.2085 38.0 38.0 38.0 37.0 38.0 20-24 37.20555 38.0 38.0 38.0 37.0 38.0 25-29 37.14465 38.0 38.0 38.0 36.8 38.0 30-34 37.1325 38.0 38.0 38.0 37.0 38.0 35-39 37.13165 38.0 38.0 38.0 37.0 38.0 40-44 37.1169 38.0 38.0 38.0 36.8 38.0 45-49 37.10185 38.0 38.0 38.0 36.8 38.0 50-54 37.04255 38.0 38.0 38.0 36.0 38.0 55-59 36.96255 38.0 38.0 38.0 36.0 38.0 60-64 36.9053 38.0 38.0 38.0 35.8 38.0 65-69 36.868700000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.889599999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.7947 38.0 38.0 38.0 35.2 38.0 80-84 36.7759 38.0 38.0 38.0 35.2 38.0 85-89 36.63715 38.0 38.0 38.0 35.0 38.0 90-94 36.4458 38.0 38.0 38.0 34.4 38.0 95-99 36.45255 38.0 38.0 38.0 34.4 38.0 100-104 36.3198 38.0 38.0 38.0 34.0 38.0 105-109 36.09715 38.0 38.0 38.0 33.4 38.0 110-114 35.8694 38.0 37.6 38.0 32.6 38.0 115-119 35.700849999999996 38.0 37.4 38.0 32.2 38.0 120-124 35.71805 38.0 37.0 38.0 32.2 38.0 125-129 35.5117 38.0 36.4 38.0 31.4 38.0 130-134 35.45515 38.0 36.0 38.0 31.4 38.0 135-139 35.11024999999999 38.0 35.8 38.0 29.8 38.0 140-144 34.79965 38.0 36.0 38.0 28.8 38.0 145-149 34.3635 38.0 35.0 38.0 28.0 38.0 150-151 30.030749999999998 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 3.0 5 1.0 6 2.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 1.0 13 4.0 14 6.0 15 2.0 16 4.0 17 4.0 18 1.0 19 6.0 20 6.0 21 4.0 22 4.0 23 9.0 24 16.0 25 11.0 26 10.0 27 14.0 28 24.0 29 19.0 30 41.0 31 51.0 32 66.0 33 82.0 34 143.0 35 242.0 36 565.0 37 2647.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.775 17.675 12.65 31.900000000000002 2 29.825000000000003 22.775000000000002 24.625 22.775000000000002 3 23.35 25.650000000000002 26.450000000000003 24.55 4 25.85 29.4 20.375 24.375 5 27.85 30.599999999999998 19.05 22.5 6 24.875 33.6 20.349999999999998 21.175 7 22.975 19.85 33.0 24.175 8 24.975 22.5 22.425 30.099999999999998 9 24.075 22.175 26.575 27.175 10-14 26.735 25.31 22.74 25.215 15-19 26.009999999999998 25.040000000000003 23.44 25.509999999999998 20-24 25.845000000000002 25.965 23.150000000000002 25.040000000000003 25-29 26.305 24.58 23.075000000000003 26.040000000000003 30-34 26.150000000000002 25.145 23.395 25.31 35-39 26.255 25.355 23.044999999999998 25.345000000000002 40-44 26.19 25.22 22.955000000000002 25.635 45-49 25.779999999999998 25.035 23.69 25.495 50-54 26.265 25.145 23.335 25.255 55-59 26.584999999999997 24.815 23.13 25.47 60-64 26.424999999999997 24.775 23.419999999999998 25.380000000000003 65-69 26.33 24.265 24.02 25.385 70-74 26.779999999999998 24.865000000000002 22.97 25.385 75-79 25.965 25.1 23.919999999999998 25.014999999999997 80-84 26.55 24.45 24.01 24.990000000000002 85-89 26.105 24.94 23.425 25.53 90-94 26.525 25.119999999999997 23.32 25.035 95-99 25.705 25.040000000000003 24.195 25.06 100-104 26.465 24.725 23.14 25.669999999999998 105-109 26.5 25.019999999999996 24.169999999999998 24.310000000000002 110-114 26.575 26.035000000000004 23.24 24.15 115-119 26.625 25.035 23.055 25.285000000000004 120-124 26.810000000000002 25.595000000000002 23.835 23.76 125-129 26.665 25.485000000000003 23.435 24.415 130-134 27.089999999999996 25.069999999999997 23.89 23.95 135-139 27.200000000000003 25.369999999999997 23.94 23.49 140-144 27.055 25.345000000000002 23.68 23.919999999999998 145-149 27.310000000000002 25.41 23.46 23.82 150-151 26.325 26.075 24.5 23.