Starting /dee2/code/volunteer_pipeline.sh SRR6958431 current disk space = 1547898482688 free memory = 1596989424 SRR6958431 SRAfilesize ed7f7b94a6c326e789584b89d1991a03 SRR6958431.sra SRR6958431.sra file validated SRR6958431 is paired end SRR6958431 is conventional basespace SRR6958431 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958431_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.47575 25.0 18.0 32.0 18.0 33.0 2 23.10225 18.0 18.0 29.0 18.0 31.0 3 28.63 29.0 27.0 31.0 25.0 33.0 4 29.3785 31.0 29.0 33.0 25.0 33.0 5 31.75075 33.0 32.0 33.0 30.0 33.0 6 35.66025 37.0 35.0 38.0 31.0 38.0 7 36.965 38.0 37.0 38.0 35.0 38.0 8 37.065 38.0 38.0 38.0 36.0 38.0 9 37.08075 38.0 38.0 38.0 36.0 38.0 10-14 37.29109999999999 38.0 38.0 38.0 36.4 38.0 15-19 37.376250000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.4332 38.0 38.0 38.0 37.0 38.0 25-29 37.30195 38.0 38.0 38.0 37.0 38.0 30-34 37.2277 38.0 38.0 38.0 36.8 38.0 35-39 37.185199999999995 38.0 38.0 38.0 36.6 38.0 40-44 37.10395 38.0 38.0 38.0 36.0 38.0 45-49 37.0323 38.0 38.0 38.0 36.0 38.0 50-54 37.0637 38.0 38.0 38.0 36.0 38.0 55-59 36.91635 38.0 38.0 38.0 35.2 38.0 60-64 36.84995 38.0 38.0 38.0 35.0 38.0 65-69 36.96704999999999 38.0 38.0 38.0 35.2 38.0 70-74 36.94925 38.0 38.0 38.0 35.2 38.0 75-79 36.800850000000004 38.0 38.0 38.0 34.4 38.0 80-84 36.44095 38.0 37.6 38.0 33.8 38.0 85-89 36.466049999999996 38.0 37.8 38.0 34.0 38.0 90-94 36.43315 38.0 38.0 38.0 34.0 38.0 95-99 36.3728 38.0 37.4 38.0 33.6 38.0 100-104 36.13365 38.0 37.0 38.0 33.0 38.0 105-109 36.028000000000006 38.0 37.0 38.0 32.6 38.0 110-114 35.8156 38.0 36.2 38.0 31.0 38.0 115-119 35.77185 38.0 36.0 38.0 31.0 38.0 120-124 35.5901 38.0 36.0 38.0 31.2 38.0 125-129 35.15725 38.0 35.0 38.0 28.6 38.0 130-134 35.058749999999996 38.0 35.0 38.0 28.4 38.0 135-139 34.774 38.0 35.0 38.0 27.8 38.0 140-144 34.35185 38.0 34.4 38.0 25.4 38.0 145-149 33.33435 38.0 34.0 38.0 20.4 38.0 150-151 28.695124999999997 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 2.0 19 1.0 20 1.0 21 1.0 22 0.0 23 7.0 24 14.0 25 12.0 26 10.0 27 25.0 28 23.0 29 37.0 30 45.0 31 66.0 32 102.0 33 165.0 34 255.0 35 452.0 36 1093.0 37 1684.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.30369214768591 9.100364014560583 8.138325533021321 40.45761830473219 2 25.425851703406817 12.249498997995993 37.80060120240481 24.524048096192384 3 20.825 15.225 25.5 38.45 4 24.2 23.1 23.575 29.125 5 25.118958176809414 28.850488354620584 24.868519909842224 21.162033558727774 6 22.575 32.675 23.075000000000003 21.675 7 18.975 24.349999999999998 38.4 18.275 8 19.85 23.849999999999998 30.95 25.35 9 19.2 22.0 34.275 24.525 10-14 23.1 26.07 26.085 24.745 15-19 22.33 25.569999999999997 26.529999999999998 25.569999999999997 20-24 22.625 25.145 26.584999999999997 25.645 25-29 22.96 25.490000000000002 26.540000000000003 25.009999999999998 30-34 22.470000000000002 25.64 26.419999999999998 25.47 35-39 22.445 25.66 26.174999999999997 25.72 40-44 22.770000000000003 25.795 26.179999999999996 25.255 45-49 