Starting /dee2/code/volunteer_pipeline.sh SRR6958430 current disk space = 1548277469184 free memory = 1597894116 SRR6958430 SRAfilesize c0726f88c38e24a4248ba1c125c83bdf SRR6958430.sra SRR6958430.sra file validated SRR6958430 is paired end SRR6958430 is conventional basespace SRR6958430 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.5595 18.0 18.0 25.0 18.0 32.0 2 29.04825 29.0 27.0 31.0 27.0 33.0 3 30.4155 31.0 29.0 33.0 27.0 33.0 4 30.57 31.0 31.0 33.0 28.0 33.0 5 31.579 33.0 31.0 33.0 29.0 33.0 6 36.38025 37.0 36.0 38.0 34.0 38.0 7 37.3975 38.0 38.0 38.0 36.0 38.0 8 37.61125 38.0 38.0 38.0 37.0 38.0 9 37.67875 38.0 38.0 38.0 38.0 38.0 10-14 37.70095 38.0 38.0 38.0 38.0 38.0 15-19 37.68235 38.0 38.0 38.0 38.0 38.0 20-24 37.6877 38.0 38.0 38.0 38.0 38.0 25-29 37.686099999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.64 38.0 38.0 38.0 37.8 38.0 35-39 37.59885 38.0 38.0 38.0 37.8 38.0 40-44 37.647499999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.607749999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.5687 38.0 38.0 38.0 38.0 38.0 55-59 37.564299999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.4927 38.0 38.0 38.0 37.6 38.0 65-69 37.39975 38.0 38.0 38.0 37.0 38.0 70-74 37.38565 38.0 38.0 38.0 37.0 38.0 75-79 37.348200000000006 38.0 38.0 38.0 37.0 38.0 80-84 37.286199999999994 38.0 38.0 38.0 36.6 38.0 85-89 37.1552 38.0 38.0 38.0 36.4 38.0 90-94 37.1281 38.0 38.0 38.0 36.0 38.0 95-99 37.08265 38.0 38.0 38.0 36.0 38.0 100-104 36.971 38.0 38.0 38.0 35.8 38.0 105-109 36.838049999999996 38.0 38.0 38.0 35.0 38.0 110-114 36.70590000000001 38.0 38.0 38.0 34.8 38.0 115-119 36.66725 38.0 38.0 38.0 34.6 38.0 120-124 36.528999999999996 38.0 38.0 38.0 34.2 38.0 125-129 36.3076 38.0 38.0 38.0 34.0 38.0 130-134 36.3231 38.0 38.0 38.0 34.0 38.0 135-139 36.16415 38.0 38.0 38.0 33.4 38.0 140-144 34.7984 38.0 35.8 38.0 27.4 38.0 145-149 35.04215 38.0 35.2 38.0 30.6 38.0 150-151 32.166875000000005 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 5.0 20 1.0 21 2.0 22 0.0 23 3.0 24 3.0 25 7.0 26 4.0 27 6.0 28 9.0 29 22.0 30 20.0 31 37.0 32 47.0 33 65.0 34 110.0 35 243.0 36 716.0 37 2693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.476874836686697 8.98876404494382 25.137183172197542 40.39717794617194 2 23.65 12.75 36.55 27.05 3 22.125 16.175 25.624999999999996 36.075 4 26.674999999999997 24.15 21.2 27.975 5 24.525 30.325000000000003 24.65 20.5 6 20.575 33.525 24.625 21.275 7 16.6 24.575 40.125 18.7 8 19.7 22.75 30.725 26.825 9 18.125 21.375 35.9 24.6 10-14 21.95 26.6 27.155 24.295 15-19 22.54 25.635 26.69 25.135 20-24 23.119999999999997 25.61 26.465 24.805 25-29 22.33 26.215 26.985 24.47 30-34 22.575 26.245 26.474999999999998 24.705 35-39 22.355 25.795 26.515 25.335 40-44 22.485 26.400000000000002 26.405 24.709999999999997 45-49 22.695 26.155 26.33 24.82 50-54 23.200000000000003 25.85 25.8 25.15 55-59 22.54 25.39 27.11 24.959999999999997 60-64 22.785 25.595000000000002 26.55 25.069999999999997 65-69 22.365 25.85 26.495 25.290000000000003 70-74 22.81 25.82 26.450000000000003 24.92 75-79 22.745 26.540000000000003 26.064999999999998 24.65 80-84 22.355 25.040000000000003 26.97 25.635 85-89 22.8 26.02 26.02 25.16 90-94 22.919999999999998 25.679999999999996 26.215 25.185000000000002 95-99 22.650000000000002 25.7 26.43 25.22 100-104 22.735230853884246 25.926667000150065 26.812065429443248 24.526036716522434 105-109 22.939999999999998 25.52 25.919999999999998 25.619999999999997 110-114 22.76024210894903 26.141763793707167 26.481916862588168 24.61607723475564 115-119 22.895302886298836 26.56195287879546 25.81661747786504 24.726126757040667 120-124 22.884999999999998 26.605 25.41 25.1 125-129 22.624411735255833 26.048863522579353 26.043857014118355 25.282867728046458 130-134 23.14 26.46 25.285000000000004 25.115 135-139 23.165 26.195 25.505 25.135 140-144 22.585 25.77 26.19 25.455 145-149 22.85 26.815 25.235000000000003 25.1 150-151 21.875 26.85 25.324999999999996 25.