Starting /dee2/code/volunteer_pipeline.sh SRR6958433 current disk space = 1548060405760 free memory = 1597153416 SRR6958433 SRAfilesize 36a5b01c39e9599aeb1b42303f5c2e8f SRR6958433.sra SRR6958433.sra file validated SRR6958433 is paired end SRR6958433 is conventional basespace SRR6958433 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7955 33.0 32.0 34.0 25.0 34.0 2 32.19025 33.0 33.0 34.0 29.0 34.0 3 32.51825 33.0 33.0 34.0 30.0 34.0 4 32.3795 33.0 33.0 34.0 31.0 34.0 5 32.58075 33.0 33.0 34.0 32.0 34.0 6 36.47225 38.0 37.0 38.0 34.0 38.0 7 37.00975 38.0 38.0 38.0 35.0 38.0 8 37.149 38.0 38.0 38.0 36.0 38.0 9 37.3645 38.0 38.0 38.0 37.0 38.0 10-14 37.390550000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.34565 38.0 38.0 38.0 37.0 38.0 20-24 37.4281 38.0 38.0 38.0 37.0 38.0 25-29 37.31975 38.0 38.0 38.0 37.0 38.0 30-34 37.2494 38.0 38.0 38.0 36.6 38.0 35-39 37.0065 38.0 38.0 38.0 36.0 38.0 40-44 37.00085 38.0 38.0 38.0 36.0 38.0 45-49 37.113350000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.9454 38.0 38.0 38.0 35.6 38.0 55-59 36.71005 38.0 38.0 38.0 34.4 38.0 60-64 36.81464999999999 38.0 38.0 38.0 35.0 38.0 65-69 36.9988 38.0 38.0 38.0 35.6 38.0 70-74 36.97115 38.0 38.0 38.0 35.0 38.0 75-79 36.82925 38.0 38.0 38.0 35.0 38.0 80-84 36.512950000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.388099999999994 38.0 37.8 38.0 33.6 38.0 90-94 36.40260000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.46235 38.0 38.0 38.0 34.0 38.0 100-104 36.1875 38.0 37.0 38.0 33.0 38.0 105-109 36.00404999999999 38.0 37.0 38.0 32.4 38.0 110-114 35.824149999999996 38.0 36.6 38.0 31.8 38.0 115-119 35.79665 38.0 36.4 38.0 31.4 38.0 120-124 35.500600000000006 38.0 36.0 38.0 30.2 38.0 125-129 35.253 38.0 35.2 38.0 28.6 38.0 130-134 35.093 38.0 35.0 38.0 28.2 38.0 135-139 34.70525 38.0 35.0 38.0 27.4 38.0 140-144 34.38934999999999 38.0 34.8 38.0 25.2 38.0 145-149 33.64295 38.0 34.2 38.0 21.2 38.0 150-151 29.126625 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 5.0 23 6.0 24 8.0 25 9.0 26 11.0 27 23.0 28 27.0 29 38.0 30 52.0 31 88.0 32 117.0 33 141.0 34 178.0 35 360.0 36 824.0 37 2102.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.52480082241069 8.121305576972501 9.149318941146236 44.20457465947057 2 21.575 12.25 37.025000000000006 29.15 3 19.325 14.075 26.674999999999997 39.925 4 25.324999999999996 21.925 22.475 30.275000000000002 5 25.674999999999997 27.875 24.325 22.125 6 22.05 32.275 24.5 21.175 7 17.65 24.925 38.125 19.3 8 19.575 24.375 29.225 26.825 9 19.925 23.425 31.6 25.05 10-14 22.37 27.145000000000003 25.64 24.845 15-19 22.3 25.53 26.525 25.645 20-24 22.36 25.580000000000002 26.35 25.71 25-29 22.645 25.195 27.275 24.884999999999998 30-34 22.365 25.585 26.91 25.14 35-39 22.869999999999997 25.430000000000003 26.200000000000003 25.5 40-44 22.67 25.85 26.16 25.319999999999997 45-49 22.75 25.66 26.155 25.435000000000002 50-54 22.66 25.55 26.729999999999997 25.06 55-59 23.11 25.71 26.275 24.905 60-64 23.09 24.645 26.145000000000003 26.119999999999997 65-69 22.985 25.485000000000003 26.39 25.14 70-74 22.95 25.7 25.785000000000004 25.564999999999998 75-79 22.516125806290315 25.54127706385319 26.421321066053306 