22.36 25.82 26.345000000000002 25.474999999999998 50-54 22.55 26.009999999999998 25.82 25.619999999999997 55-59 22.830000000000002 25.41 26.245 25.515 60-64 22.24 25.255 26.43 26.075 65-69 23.075000000000003 25.040000000000003 25.96 25.924999999999997 70-74 23.09 25.509999999999998 25.47 25.929999999999996 75-79 22.855 25.505 25.465 26.174999999999997 80-84 22.665 25.03 26.340000000000003 25.965 85-89 23.005 25.465 26.11 25.419999999999998 90-94 23.145 25.019999999999996 26.235000000000003 25.6 95-99 22.939999999999998 24.91 26.369999999999997 25.779999999999998 100-104 23.3 25.96 25.580000000000002 25.16 105-109 22.785 25.130000000000003 26.47 25.615 110-114 23.29 25.52 25.895000000000003 25.295 115-119 23.575 25.629999999999995 25.56 25.235000000000003 120-124 23.580000000000002 25.025 25.71 25.685000000000002 125-129 23.45 25.71 25.655 25.185000000000002 130-134 23.48 25.355 25.955000000000002 25.21 135-139 23.555 25.645 25.555 25.245 140-144 23.425 25.240000000000002 25.895000000000003 25.44 145-149 23.645 25.355 25.575 25.424999999999997 150-151 23.660490736104155 24.849774661992992 25.625938908362546 25.863795693540307 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 2.0 27 3.5 28 2.0 29 4.5 30 7.5 31 8.0 32 13.5 33 22.0 34 27.5 35 39.5 36 50.0 37 58.0 38 81.5 39 104.5 40 117.0 41 146.5 42 185.5 43 205.0 44 213.0 45 215.5 46 212.0 47 211.5 48 217.5 49 202.5 50 168.0 51 154.5 52 136.5 53 115.0 54 105.0 55 85.5 56 83.5 57 90.0 58 79.5 59 74.0 60 64.5 61 65.5 62 69.5 63 58.0 64 54.0 65 48.0 66 45.0 67 38.0 68 23.5 69 14.0 70 14.0 71 16.5 72 12.0 73 7.5 74 7.0 75 6.0 76 5.0 77 3.5 78 1.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.2 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.475 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958431 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958431_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.833 33.0 33.0 34.0 32.0 34.0 2 32.764 33.0 33.0 34.0 32.0 34.0 3 32.92325 34.0 33.0 34.0 32.0 34.0 4 32.99325 34.0 33.0 34.0 32.0 34.0 5 32.94525 34.0 33.0 34.0 32.0 34.0 6 37.0705 38.0 38.0 38.0 36.0 38.0 7 37.00775 38.0 38.0 38.0 36.0 38.0 8 37.06925 38.0 38.0 38.0 37.0 38.0 9 37.05175 38.0 38.0 38.0 36.0 38.0 10-14 36.9661 38.0 38.0 38.0 35.8 38.0 15-19 36.773799999999994 38.0 38.0 38.0 35.2 38.0 20-24 36.964999999999996 38.0 38.0 38.0 36.0 38.0 25-29 37.04245 38.0 38.0 38.0 36.0 38.0 30-34 37.060199999999995 38.0 38.0 38.0 36.2 38.0 35-39 37.004000000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.981100000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.9265 38.0 38.0 38.0 35.8 38.0 50-54 36.8026 38.0 38.0 38.0 35.2 38.0 55-59 36.91995 38.0 38.0 38.0 35.8 38.0 60-64 36.818900000000006 38.0 38.0 38.0 35.6 38.0 65-69 36.698699999999995 38.0 38.0 38.0 34.8 38.0 70-74 36.60305 38.0 38.0 38.0 34.6 38.0 75-79 36.366049999999994 38.0 38.0 38.0 33.6 38.0 80-84 36.3992 38.0 38.0 38.0 34.0 38.0 85-89 36.2533 38.0 37.8 38.0 33.4 38.0 90-94 36.21455 38.0 38.0 38.0 33.4 38.0 95-99 36.1104 38.0 37.6 38.0 33.0 