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.5 27 2.5 28 5.0 29 6.0 30 6.5 31 13.0 32 17.0 33 25.0 34 36.0 35 42.5 36 53.0 37 80.0 38 100.0 39 116.5 40 142.0 41 159.0 42 189.0 43 215.5 44 223.0 45 232.0 46 233.5 47 222.5 48 197.0 49 169.5 50 169.5 51 161.0 52 130.0 53 117.5 54 106.0 55 89.5 56 84.5 57 71.0 58 62.5 59 67.0 60 62.0 61 53.5 62 55.5 63 50.0 64 43.0 65 39.0 66 30.0 67 26.5 68 24.0 69 18.0 70 14.0 71 10.5 72 6.5 73 7.0 74 6.5 75 4.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.045 115-119 0.045 120-124 0.0 125-129 0.13 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0125 0.0 0.025 0.0 0.0 48-49 0.025 0.0 0.025 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.037500000000000006 0.0 0.025 0.0 0.0 60-61 0.0625 0.0 0.025 0.0 0.0 62-63 0.075 0.0 0.025 0.0 0.0 64-65 0.1 0.0 0.025 0.0 0.0 66-67 0.1 0.0 0.025 0.0 0.0 68-69 0.1 0.0 0.025 0.0 0.0 70-71 0.1 0.0 0.025 0.0 0.0 72-73 0.1 0.0 0.025 0.0 0.0 74-75 0.1 0.0 0.025 0.0 0.0 76-77 0.125 0.0 0.025 0.0 0.0 78-79 0.1375 0.0 0.025 0.0 0.0 80-81 0.2 0.0 0.025 0.0 0.0 82-83 0.2625 0.0 0.025 0.0 0.0 84-85 0.35 0.0 0.025 0.0 0.0 86-87 0.4375 0.0 0.025 0.0 0.0 88-89 0.6 0.0 0.025 0.0 0.0 90-91 0.6875 0.0 0.025 0.0 0.0 92-93 0.8875 0.0 0.025 0.0 0.0 94-95 1.025 0.0 0.025 0.0 0.0 96-97 1.25 0.0 0.025 0.0 0.0 98-99 1.4375 0.0 0.025 0.0 0.0 100-101 1.6875 0.0 0.025 0.0 0.0 102-103 1.975 0.0 0.025 0.0 0.0 104-105 2.2875 0.0 0.025 0.0 0.0 106-107 2.575 0.0 0.025 0.0 0.0 108-109 3.0250000000000004 0.0 0.025 0.0 0.0 110-111 3.5125 0.0 0.025 0.0 0.0 112-113 4.025 0.0 0.025 0.0 0.0 114-115 4.6 0.0 0.025 0.0 0.0 116-117 5.074999999999999 0.0 0.025 0.0 0.0 118-119 5.5375 0.0 0.025 0.0 0.0 120-121 6.0375 0.0 0.025 0.0 0.0 122-123 6.4125 0.0 0.025 0.0 0.0 124-125 6.8375 0.0 0.025 0.0 0.0 126-127 7.4 0.0 0.025 0.0 0.0 128-129 7.975 0.0 0.025 0.0 0.0 130-131 8.625 0.0 0.025 0.0 0.0 132-133 9.3 0.0 0.025 0.0 0.0 134-135 9.787500000000001 0.0 0.025 0.0 0.0 136-137 10.575 0.0 0.025 0.0 0.0 138-139 11.225 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGAT 10 0.006836113 144.9625 145 TGTTGCA 20 3.5913987E-4 108.72187 7 >>END_MODULE SRR6958430 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.25625 33.0 27.0 33.0 18.0 34.0 2 31.8785 33.0 32.0 34.0 27.0 34.0 3 32.594 33.0 33.0 34.0 32.0 34.0 4 32.984 33.0 33.0 34.0 32.0 34.0 5 33.145 33.0 33.0 34.0 33.0 34.0 6 37.49675 38.0 38.0 38.0 38.0 38.0 7 37.475 38.0 38.0 38.0 38.0 38.0 8 37.5275 38.0 38.0 38.0 38.0 38.0 9 37.57925 38.0 38.0 38.0 38.0 38.0 10-14 37.56555 38.0 38.0 38.0 38.0 38.0 15-19 36.361149999999995 38.0 36.4 38.0 31.8 38.0 20-24 36.3349 38.0 37.0 38.0 31.6 38.0 25-29 37.389300000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.5403 38.0 38.0 38.0 38.0 38.0 35-39 37.4801 38.0 38.0 38.0 38.0 38.0 40-44 37.333 38.0 38.0 38.0 37.6 38.0 45-49 37.217400000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.4688 38.0 38.0 38.0 38.0 38.0 55-59 37.510200000000005 38.0 38.0 38.0 38.0 38.0 60-64 37.45885 38.0 