Starting /dee2/code/volunteer_pipeline.sh SRR6958432 current disk space = 1548011196416 free memory = 1599735956 SRR6958432 SRAfilesize b8fc5c5759450a122bfb2c3f53fdb88b SRR6958432.sra SRR6958432.sra file validated SRR6958432 is paired end SRR6958432 is conventional basespace SRR6958432 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.85825 18.0 18.0 18.0 18.0 32.0 2 22.0535 18.0 18.0 27.0 18.0 30.0 3 27.34025 27.0 27.0 29.0 25.0 31.0 4 27.76275 29.0 27.0 31.0 15.0 33.0 5 30.5945 32.0 32.0 33.0 27.0 33.0 6 36.1675 37.0 36.0 38.0 33.0 38.0 7 36.92 38.0 37.0 38.0 35.0 38.0 8 37.0665 38.0 38.0 38.0 36.0 38.0 9 37.259 38.0 38.0 38.0 37.0 38.0 10-14 37.3325 38.0 38.0 38.0 36.8 38.0 15-19 37.35385 38.0 38.0 38.0 37.0 38.0 20-24 37.364000000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.32025 38.0 38.0 38.0 36.8 38.0 30-34 37.17829999999999 38.0 38.0 38.0 36.2 38.0 35-39 37.1609 38.0 38.0 38.0 36.0 38.0 40-44 37.0178 38.0 38.0 38.0 35.8 38.0 45-49 37.1582 38.0 38.0 38.0 36.0 38.0 50-54 37.12995000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.919149999999995 38.0 38.0 38.0 35.6 38.0 60-64 36.88935 38.0 38.0 38.0 34.8 38.0 65-69 36.790049999999994 38.0 38.0 38.0 35.0 38.0 70-74 36.86105 38.0 38.0 38.0 35.0 38.0 75-79 36.6171 38.0 38.0 38.0 34.4 38.0 80-84 36.38215 38.0 37.4 38.0 33.6 38.0 85-89 36.13869999999999 38.0 37.0 38.0 32.8 38.0 90-94 36.3169 38.0 37.2 38.0 33.6 38.0 95-99 36.16065 38.0 37.0 38.0 33.2 38.0 100-104 36.065599999999996 38.0 37.0 38.0 33.0 38.0 105-109 35.841150000000006 38.0 36.4 38.0 31.4 38.0 110-114 35.43425 38.0 35.8 38.0 29.8 38.0 115-119 35.33335 38.0 35.6 38.0 29.2 38.0 120-124 35.08905 38.0 35.0 38.0 28.2 38.0 125-129 34.7536 38.0 35.0 38.0 27.0 38.0 130-134 34.436350000000004 38.0 34.4 38.0 25.0 38.0 135-139 34.367399999999996 38.0 34.2 38.0 25.4 38.0 140-144 33.75425 38.0 33.8 38.0 21.4 38.0 145-149 32.458600000000004 36.8 33.2 38.0 14.2 38.0 150-151 28.215875 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 0.0 16 1.0 17 3.0 18 1.0 19 0.0 20 1.0 21 3.0 22 2.0 23 3.0 24 7.0 25 12.0 26 15.0 27 17.0 28 37.0 29 54.0 30 77.0 31 86.0 32 121.0 33 176.0 34 273.0 35 528.0 36 1209.0 37 1371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.47747747747748 23.963963963963963 6.563706563706563 51.994851994852 2 12.975 18.8 36.675000000000004 31.55 3 18.8 14.85 24.349999999999998 42.0 4 22.0 26.275 21.2 30.525000000000002 5 25.243932949712285 29.497122842131603 23.54265699274456 21.71628721541156 6 21.775 33.45 23.974999999999998 20.8 7 17.075000000000003 25.074999999999996 38.6 19.25 8 18.75 24.3 29.875 27.075 9 18.7 21.975 34.0 25.324999999999996 10-14 21.349999999999998 27.6 26.474999999999998 24.575 15-19 21.099999999999998 26.255 27.275 25.369999999999997 20-24 22.11 26.05 27.155 24.685000000000002 25-29 21.2 25.8 27.625 25.374999999999996 30-34 21.93 26.515 26.495 25.06 35-39 21.84 26.57 26.87 24.72 40-44 21.285 27.165 26.56 24.990000000000002 45-49 21.875 26.82 26.669999999999998 24.635 50-54 21.93 25.645 27.500000000000004 24.925 55-59 21.790000000000003 