25.52127606380319 80-84 23.105 25.735000000000003 25.740000000000002 25.419999999999998 85-89 22.994999999999997 25.765 25.919999999999998 25.319999999999997 90-94 23.189999999999998 25.314999999999998 26.06 25.435000000000002 95-99 23.397339733973396 24.957495749574957 26.21762176217622 25.42754275427543 100-104 22.884999999999998 25.5 25.985000000000003 25.629999999999995 105-109 22.967296729672967 25.012501250125013 26.047604760476045 25.972597259725973 110-114 23.137313731373137 25.30753075307531 26.162616261626166 25.392539253925396 115-119 23.330000000000002 24.88 25.4 26.39 120-124 23.425 25.790000000000003 25.515 25.27 125-129 23.215 25.380000000000003 25.645 25.759999999999998 130-134 23.575 25.735000000000003 25.424999999999997 25.264999999999997 135-139 23.7973797379738 25.442544254425442 25.537553755375537 25.22252225222522 140-144 23.707370737073706 25.332533253325334 25.757575757575758 25.202520252025202 145-149 23.14 25.624999999999996 25.945 25.290000000000003 150-151 23.10577644411103 26.081520380095025 24.681170292573142 26.131532883220803 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 1.0 27 1.0 28 5.5 29 7.5 30 6.5 31 11.5 32 16.5 33 23.0 34 30.5 35 37.5 36 52.0 37 71.5 38 85.5 39 103.5 40 133.0 41 158.5 42 181.5 43 202.0 44 211.0 45 206.0 46 208.0 47 203.0 48 185.0 49 188.0 50 181.5 51 155.0 52 146.5 53 128.5 54 100.5 55 93.0 56 98.0 57 87.0 58 67.5 59 70.0 60 70.5 61 57.5 62 50.0 63 54.5 64 48.5 65 43.0 66 41.5 67 35.0 68 31.0 69 29.0 70 25.0 71 16.0 72 12.0 73 8.5 74 4.5 75 3.0 76 3.0 77 3.0 78 2.0 79 1.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.01 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.01 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.3875000000000002 0.0 0.0 0.0 0.0 128-129 1.6375000000000002 0.0 0.0 0.0 0.0 130-131 1.7625 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.05 0.0 0.0 0.0 0.0 136-137 2.3375000000000004 0.0 0.0 0.0 0.0 138-139 2.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCTG 10 0.006832588 144.9875 3 ACCTTTG 10 0.006832588 144.9875 5 >>END_MODULE SRR6958433 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96 33.0 33.0 34.0 32.0 34.0 2 32.922 34.0 33.0 34.0 32.0 34.0 3 32.9635 34.0 33.0 34.0 32.0 34.0 4 32.96525 34.0 33.0 34.0 32.0 34.0 5 32.84625 34.0 33.0 34.0 32.0 34.0 6 37.1125 38.0 38.0 38.0 36.0 38.0 7 37.03825 38.0 38.0 38.0 36.0 38.0 8 36.956 38.0 38.0 38.0 36.0 38.0 9 37.0425 38.0 38.0 38.0 36.0 38.0 10-14 36.9821 38.0 38.0 38.0 35.8 38.0 15-19 36.92785 38.0 38.0 38.0 35.8 38.0 20-24 36.99945 38.0 38.0 38.0 36.0 38.0 25-29 37.081399999999995 38.0 38.0 38.0 36.2 38.0 30-34 37.10165 38.0 38.0 38.0 36.4 38.0 35-39 37.06185000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.96885 38.0 38.0 38.0 36.0 38.0 45-49 36.82905 38.0 38.0 38.0 35.4 38.0 50-54 36.759249999999994 38.0 38.0 38.0 35.0 38.0 55-59 36.87075 38.0 38.0 38.0 35.4 38.0 60-64 36.822649999999996 38.0 38.0 38.0 35.4 38.0 65-69 36.72605 38.0 38.0 38.0 34.8 38.0 70-74 36.5592 38.0 38.0 38.0 34.0 38.0 75-79 36.33555 38.0 38.0 38.0 33.8 38.0 80-84 36.2653 38.0 38.0 38.0 33.2 38.0 85-89 36.2542 38.0 38.0 38.0 33.4 38.0 90-94 36.1111 38.0 37.8 38.0 33.0 38.0 95-99 35.9911 38.0 