38.0 38.0 38.0 38.0 65-69 37.44755 38.0 38.0 38.0 38.0 38.0 70-74 37.32940000000001 38.0 38.0 38.0 37.4 38.0 75-79 37.3275 38.0 38.0 38.0 37.4 38.0 80-84 37.34555 38.0 38.0 38.0 37.4 38.0 85-89 37.3013 38.0 38.0 38.0 37.0 38.0 90-94 37.25555000000001 38.0 38.0 38.0 37.0 38.0 95-99 37.16995000000001 38.0 38.0 38.0 36.8 38.0 100-104 37.0512 38.0 38.0 38.0 36.4 38.0 105-109 36.940999999999995 38.0 38.0 38.0 35.6 38.0 110-114 36.866249999999994 38.0 38.0 38.0 35.2 38.0 115-119 36.90495 38.0 38.0 38.0 35.2 38.0 120-124 36.73515 38.0 38.0 38.0 35.0 38.0 125-129 35.372550000000004 38.0 36.0 38.0 28.8 38.0 130-134 35.950149999999994 38.0 37.2 38.0 33.2 38.0 135-139 35.625249999999994 38.0 37.4 38.0 31.4 38.0 140-144 35.127 38.0 35.8 38.0 30.6 38.0 145-149 32.75515 37.2 32.0 38.0 21.6 38.0 150-151 29.059125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 0.0 6 1.0 7 2.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 1.0 18 2.0 19 4.0 20 1.0 21 5.0 22 4.0 23 5.0 24 8.0 25 2.0 26 3.0 27 8.0 28 19.0 29 20.0 30 25.0 31 47.0 32 44.0 33 82.0 34 124.0 35 253.0 36 698.0 37 2631.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.525 21.5 9.3 30.675 2 27.625 24.9 29.875 17.599999999999998 3 20.8 25.174999999999997 29.849999999999998 24.175 4 24.5 33.4 20.4 21.7 5 27.250000000000004 34.300000000000004 19.6 18.85 6 21.5 37.4 21.5 19.6 7 21.5 20.75 37.35 20.4 8 22.45 24.175 25.95 27.425 9 23.325000000000003 24.325 27.400000000000002 24.95 10-14 24.83 27.145000000000003 24.349999999999998 23.674999999999997 15-19 24.395 26.674999999999997 25.314999999999998 23.615 20-24 25.285000000000004 26.185000000000002 25.935000000000002 22.595000000000002 25-29 24.97 26.700000000000003 25.264999999999997 23.064999999999998 30-34 24.465 27.015 25.235000000000003 23.285 35-39 24.87 26.979999999999997 25.14 23.01 40-44 25.11 26.365 25.105 23.419999999999998 45-49 24.985 26.534999999999997 25.635 22.845 50-54 24.765 26.75 25.635 22.85 55-59 25.585 26.009999999999998 25.255 23.150000000000002 60-64 25.005 26.63 25.545 22.82 65-69 24.725 26.889999999999997 25.155 23.23 70-74 25.545 25.505 25.729999999999997 23.22 75-79 25.724999999999998 26.119999999999997 24.965 23.189999999999998 80-84 25.705 26.474999999999998 25.119999999999997 22.7 85-89 24.990000000000002 26.655 25.135 23.22 90-94 24.665 26.634999999999998 25.380000000000003 23.32 95-99 25.135 26.865 25.430000000000003 22.57 100-104 25.540000000000003 26.895000000000003 25.19 22.375 105-109 25.316265813290666 26.77133856692835 26.00630031501575 21.906095304765238 110-114 26.075 26.68 25.115 22.13 115-119 26.46 26.85 24.785 21.905 120-124 26.11 26.669999999999998 25.25 21.97 125-129 25.795 27.605 24.925 21.675 130-134 26.305 27.27 24.375 22.05 135-139 26.384999999999998 27.384999999999998 24.995 21.235 140-144 26.41 26.945000000000004 24.875 21.77 145-149 27.029999999999998 27.215 24.55 21.205 150-151 26.237500000000004 27.287499999999998 24.212500000000002 22.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.5 24 2.5 25 2.5 26 3.5 27 4.0 28 5.0 29 4.5 30 8.0 31 11.5 32 15.5 33 23.5 34 31.0 35 38.5 36 50.5 37 62.0 38 82.0 39 102.5 40 124.5 41 163.0 42 194.0 43 198.5 44 200.0 45 215.5 46 234.0 47 227.5 48 196.0 49 187.5 50 182.5 51 162.5 52 142.5 53 121.0 54 108.0 55 97.0 56 89.0 57 84.5 58 74.0 59 67.5 60 65.0 61 66.5 62 59.5 63 49.0 64 50.5 65 36.0 66 24.5 67 27.5 68 24.0 69 21.0 70 15.0 71 12.5 72 13.0 73 8.5 74 4.5 75 2.