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 0.5 28 0.5 29 1.0 30 4.0 31 8.5 32 7.0 33 6.0 34 13.5 35 25.5 36 35.0 37 40.5 38 49.5 39 70.5 40 92.0 41 110.0 42 147.0 43 169.5 44 168.5 45 174.5 46 176.5 47 168.5 48 169.0 49 175.0 50 172.0 51 155.5 52 142.5 53 127.0 54 110.0 55 100.5 56 96.5 57 104.0 58 99.0 59 94.0 60 96.0 61 93.0 62 81.0 63 75.0 64 88.0 65 95.5 66 84.0 67 66.5 68 58.0 69 56.5 70 50.0 71 36.0 72 28.0 73 25.5 74 18.5 75 9.5 76 6.0 77 6.5 78 4.0 79 2.0 80 1.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91056498606537 97.6 2 0.9120851279452749 1.7999999999999998 3 0.12667848999239928 0.375 4 0.02533569799847986 0.1 5 0.02533569799847986 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.225 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGC 10 0.006830828 145.0 6 >>END_MODULE Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238978 spots for SRR6958429.sra Written 1238978 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra Read 1238967 spots for SRR6958429.sra Written 1238967 spots for SRR6958429.sra SRR ids: ['SRR6958429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t3pow2ev SRR6958429.sra spots: 24779351 blocks: [[1, 1238967], [1238968, 2477934], [2477935, 3716901], [3716902, 4955868], [4955869, 6194835], [6194836, 7433802], [7433803, 8672769], [8672770, 9911736], [9911737, 11150703], [11150704, 12389670], [12389671, 13628637], [13628638, 14867604], [14867605, 16106571], [16106572, 17345538], [17345539, 18584505], [18584506, 19823472], [19823473, 21062439], [21062440, 22301406], [22301407, 23540373], [23540374, 24779351]] SRR6958429 file size 8375208 SRR6958429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958429 SRR6958429_1.fastq SRR6958429_2.fastq Input file: SRR6958429_1.fastq Paired file: SRR6958429_2.fastq trimmed: SRR6958429-trimmed-pair1.fastq, SRR6958429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:58:39 2024 >> started Fri Dec 6 22:59:09 2024 >> done (30.101s) 24779351 read pairs processed; of these: 40414 ( 0.16%) short read pairs filtered out after trimming by size control 48502 ( 0.20%) empty read pairs filtered out after trimming by size control 24690435 (99.64%) read pairs available; of these: 9711130 (39.33%) trimmed read pairs available after processing 14979305 (60.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 5 0.00% 28 5 0.00% 29 9 0.00% 30 3 0.00% 31 11 0.00% 32 5 0.00% 33 7 0.00% 34 5 0.00% 35 12 0.00% 36 10 0.00% 37 6 0.00% 38 11 0.00% 39 11 0.00% 40 10 0.00% 41 8 0.00% 42 14 0.00% 43 16 0.00% 44 17 0.00% 45 12 0.00% 46 22 0.00% 47 23 0.00% 48 17 0.00% 49 21 0.00% 50 39 0.00% 51 22 0.00% 52 34 0.00% 53 38 0.00% 54 51 0.00% 55 47 0.00% 56 72 0.00% 57 74 0.00% 58 64 0.00% 59 89 0.00% 60 87 0.00% 61 101 0.00% 62 139 0.00% 63 126 0.00% 64 153 0.00% 65 180 0.00% 66 202 0.00% 67 238 0.00% 68 250 0.00% 69 272 0.00% 70 318 0.00% 71 354 0.00% 72 406 0.00% 73 439 0.00% 74 565 0.00% 75 611 0.00% 76 711 0.00% 77 798 0.00% 78 909 0.00% 79 1079 0.00% 80 1190 0.00% 81 1364 0.01% 82 1623 0.01% 83 1902 0.01% 84 3363 0.01% 85 4260 0.02% 86 4356 0.02% 87 4618 0.02% 88 4568 0.02% 89 4933 0.02% 90 5236 0.02% 91 5610 0.02% 92 5866 0.02% 93 6263 0.03% 94 6905 0.03% 95 7293 0.03% 96 7879 0.03% 97 8478 0.03% 98 8926 0.04% 99 9576 0.04% 100 