38.0 100-104 35.94855 38.0 37.0 38.0 32.8 38.0 105-109 35.77885 38.0 36.8 38.0 31.8 38.0 110-114 35.5485 38.0 36.2 38.0 31.0 38.0 115-119 35.37825 38.0 36.0 38.0 29.8 38.0 120-124 35.160199999999996 38.0 35.6 38.0 28.2 38.0 125-129 35.185249999999996 38.0 35.8 38.0 28.6 38.0 130-134 34.66005 38.0 35.0 38.0 27.0 38.0 135-139 34.26285 38.0 35.0 38.0 24.0 38.0 140-144 33.85269999999999 38.0 33.8 38.0 23.2 38.0 145-149 33.11635 38.0 33.6 38.0 19.0 38.0 150-151 27.7275 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 2.0 16 3.0 17 2.0 18 3.0 19 5.0 20 4.0 21 0.0 22 10.0 23 15.0 24 13.0 25 25.0 26 25.0 27 31.0 28 21.0 29 47.0 30 59.0 31 70.0 32 99.0 33 121.0 34 201.0 35 377.0 36 693.0 37 2161.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.249937453089814 17.613209907430573 12.259194395796849 36.87765824368276 2 27.525 24.6 29.099999999999998 18.775 3 21.725 25.85 28.000000000000004 24.425 4 26.5 30.0 20.8 22.7 5 27.6 32.9 20.1 19.400000000000002 6 22.400000000000002 35.3 21.475 20.825 7 22.025 19.775000000000002 35.025 23.175 8 23.974999999999998 23.175 24.65 28.199999999999996 9 22.275 22.900000000000002 28.95 25.874999999999996 10-14 25.83 26.685 23.56 23.925 15-19 25.724999999999998 25.515 24.57 24.19 20-24 25.355 26.57 24.404999999999998 23.669999999999998 25-29 25.655 25.1 24.959999999999997 24.285 30-34 25.485000000000003 26.229999999999997 24.51 23.775 35-39 25.480000000000004 25.615 24.675 24.23 40-44 25.729999999999997 25.19 24.445 24.635 45-49 25.71 24.95 25.169999999999998 24.169999999999998 50-54 25.650000000000002 25.624999999999996 24.815 23.91 55-59 26.540000000000003 25.55 24.474999999999998 23.435 60-64 25.66 25.7 24.560000000000002 24.08 65-69 25.480000000000004 26.064999999999998 24.560000000000002 23.895 70-74 25.385 25.485000000000003 25.52 23.61 75-79 26.14 25.1 24.955 23.805 80-84 25.474999999999998 25.285000000000004 25.064999999999998 24.175 85-89 25.885 25.290000000000003 25.335 23.49 90-94 25.755 25.535000000000004 24.97 23.74 95-99 25.14 25.905 25.25 23.705000000000002 100-104 25.785000000000004 25.740000000000002 25.205 23.27 105-109 25.805 25.35 25.380000000000003 23.465 110-114 25.86 26.08 24.625 23.435 115-119 25.96 26.06 24.709999999999997 23.27 120-124 25.94 26.185000000000002 24.779999999999998 23.095 125-129 26.085 25.924999999999997 24.69 23.3 130-134 26.179999999999996 25.995 24.725 23.1 135-139 26.43 26.105 24.595 22.869999999999997 140-144 26.39 26.035000000000004 24.605 22.97 145-149 26.33 26.174999999999997 24.515 22.98 150-151 26.411315558893477 25.86055826761797 25.284766554011767 22.44335961947678 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 0.5 28 2.0 29 3.5 30 6.0 31 9.5 32 9.0 33 12.5 34 19.5 35 33.5 36 54.0 37 61.0 38 67.5 39 92.5 40 115.5 41 139.0 42 169.5 43 184.0 44 193.5 45 201.5 46 216.5 47 208.5 48 187.0 49 183.0 50 167.5 51 144.5 52 137.5 53 123.0 54 106.5 55 99.0 56 92.5 57 91.0 58 85.5 59 82.5 60 83.0 61 87.0 62 75.5 63 63.5 64 58.0 65 55.0 66 43.5 67 38.0 68 45.0 69 41.0 70 28.5 71 20.0 72 23.0 73 17.0 74 5.5 75 3.0 76 3.0 77 3.5 78 2.