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54716981132076 98.925 2 0.37735849056603776 0.75 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.05031446540880503 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.4875 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 2.025 0.0 0.0 0.0 0.0 104-105 2.3375 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 4.075 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.0625 0.0 0.0 0.0 0.0 118-119 5.5125 0.0 0.0 0.0 0.0 120-121 6.025 0.0 0.0 0.0 0.0 122-123 6.387499999999999 0.0 0.0 0.0 0.0 124-125 6.800000000000001 0.0 0.0 0.0 0.0 126-127 7.324999999999999 0.0 0.0 0.0 0.0 128-129 7.8999999999999995 0.0 0.0 0.0 0.0 130-131 8.525 0.0 0.0 0.0 0.0 132-133 9.2 0.0 0.0 0.0 0.0 134-135 9.712499999999999 0.0 0.0 0.0 0.0 136-137 10.475000000000001 0.0 0.0 0.0 0.0 138-139 11.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 25 4.977651E-4 29.0 70-74 >>END_MODULE Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095471 spots for SRR6958430.sra Written 1095471 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra Read 1095464 spots for SRR6958430.sra Written 1095464 spots for SRR6958430.sra SRR ids: ['SRR6958430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k13vjkg0 SRR6958430.sra spots: 21909287 blocks: [[1, 1095464], [1095465, 2190928], [2190929, 3286392], [3286393, 4381856], [4381857, 5477320], [5477321, 6572784], [6572785, 7668248], [7668249, 8763712], [8763713, 9859176], [9859177, 10954640], [10954641, 12050104], [12050105, 13145568], [13145569, 14241032], [14241033, 15336496], [15336497, 16431960], [16431961, 17527424], [17527425, 18622888], [18622889, 19718352], [19718353, 20813816], [20813817, 21909287]] SRR6958430 file size 7402638 SRR6958430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958430 SRR6958430_1.fastq SRR6958430_2.fastq Input file: SRR6958430_1.fastq Paired file: SRR6958430_2.fastq trimmed: SRR6958430-trimmed-pair1.fastq, SRR6958430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:58:07 2024 >> started Fri Dec 6 22:58:30 2024 >> done (22.881s) 21909287 read pairs processed; of these: 9912 ( 0.05%) short read pairs filtered out after trimming by size control 17016 ( 0.08%) empty read pairs filtered out after trimming by size control 21882359 (99.88%) read pairs available; of these: 8749364 (39.98%) trimmed read pairs available after processing 13132995 (60.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 9 0.00% 21 15 0.00% 22 4 0.00% 23 13 0.00% 24 10 0.00% 25 9 0.00% 26 15 0.00% 27 16 0.00% 28 17 0.00% 29 15 0.00% 30 16 0.00% 31 16 0.00% 32 14 0.00% 33 22 0.00% 34 28 0.00% 35 21 0.00% 36 29 0.00% 37 27 0.00% 38 42 0.00% 39 53 0.00% 40 56 0.00% 41 59 0.00% 42 47 0.00% 43 70 0.00% 44 66 0.00% 45 77 0.00% 46 82 0.00% 47 114 0.00% 48 135 0.00% 49 130 0.00% 50 151 0.00% 51 208 0.00% 52 191 0.00% 53 237 0.00% 54 225 0.00% 55 269 0.00% 56 306 0.00% 57 338 0.00% 58 396 0.00% 59 507 0.00% 60 567 0.00% 61 609 0.00% 62 740 0.00% 63 818 0.00% 64 891 0.00% 65 993 0.00% 66 1096 0.01% 67 1309 0.01% 68 1461 0.01% 69 1600 0.01% 70 1915 0.01% 71 2080 0.01% 72 2530 0.01% 73 2750 0.01% 74 3151 0.01% 75 3468 0.02% 76 3983 0.02% 77 4357 0.02% 78 4803 0.02% 79 5290 0.02% 80 5996 0.03% 81 6619 0.03% 82 7606 0.03% 83 8302 0.04% 84 9826 0.04% 85 10747 0.05% 86 11313 0.05% 87 12315 0.06% 88 13312 0.06% 89 14077 0.06% 90 15289 0.07% 91 16827 0.08% 92 18477 0.08% 93 19913 0.09% 94 21506 0.10% 95 22335 0.10% 96 23587 0.11% 97 25217 0.12% 98 26469 0.12% 99 28722 0.13% 100 32336 0.15% 