26.44 26.77 25.0 60-64 21.44 26.474999999999998 27.125 24.959999999999997 65-69 22.189999999999998 26.305 26.340000000000003 25.165 70-74 21.845 26.224999999999998 27.034999999999997 24.895 75-79 21.755 26.69 26.205000000000002 25.35 80-84 21.634999999999998 26.224999999999998 27.0 25.14 85-89 22.425 26.185000000000002 27.02 24.37 90-94 21.790000000000003 27.055 26.265 24.89 95-99 21.81 26.345000000000002 26.875 24.97 100-104 21.965 25.575 27.185 25.275 105-109 22.435 26.235000000000003 26.724999999999998 24.605 110-114 22.39 25.505 27.22 24.884999999999998 115-119 21.884999999999998 26.135 26.99 24.990000000000002 120-124 21.95 25.695 26.845000000000002 25.509999999999998 125-129 22.705000000000002 25.19 27.224999999999998 24.88 130-134 22.245 26.125 26.865 24.765 135-139 22.595000000000002 26.375 26.19 24.84 140-144 22.645 26.205000000000002 26.415 24.735 145-149 22.34 25.46 27.105 25.095 150-151 22.929697272954716 25.906930197648236 26.53239929947461 24.630973229922443 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 2.0 27 1.5 28 2.0 29 7.5 30 10.0 31 11.0 32 15.5 33 21.5 34 33.5 35 48.0 36 62.0 37 76.5 38 97.0 39 136.0 40 158.0 41 172.5 42 202.5 43 224.5 44 249.5 45 251.0 46 246.0 47 231.0 48 213.5 49 197.0 50 168.5 51 151.5 52 132.5 53 117.5 54 104.5 55 83.5 56 71.0 57 63.5 58 53.0 59 46.5 60 43.5 61 45.5 62 39.5 63 37.0 64 37.0 65 29.0 66 22.5 67 19.5 68 13.0 69 10.5 70 11.0 71 7.5 72 6.0 73 5.5 74 3.5 75 1.5 76 1.0 77 0.5 78 1.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.8375 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.1124999999999998 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.5750000000000002 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGAG 10 0.006338066 148.6282 1 AAGTTTC 10 0.0065874006 146.74684 4 >>END_MODULE SRR6958432 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958432_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94825 33.0 33.0 34.0 32.0 34.0 2 32.97775 33.0 33.0 34.0 32.0 34.0 3 32.94 33.0 33.0 34.0 32.0 34.0 4 32.883 33.0 33.0 34.0 32.0 34.0 5 32.9595 34.0 33.0 34.0 32.0 34.0 6 37.0925 38.0 38.0 38.0 36.0 38.0 7 37.1 38.0 38.0 38.0 36.0 38.0 8 37.12 38.0 38.0 38.0 36.0 38.0 9 36.95025 38.0 38.0 38.0 36.0 38.0 10-14 36.9917 38.0 38.0 38.0 35.8 38.0 15-19 36.9231 38.0 38.0 38.0 35.6 38.0 20-24 36.92845 38.0 38.0 38.0 35.6 38.0 25-29 36.9987 38.0 38.0 38.0 36.0 38.0 30-34 37.051750000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.86775 38.0 38.0 38.0 35.4 38.0 40-44 36.88845 38.0 38.0 38.0 35.4 38.0 45-49 36.81255 38.0 38.0 38.0 35.0 38.0 50-54 36.80800000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.7393 38.0 38.0 38.0 34.8 38.0 60-64 36.72605 38.0 38.0 38.0 35.0 38.0 65-69 36.58069999999999 38.0 38.0 38.0 34.2 38.0 70-74 36.54235 38.0 38.0 38.0 34.0 38.0 75-79 36.30565 38.0 37.6 38.0 33.6 38.0 80-84 36.29395 38.0 37.6 38.0 33.4 38.0 85-89 36.1125 38.0 37.2 38.0 33.0 38.0 90-94 36.0471 38.0 37.0 38.0 33.0 38.0 95-99 35.98775 38.0 37.0 38.0 32.6 38.0 100-104 35.8428 38.0 37.0 38.0 32.0 38.0 105-109 35.53055 