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01215805471124 97.725 2 0.7598784194528876 1.5 3 0.2026342451874367 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025329280648429587 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.6125 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.475 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150547 spots for SRR6958431.sra Written 1150547 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra Read 1150532 spots for SRR6958431.sra Written 1150532 spots for SRR6958431.sra SRR ids: ['SRR6958431.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mlyzpzg0 SRR6958431.sra spots: 23010655 blocks: [[1, 1150532], [1150533, 2301064], [2301065, 3451596], [3451597, 4602128], [4602129, 5752660], [5752661, 6903192], [6903193, 8053724], [8053725, 9204256], [9204257, 10354788], [10354789, 11505320], [11505321, 12655852], [12655853, 13806384], [13806385, 14956916], [14956917, 16107448], [16107449, 17257980], [17257981, 18408512], [18408513, 19559044], [19559045, 20709576], [20709577, 21860108], [21860109, 23010655]] SRR6958431 file size 7775855 SRR6958431 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958431 SRR6958431_1.fastq SRR6958431_2.fastq Input file: SRR6958431_1.fastq Paired file: SRR6958431_2.fastq trimmed: SRR6958431-trimmed-pair1.fastq, SRR6958431-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:03:27 2024 >> started Fri Dec 6 23:03:53 2024 >> done (26.947s) 23010655 read pairs processed; of these: 11137 ( 0.05%) short read pairs filtered out after trimming by size control 7665 ( 0.03%) empty read pairs filtered out after trimming by size control 22991853 (99.92%) read pairs available; of these: 8220682 (35.75%) trimmed read pairs available after processing 14771171 (64.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 5 0.00% 24 5 0.00% 25 2 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 7 0.00% 30 11 0.00% 31 4 0.00% 32 13 0.00% 33 6 0.00% 34 11 0.00% 35 10 0.00% 36 10 0.00% 37 11 0.00% 38 12 0.00% 39 11 0.00% 40 9 0.00% 41 14 0.00% 42 12 0.00% 43 13 0.00% 44 15 0.00% 45 25 0.00% 46 26 0.00% 47 20 0.00% 48 32 0.00% 49 30 0.00% 50 41 0.00% 51 38 0.00% 52 44 0.00% 53 45 0.00% 54 43 0.00% 55 51 0.00% 56 49 0.00% 57 55 0.00% 58 79 0.00% 59 73 0.00% 60 90 0.00% 61 109 0.00% 62 111 0.00% 63 103 0.00% 64 126 0.00% 65 143 0.00% 66 173 0.00% 67 192 0.00% 68 198 0.00% 69 203 0.00% 70 242 0.00% 71 246 0.00% 72 313 0.00% 73 376 0.00% 74 368 0.00% 75 471 0.00% 76 478 0.00% 77 556 0.00% 78 584 0.00% 79 697 0.00% 80 784 0.00% 81 903 0.00% 82 954 0.00% 83 1143 0.00% 84 1689 0.01% 85 2146 0.01% 86 2289 0.01% 87 2497 0.01% 88 2857 0.01% 89 2793 0.01% 90 2920 0.01% 91 3087 0.01% 92 3420 0.01% 93 3559 0.02% 94 3851 0.02% 95 3948 0.02% 96 4427 0.02% 97 4646 0.02% 98 5051 0.02% 99 5358 0.02% 100 5859 0.03% 101 6222 0.03% 102 6565 0.03% 103 7190 0.03% 104 7714 0.03% 105 8173 0.04% 106 8730 0.04% 107 9416 0.04% 108 9925 0.04% 109 10674 0.05% 110 11186 0.05% 111 11894 0.05% 112 