10231 0.04% 101 10836 0.04% 102 11578 0.05% 103 12702 0.05% 104 13416 0.05% 105 14512 0.06% 106 15658 0.06% 107 16514 0.07% 108 17152 0.07% 109 18424 0.07% 110 19141 0.08% 111 20786 0.08% 112 21795 0.09% 113 23355 0.09% 114 24950 0.10% 115 26582 0.11% 116 28191 0.11% 117 28997 0.12% 118 30330 0.12% 119 31385 0.13% 120 32830 0.13% 121 34455 0.14% 122 36312 0.15% 123 38056 0.15% 124 39820 0.16% 125 41983 0.17% 126 43970 0.18% 127 45731 0.19% 128 47285 0.19% 129 49379 0.20% 130 50965 0.21% 131 54060 0.22% 132 56996 0.23% 133 60300 0.24% 134 62734 0.25% 135 66024 0.27% 136 69699 0.28% 137 73600 0.30% 138 78044 0.32% 139 83372 0.34% 140 88660 0.36% 141 95116 0.39% 142 105013 0.43% 143 116760 0.47% 144 131163 0.53% 145 154493 0.63% 146 190121 0.77% 147 265654 1.08% 148 392813 1.59% 149 801093 3.24% 150 5795122 23.47% 151 14979305 60.67% 24690435 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=19 prefix-density=0.87 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=38.79 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=13 prefix-density=0.59 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=50.89 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.5 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR6958429 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:59:58 Started mapping on | Dec 06 22:59:58 Finished on | Dec 06 23:01:47 Mapping speed, Million of reads per hour | 815.46 Number of input reads | 24690435 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24068629 Uniquely mapped reads % | 97.48% Average mapped length | 296.76 Number of splices: Total | 27660358 Number of splices: Annotated (sjdb) | 26008220 Number of splices: GT/AG | 27287981 Number of splices: GC/AG | 325559 Number of splices: AT/AC | 11007 Number of splices: Non-canonical | 35811 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 183596 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 12819 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.41% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 458871 458871 458871 N_multimapping 183596 183596 183596 N_noFeature 671104 23431942 831275 N_ambiguous 567683 3153 92451 UnstrandedReadsAssigned:22829842 PositiveStrandReadsAssigned:633534 NegativeStrandReadsAssigned:23144903 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958429 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958429-trimmed-pair1.fastq SRR6958429-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,690,435 reads, 23,126,229 reads pseudoaligned [quant] estimated average fragment length: 260.618 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6958429.ke.tsv 35125 SRR6958429.se.tsv 88098 total ==> SRR6958429.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.778 0 0 PNS24247 1044 784.382 78.8424 6.38412 PNS24249 1928 1668.38 73.027 2.78008 PNS24246 1044 784.382 78.8424 6.38412 PNS24248 1044 784.382 78.8424 6.38412 PNS24244 1471 1211.38 18.4457 0.967127 PNS24243 293 85.6327 0 0 KQK14069 1603 1343.38 7900.97 373.55 KQK14071 474 228.529 143.561 39.8991 ==> SRR6958429.se.tsv <== BRADI_1g14170v3 8787 BRADI_1g53295v3 280 BRADI_1g59795v3 405 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 325 BRADI_1g74790v3 143 BRADI_1g09890v3 0 BRADI_1g77505v3 335 BRADI_1g48960v3 0 SRR6958429 completed mapping pipeline successfully