37.0 38.0 32.8 38.0 100-104 35.80985 38.0 37.0 38.0 31.6 38.0 105-109 35.664049999999996 38.0 36.6 38.0 31.0 38.0 110-114 35.36045 38.0 35.8 38.0 29.6 38.0 115-119 35.17925 38.0 35.8 38.0 28.8 38.0 120-124 35.182100000000005 38.0 36.0 38.0 28.6 38.0 125-129 34.9174 38.0 35.4 38.0 27.6 38.0 130-134 34.622949999999996 38.0 35.0 38.0 27.0 38.0 135-139 34.022999999999996 38.0 34.2 38.0 23.0 38.0 140-144 33.7404 38.0 34.2 38.0 21.8 38.0 145-149 32.72955 38.0 33.2 38.0 16.4 38.0 150-151 27.7625 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 0.0 11 0.0 12 3.0 13 1.0 14 1.0 15 0.0 16 3.0 17 1.0 18 5.0 19 7.0 20 7.0 21 4.0 22 10.0 23 16.0 24 18.0 25 19.0 26 23.0 27 22.0 28 32.0 29 57.0 30 59.0 31 92.0 32 105.0 33 130.0 34 195.0 35 317.0 36 709.0 37 2156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.65 16.8 12.775 37.775 2 28.632158039509875 24.20605151287822 28.00700175043761 19.154788697174293 3 21.160580290145074 26.113056528264135 27.66383191595798 25.062531265632813 4 25.362681340670335 30.665332666333168 20.860430215107552 23.111555777888945 5 27.088544272136065 32.666333166583286 20.83541770885443 19.409704852426213 6 23.05 37.375 20.200000000000003 19.375 7 22.825 20.175 33.475 23.525 8 23.549999999999997 22.95 25.15 28.349999999999998 9 22.275 23.125 27.700000000000003 26.900000000000002 10-14 25.526276313815693 26.86134306715336 23.226161308065404 24.386219310965547 15-19 24.91 26.085 24.33 24.675 20-24 25.590000000000003 26.974999999999998 24.245 23.189999999999998 25-29 25.69256925692569 25.837583758375835 24.482448244824482 23.98739873987399 30-34 25.215 26.055 24.81 23.919999999999998 35-39 25.515 26.13 24.044999999999998 24.310000000000002 40-44 25.75 25.61 24.825 23.815 45-49 25.474999999999998 25.895000000000003 25.035 23.595 50-54 26.035000000000004 25.525 25.064999999999998 23.375 55-59 26.14 25.314999999999998 24.959999999999997 23.585 60-64 25.155 26.085 25.03 23.73 65-69 25.729999999999997 25.990000000000002 24.515 23.765 70-74 25.619999999999997 25.915 25.124999999999996 23.34 75-79 25.8 25.455 24.98 23.765 80-84 26.06 25.71 24.995 23.235 85-89 25.669999999999998 25.915 24.86 23.555 90-94 25.71 25.86 25.074999999999996 23.355 95-99 25.69 25.669999999999998 25.335 23.305 100-104 25.955000000000002 25.745 24.97 23.330000000000002 105-109 25.665 26.085 25.095 23.155 110-114 26.156307815390768 26.136306815340767 25.061253062653133 22.64613230661533 115-119 26.453968095214282 26.018902835425312 24.51867780167025 23.008451267690152 120-124 25.75628781439072 25.951297564878246 24.911245562278115 23.381169058452922 125-129 25.840000000000003 26.16 24.915000000000003 23.085 130-134 25.629999999999995 26.455000000000002 24.610000000000003 23.305 135-139 25.8 26.255 25.05 22.895 140-144 26.115 25.94 25.22 22.725 145-149 26.64899734960244 26.638995849377405 24.578686803020453 22.1333199979997 150-151 26.494123530882717 26.094023505876468 24.868717179294826 22.543135783945985 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 2.5 28 5.0 29 7.5 30 6.5 31 8.5 32 14.5 33 20.5 34 30.5 35 36.0 36 39.5 37 59.0 38 81.0 39 103.5 40 127.0 41 145.0 42 171.5 43 194.0 44 196.5 45 202.0 46 202.0 47 188.5 48 185.0 49 173.5 50 164.5 51 151.0 52 135.5 53 122.0 54 102.0 55 97.0 56 87.0 57 91.5 58 85.5 59 74.0 60 77.0 61 72.5 62 70.0 63 64.0 64 62.0 65 54.0 66 43.5 67 41.0 68 40.5 69 40.0 70 36.0 71 27.5 72 16.5 73 11.5 74 10.0 75 6.0 76 6.5 77 4.0 78 2.0 79 2.