12722 0.06% 113 13454 0.06% 114 14483 0.06% 115 15591 0.07% 116 16379 0.07% 117 17186 0.07% 118 18350 0.08% 119 18878 0.08% 120 19873 0.09% 121 21033 0.09% 122 22471 0.10% 123 23420 0.10% 124 25015 0.11% 125 26319 0.11% 126 27770 0.12% 127 29416 0.13% 128 30827 0.13% 129 33043 0.14% 130 34996 0.15% 131 36983 0.16% 132 39412 0.17% 133 41857 0.18% 134 44854 0.20% 135 47548 0.21% 136 51374 0.22% 137 55468 0.24% 138 58765 0.26% 139 64152 0.28% 140 70209 0.31% 141 77809 0.34% 142 87848 0.38% 143 100913 0.44% 144 118902 0.52% 145 144946 0.63% 146 190960 0.83% 147 258430 1.12% 148 411936 1.79% 149 856580 3.73% 150 4871991 21.19% 151 14771171 64.25% 22991853 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=22 prefix-density=0.79 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=35.75 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=20 prefix-density=0.59 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=43.81 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.4 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR6958431 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:04:39 Started mapping on | Dec 06 23:04:40 Finished on | Dec 06 23:07:14 Mapping speed, Million of reads per hour | 537.47 Number of input reads | 22991853 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22484549 Uniquely mapped reads % | 97.79% Average mapped length | 298.00 Number of splices: Total | 26737913 Number of splices: Annotated (sjdb) | 25242507 Number of splices: GT/AG | 26377532 Number of splices: GC/AG | 318664 Number of splices: AT/AC | 10086 Number of splices: Non-canonical | 31631 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 185936 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 9693 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 328127 328127 328127 N_multimapping 185936 185936 185936 N_noFeature 727309 21828073 898835 N_ambiguous 576440 2966 92894 UnstrandedReadsAssigned:21180800 PositiveStrandReadsAssigned:653510 NegativeStrandReadsAssigned:21492820 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958431 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958431-trimmed-pair1.fastq SRR6958431-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,991,853 reads, 21,474,055 reads pseudoaligned [quant] estimated average fragment length: 278.599 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6958431.ke.tsv 35125 SRR6958431.se.tsv 88098 total ==> SRR6958431.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.884 0 0 PNS24247 1044 766.401 67.3715 5.98935 PNS24249 1928 1650.4 53.2232 2.19721 PNS24246 1044 766.401 67.3715 5.98935 PNS24248 1044 766.401 67.3715 5.98935 PNS24244 1471 1193.4 37.6622 2.1502 PNS24243 293 77.0842 1 0.88388 KQK14069 1603 1325.4 5667.56 291.345 KQK14071 474 213.851 83.8257 26.707 ==> SRR6958431.se.tsv <== BRADI_1g14170v3 6604 BRADI_1g53295v3 275 BRADI_1g59795v3 441 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 351 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR6958431 completed mapping pipeline successfully