38.0 36.6 38.0 30.2 38.0 110-114 35.289699999999996 38.0 35.8 38.0 29.2 38.0 115-119 35.060249999999996 38.0 35.6 38.0 28.0 38.0 120-124 34.85785 38.0 35.0 38.0 27.6 38.0 125-129 34.73855 38.0 35.0 38.0 27.2 38.0 130-134 34.3878 38.0 34.8 38.0 25.0 38.0 135-139 33.76115 38.0 34.0 38.0 22.6 38.0 140-144 33.32665 38.0 33.6 38.0 19.4 38.0 145-149 32.2267 38.0 31.8 38.0 13.2 38.0 150-151 27.73 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 3.0 15 2.0 16 4.0 17 4.0 18 3.0 19 2.0 20 4.0 21 6.0 22 6.0 23 8.0 24 13.0 25 20.0 26 24.0 27 31.0 28 39.0 29 46.0 30 63.0 31 87.0 32 104.0 33 153.0 34 245.0 35 366.0 36 807.0 37 1947.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.749562171628725 17.838378784088064 12.384288216162123 37.02777082812109 2 27.500000000000004 23.95 30.7 17.849999999999998 3 22.466850137603203 25.369026770077557 30.2727045283963 21.891418563922944 4 25.05 30.325000000000003 22.650000000000002 21.975 5 27.113556778389196 33.34167083541771 20.635317658829415 18.90945472736368 6 21.85 37.2 21.125 19.825 7 22.075 20.825 36.35 20.75 8 23.1 23.95 25.874999999999996 27.075 9 23.599999999999998 23.125 28.875 24.4 10-14 25.230000000000004 26.765 24.22 23.785 15-19 25.2 26.21 25.674999999999997 22.915 20-24 25.295 26.700000000000003 24.990000000000002 23.015 25-29 25.05 26.76 25.115 23.075000000000003 30-34 24.19 26.93 25.650000000000002 23.23 35-39 25.580000000000002 26.19 24.97 23.26 40-44 24.665 26.5 25.555 23.28 45-49 24.685000000000002 27.384999999999998 25.355 22.575 50-54 24.51 26.895000000000003 25.555 23.04 55-59 25.535000000000004 25.979999999999997 25.569999999999997 22.915 60-64 24.755 26.945000000000004 25.5 22.8 65-69 24.834999999999997 26.595000000000002 25.814999999999998 22.755 70-74 25.674999999999997 26.005 25.380000000000003 22.939999999999998 75-79 25.240000000000002 26.445 25.795 22.52 80-84 25.025 26.615 25.465 22.895 85-89 24.745 26.41 26.06 22.785 90-94 24.585 26.625 26.495 22.295 95-99 25.555 26.505000000000003 25.585 22.355 100-104 25.155 26.865 25.785000000000004 22.195 105-109 24.7 27.575 25.245 22.48 110-114 24.935 26.674999999999997 26.3 22.09 115-119 25.124999999999996 26.57 25.82 22.485 120-124 25.674999999999997 26.775 25.71 21.84 125-129 25.650000000000002 26.875 25.540000000000003 21.935 130-134 25.509999999999998 26.55 25.814999999999998 22.125 135-139 25.424999999999997 26.965 25.66 21.95 140-144 25.21 26.905 25.795 22.09 145-149 25.759999999999998 26.35 26.46 21.43 150-151 24.818613960470355 27.445584188141105 25.83187390542907 21.90392794595947 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 3.0 27 2.5 28 5.0 29 6.0 30 7.0 31 13.5 32 19.5 33 23.5 34 32.0 35 42.5 36 53.5 37 67.5 38 97.5 39 123.5 40 132.0 41 160.0 42 194.5 43 207.0 44 218.5 45 238.0 46 244.5 47 225.0 48 186.5 49 173.0 50 164.5 51 143.0 52 123.0 53 113.0 54 97.5 55 83.5 56 83.0 57 74.0 58 70.0 59 72.5 60 65.5 61 50.0 62 44.5 63 46.5 64 43.5 65 37.0 66 36.0 67 32.5 68 27.0 69 24.0 70 24.0 71 18.0 72 15.0 73 11.5 74 5.0 75 5.5 76 3.5 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.075 