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.015 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.3772635814889336 0.75 3 0.07545271629778671 0.22499999999999998 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.9125 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.4 0.0 0.0 0.0 0.0 138-139 2.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGCA 10 0.006830828 145.0 5 TTCAGGG 10 0.006830828 145.0 6 >>END_MODULE Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059193 spots for SRR6958433.sra Written 1059193 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra Read 1059176 spots for SRR6958433.sra Written 1059176 spots for SRR6958433.sra SRR ids: ['SRR6958433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fe04xasu SRR6958433.sra spots: 21183537 blocks: [[1, 1059176], [1059177, 2118352], [2118353, 3177528], [3177529, 4236704], [4236705, 5295880], [5295881, 6355056], [6355057, 7414232], [7414233, 8473408], [8473409, 9532584], [9532585, 10591760], [10591761, 11650936], [11650937, 12710112], [12710113, 13769288], [13769289, 14828464], [14828465, 15887640], [15887641, 16946816], [16946817, 18005992], [18005993, 19065168], [19065169, 20124344], [20124345, 21183537]] SRR6958433 file size 7156705 SRR6958433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958433 SRR6958433_1.fastq SRR6958433_2.fastq Input file: SRR6958433_1.fastq Paired file: SRR6958433_2.fastq trimmed: SRR6958433-trimmed-pair1.fastq, SRR6958433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:03:32 2024 >> started Fri Dec 6 23:04:02 2024 >> done (29.526s) 21183537 read pairs processed; of these: 10064 ( 0.05%) short read pairs filtered out after trimming by size control 8291 ( 0.04%) empty read pairs filtered out after trimming by size control 21165182 (99.91%) read pairs available; of these: 7551582 (35.68%) trimmed read pairs available after processing 13613600 (64.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 4 0.00% 30 6 0.00% 31 6 0.00% 32 8 0.00% 33 10 0.00% 34 10 0.00% 35 8 0.00% 36 5 0.00% 37 9 0.00% 38 10 0.00% 39 12 0.00% 40 16 0.00% 41 17 0.00% 42 12 0.00% 43 17 0.00% 44 7 0.00% 45 14 0.00% 46 19 0.00% 47 19 0.00% 48 16 0.00% 49 21 0.00% 50 24 0.00% 51 34 0.00% 52 26 0.00% 53 41 0.00% 54 42 0.00% 55 47 0.00% 56 50 0.00% 57 44 0.00% 58 57 0.00% 59 69 0.00% 60 70 0.00% 61 94 0.00% 62 89 0.00% 63 111 0.00% 64 108 0.00% 65 131 0.00% 66 177 0.00% 67 161 0.00% 68 208 0.00% 69 190 0.00% 70 227 0.00% 71 250 0.00% 72 267 0.00% 73 355 0.00% 74 384 0.00% 75 427 0.00% 76 500 0.00% 77 526 0.00% 78 545 0.00% 79 666 0.00% 80 743 0.00% 81 884 0.00% 82 933 0.00% 83 1138 0.01% 84 1709 0.01% 85 2037 0.01% 86 2217 0.01% 87 2405 0.01% 88 2680 0.01% 89 2662 0.01% 90 2785 0.01% 91 3023 0.01% 92 3232 0.02% 93 3555 0.02% 94 3791 0.02% 95 3983 0.02% 96 4191 0.02% 97 4699 0.02% 98 4909 0.02% 99 5186 0.02% 100 5773 0.03% 101 6048 0.03% 102 6418 0.03% 103 6846 0.03% 104 7435 0.04% 105 7961 0.04% 106 8345 0.04% 107 