101 34541 0.16% 102 32284 0.15% 103 34364 0.16% 104 36157 0.17% 105 37620 0.17% 106 39593 0.18% 107 40568 0.19% 108 42060 0.19% 109 43494 0.20% 110 44727 0.20% 111 46436 0.21% 112 49168 0.22% 113 50392 0.23% 114 52506 0.24% 115 55235 0.25% 116 56429 0.26% 117 57209 0.26% 118 58736 0.27% 119 59536 0.27% 120 61717 0.28% 121 62644 0.29% 122 64547 0.29% 123 67104 0.31% 124 69331 0.32% 125 71037 0.32% 126 72869 0.33% 127 73890 0.34% 128 74847 0.34% 129 76791 0.35% 130 79425 0.36% 131 80271 0.37% 132 82797 0.38% 133 86115 0.39% 134 86950 0.40% 135 90434 0.41% 136 92740 0.42% 137 94874 0.43% 138 97338 0.44% 139 101525 0.46% 140 104531 0.48% 141 109199 0.50% 142 116442 0.53% 143 123111 0.56% 144 134952 0.62% 145 153755 0.70% 146 179760 0.82% 147 217833 1.00% 148 327979 1.50% 149 623057 2.85% 150 3801167 17.37% 151 13132995 60.02% 21882359 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=26 prefix-density=0.85 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=106.38 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.7 sequence=ATTTCTTCAAAACAAACTACTTGTCGAGGCTGGAGTCACGTGGAGGCTTCGCTGTCGAGGCGAATCCTTTTGGTGCCAACCTCGTCACTAGCCGGCACCCTATTCTCCTTCGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGTGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAGGGAAGCTATCGGACCGACCGATGTATCGAGTTCATGATCAATAATCGAGGCGCACTC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.9 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=122.21 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGC SRR6958430 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:00:47 Started mapping on | Dec 06 23:00:47 Finished on | Dec 06 23:03:17 Mapping speed, Million of reads per hour | 525.18 Number of input reads | 21882359 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21214916 Uniquely mapped reads % | 96.95% Average mapped length | 291.56 Number of splices: Total | 24293416 Number of splices: Annotated (sjdb) | 22815708 Number of splices: GT/AG | 23960664 Number of splices: GC/AG | 275906 Number of splices: AT/AC | 8610 Number of splices: Non-canonical | 48236 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252997 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 14406 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 421820 421820 421820 N_multimapping 252997 252997 252997 N_noFeature 857015 20516879 1070557 N_ambiguous 558789 2816 75440 UnstrandedReadsAssigned:19799112 PositiveStrandReadsAssigned:695221 NegativeStrandReadsAssigned:20068919 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958430-trimmed-pair1.fastq SRR6958430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,882,359 reads, 20,084,886 reads pseudoaligned [quant] estimated average fragment length: 229.299 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6958430.ke.tsv 35125 SRR6958430.se.tsv 88098 total ==> SRR6958430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 708.171 0 0 PNS24247 1044 815.701 44.8456 4.24051 PNS24249 1928 1699.7 33.2663 1.5096 PNS24246 1044 815.701 44.8456 4.24051 PNS24248 1044 815.701 44.8456 4.24051 PNS24244 1471 1242.7 48.1969 2.99145 PNS24243 293 101.951 0 0 KQK14069 1603 1374.7 2886.23 161.939 KQK14071 474 253.676 90.6198 27.5533 ==> SRR6958430.se.tsv <== BRADI_1g14170v3 3674 BRADI_1g53295v3 1619 BRADI_1g59795v3 125 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 387 BRADI_1g74790v3 100 BRADI_1g09890v3 0 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR6958430 completed mapping pipeline successfully