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26841574167507 98.375 2 0.6559031281533804 1.3 3 0.025227043390514632 0.075 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.1375000000000002 0.0 0.0 0.0 0.0 134-135 1.3 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACGAGG 10 0.0068378756 144.95 7 >>END_MODULE Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938408 spots for SRR6958432.sra Written 938408 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra Read 938406 spots for SRR6958432.sra Written 938406 spots for SRR6958432.sra SRR ids: ['SRR6958432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2tycgxpo SRR6958432.sra spots: 18768122 blocks: [[1, 938406], [938407, 1876812], [1876813, 2815218], [2815219, 3753624], [3753625, 4692030], [4692031, 5630436], [5630437, 6568842], [6568843, 7507248], [7507249, 8445654], [8445655, 9384060], [9384061, 10322466], [10322467, 11260872], [11260873, 12199278], [12199279, 13137684], [13137685, 14076090], [14076091, 15014496], [15014497, 15952902], [15952903, 16891308], [16891309, 17829714], [17829715, 18768122]] SRR6958432 file size 6338200 SRR6958432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958432 SRR6958432_1.fastq SRR6958432_2.fastq Input file: SRR6958432_1.fastq Paired file: SRR6958432_2.fastq trimmed: SRR6958432-trimmed-pair1.fastq, SRR6958432-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:02:17 2024 >> started Fri Dec 6 23:02:42 2024 >> done (24.682s) 18768122 read pairs processed; of these: 9296 ( 0.05%) short read pairs filtered out after trimming by size control 8394 ( 0.04%) empty read pairs filtered out after trimming by size control 18750432 (99.91%) read pairs available; of these: 6591336 (35.15%) trimmed read pairs available after processing 12159096 (64.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 1 0.00% 21 3 0.00% 22 5 0.00% 23 1 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 8 0.00% 28 3 0.00% 29 7 0.00% 30 8 0.00% 31 6 0.00% 32 6 0.00% 33 7 0.00% 34 5 0.00% 35 7 0.00% 36 6 0.00% 37 5 0.00% 38 11 0.00% 39 8 0.00% 40 9 0.00% 41 18 0.00% 42 8 0.00% 43 14 0.00% 44 10 0.00% 45 12 0.00% 46 6 0.00% 47 22 0.00% 48 20 0.00% 49 22 0.00% 50 19 0.00% 51 27 0.00% 52 24 0.00% 53 22 0.00% 54 36 0.00% 55 43 0.00% 56 39 0.00% 57 40 0.00% 58 47 0.00% 59 48 0.00% 60 56 0.00% 61 87 0.00% 62 76 0.00% 63 88 0.00% 64 141 0.00% 65 96 0.00% 66 114 0.00% 67 133 0.00% 68 127 0.00% 69 158 0.00% 70 212 0.00% 71 211 0.00% 72 236 0.00% 73 239 0.00% 74 283 0.00% 75 299 0.00% 76 330 0.00% 77 363 0.00% 78 436 0.00% 79 471 0.00% 80 561 0.00% 81 596 0.00% 82 725 0.00% 83 815 0.00% 84 1246 0.01% 85 1671 0.01% 86 1539 0.01% 87 1723 0.01% 88 1889 0.01% 89 2052 0.01% 90 2286 0.01% 91 2501 0.01% 92 2411 0.01% 93 2510 0.01% 94 3120 0.02% 95 2972 0.02% 96 3195 0.02% 97 3458 0.02% 98 3516 0.02% 99 3874 0.02% 100 4286 0.02% 101 4610 0.02% 102 4855 0.03% 103 5337 0.03% 104 5649 0.03% 105 5922 0.03% 106 6485 0.03% 107 7052 0.04% 108 7346 0.04% 109 7890 0.04% 110 8208 0.04% 111 9038 0.05% 112 9387 0.05% 113 