8998 0.04% 108 9613 0.05% 109 10146 0.05% 110 10793 0.05% 111 11300 0.05% 112 12131 0.06% 113 12758 0.06% 114 13571 0.06% 115 14644 0.07% 116 15418 0.07% 117 16082 0.08% 118 17170 0.08% 119 18082 0.09% 120 18705 0.09% 121 19761 0.09% 122 21001 0.10% 123 22109 0.10% 124 23532 0.11% 125 24932 0.12% 126 26227 0.12% 127 27391 0.13% 128 28857 0.14% 129 30548 0.14% 130 32465 0.15% 131 34240 0.16% 132 35825 0.17% 133 38745 0.18% 134 40957 0.19% 135 44001 0.21% 136 47192 0.22% 137 50544 0.24% 138 54591 0.26% 139 58496 0.28% 140 64535 0.30% 141 70210 0.33% 142 78426 0.37% 143 89625 0.42% 144 104636 0.49% 145 128409 0.61% 146 161119 0.76% 147 222966 1.05% 148 351127 1.66% 149 740377 3.50% 150 4577543 21.63% 151 13613600 64.32% 21165182 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=7.33 fanout-score-rank=12 prefix-density=0.41 prefix-fanout=4.5 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=178.28 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.4 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.46 fanout-score-rank=20 prefix-density=0.35 prefix-fanout=3.3 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=129.10 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=20.7 sequence=CAAGAAGAAGGT SRR6958433 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:04:53 Started mapping on | Dec 06 23:04:53 Finished on | Dec 06 23:06:57 Mapping speed, Million of reads per hour | 614.47 Number of input reads | 21165182 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20827547 Uniquely mapped reads % | 98.40% Average mapped length | 298.20 Number of splices: Total | 25231300 Number of splices: Annotated (sjdb) | 23848917 Number of splices: GT/AG | 24913567 Number of splices: GC/AG | 287846 Number of splices: AT/AC | 10789 Number of splices: Non-canonical | 19098 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 150144 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 7240 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 193988 193988 193988 N_multimapping 150144 150144 150144 N_noFeature 750114 20302366 893125 N_ambiguous 451342 2319 70450 UnstrandedReadsAssigned:19626091 PositiveStrandReadsAssigned:522862 NegativeStrandReadsAssigned:19863972 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958433-trimmed-pair1.fastq SRR6958433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,165,182 reads, 19,899,066 reads pseudoaligned [quant] estimated average fragment length: 274.504 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52973 SRR6958433.ke.tsv 35125 SRR6958433.se.tsv 88098 total ==> SRR6958433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.992 0 0 PNS24247 1044 770.496 58.4459 5.74937 PNS24249 1928 1654.5 43.36 1.98637 PNS24246 1044 770.496 58.4459 5.74937 PNS24248 1044 770.496 58.4459 5.74937 PNS24244 1471 1197.5 31.3024 1.98126 PNS24243 293 77.1625 0 0 KQK14069 1603 1329.5 2329.52 132.806 KQK14071 474 215.364 40.8622 14.3809 ==> SRR6958433.se.tsv <== BRADI_1g14170v3 2644 BRADI_1g53295v3 679 BRADI_1g59795v3 373 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 332 BRADI_1g74790v3 192 BRADI_1g09890v3 0 BRADI_1g77505v3 342 BRADI_1g48960v3 0 SRR6958433 completed mapping pipeline successfully