10518 0.06% 114 10852 0.06% 115 11926 0.06% 116 12296 0.07% 117 13115 0.07% 118 13685 0.07% 119 14507 0.08% 120 15326 0.08% 121 16045 0.09% 122 17135 0.09% 123 18064 0.10% 124 19338 0.10% 125 20345 0.11% 126 21476 0.11% 127 23011 0.12% 128 24046 0.13% 129 25494 0.14% 130 27264 0.15% 131 29246 0.16% 132 30999 0.17% 133 33370 0.18% 134 35348 0.19% 135 38236 0.20% 136 40939 0.22% 137 44651 0.24% 138 48357 0.26% 139 52344 0.28% 140 57370 0.31% 141 63214 0.34% 142 72025 0.38% 143 82737 0.44% 144 97239 0.52% 145 121706 0.65% 146 158937 0.85% 147 212401 1.13% 148 334374 1.78% 149 712662 3.80% 150 3877253 20.68% 151 12159096 64.85% 18750432 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=22 prefix-density=0.48 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=69.11 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=21 prefix-density=0.40 prefix-fanout=3.0 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=73.58 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.5 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR6958432 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:03:45 Started mapping on | Dec 06 23:03:46 Finished on | Dec 06 23:05:45 Mapping speed, Million of reads per hour | 567.24 Number of input reads | 18750432 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18449259 Uniquely mapped reads % | 98.39% Average mapped length | 298.08 Number of splices: Total | 22290450 Number of splices: Annotated (sjdb) | 21044377 Number of splices: GT/AG | 21994002 Number of splices: GC/AG | 260146 Number of splices: AT/AC | 9411 Number of splices: Non-canonical | 26891 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 162082 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 5661 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 144677 144677 144677 N_multimapping 162082 162082 162082 N_noFeature 724856 17940116 873207 N_ambiguous 436629 2340 77418 UnstrandedReadsAssigned:17287774 PositiveStrandReadsAssigned:506803 NegativeStrandReadsAssigned:17498634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958432 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958432-trimmed-pair1.fastq SRR6958432-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,750,432 reads, 17,503,790 reads pseudoaligned [quant] estimated average fragment length: 280.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR6958432.ke.tsv 35125 SRR6958432.se.tsv 88098 total ==> SRR6958432.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.984 0 0 PNS24247 1044 764.629 62.9799 7.24225 PNS24249 1928 1648.63 35.1152 1.87281 PNS24246 1044 764.629 62.9799 7.24225 PNS24248 1044 764.629 62.9799 7.24225 PNS24244 1471 1191.63 27.945 2.06198 PNS24243 293 75.3945 0 0 KQK14069 1603 1323.63 2950.56 196.002 KQK14071 474 211.725 53.1976 22.0924 ==> SRR6958432.se.tsv <== BRADI_1g14170v3 3450 BRADI_1g53295v3 318 BRADI_1g59795v3 335 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 321 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 325 BRADI_1g48960v3 0 SRR6958432 completed mapping pipeline successfully