Starting /dee2/code/volunteer_pipeline.sh SRR6958434 current disk space = 1548060405760 free memory = 1597150444 SRR6958434 SRAfilesize 1a46aa9e7437382a90fbb08c52559b50 SRR6958434.sra SRR6958434.sra file validated SRR6958434 is paired end SRR6958434 is conventional basespace SRR6958434 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.37425 31.0 25.0 33.0 18.0 33.0 2 29.44225 31.0 27.0 33.0 25.0 33.0 3 31.39325 33.0 31.0 33.0 27.0 33.0 4 32.1995 33.0 32.0 33.0 31.0 34.0 5 32.7495 33.0 33.0 34.0 32.0 34.0 6 36.38475 38.0 36.0 38.0 34.0 38.0 7 37.20475 38.0 38.0 38.0 36.0 38.0 8 37.49675 38.0 38.0 38.0 37.0 38.0 9 36.31275 38.0 38.0 38.0 33.0 38.0 10-14 37.1904 38.0 37.8 38.0 36.2 38.0 15-19 37.3829 38.0 38.0 38.0 37.0 38.0 20-24 37.412099999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.19825 38.0 38.0 38.0 36.4 38.0 30-34 37.57015 38.0 38.0 38.0 38.0 38.0 35-39 37.44199999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.52015 38.0 38.0 38.0 37.8 38.0 45-49 37.431400000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.31955 38.0 38.0 38.0 36.8 38.0 55-59 36.94545 38.0 38.0 38.0 35.6 38.0 60-64 36.718599999999995 38.0 37.8 38.0 34.4 38.0 65-69 37.1074 38.0 38.0 38.0 36.0 38.0 70-74 37.1027 38.0 38.0 38.0 36.0 38.0 75-79 37.138749999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.98965 38.0 38.0 38.0 35.4 38.0 85-89 36.95635 38.0 38.0 38.0 35.2 38.0 90-94 36.93715 38.0 38.0 38.0 35.0 38.0 95-99 36.884699999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.6267 38.0 38.0 38.0 34.0 38.0 105-109 36.669 38.0 38.0 38.0 34.4 38.0 110-114 36.413349999999994 38.0 37.6 38.0 33.8 38.0 115-119 36.31835 38.0 37.2 38.0 34.0 38.0 120-124 36.18275 38.0 37.4 38.0 33.4 38.0 125-129 35.904250000000005 38.0 36.6 38.0 32.2 38.0 130-134 35.622 38.0 36.0 38.0 31.4 38.0 135-139 35.5795 38.0 36.0 38.0 31.4 38.0 140-144 35.092499999999994 38.0 35.0 38.0 29.0 38.0 145-149 34.55325 38.0 35.0 38.0 27.0 38.0 150-151 31.000500000000002 35.5 29.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 4.0 19 1.0 20 1.0 21 1.0 22 0.0 23 6.0 24 5.0 25 2.0 26 9.0 27 18.0 28 13.0 29 20.0 30 34.0 31 53.0 32 68.0 33 114.0 34 172.0 35 343.0 36 744.0 37 2390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.876060683980455 11.056826947801492 8.614039598868604 42.45307276934945 2 20.125 13.750000000000002 36.925000000000004 29.2 3 19.85 15.15 26.474999999999998 38.525 4 23.575 23.674999999999997 23.05 29.7 5 25.05 29.349999999999998 24.3 21.3 6 23.325000000000003 34.025 22.900000000000002 19.75 7 17.125 26.424999999999997 39.675 16.775000000000002 8 20.65 25.3 29.799999999999997 24.25 9 18.575 24.05 34.675 22.7 10-14 21.54 28.555000000000003 26.93 22.975 15-19 21.32 27.075 27.32 24.285 20-24 21.2 28.139999999999997 26.584999999999997 24.075 25-29 22.335 27.62 26.450000000000003 23.595 30-34 21.97 28.03 26.43 23.57 35-39 21.865000000000002 26.955000000000002 27.015 24.165 40-44 21.445 27.655 26.979999999999997 23.919999999999998 45-49 22.38 26.674999999999997 26.77 24.175 50-54 21.818272740911137 27.589138370755613 26.83902585387808 23.75356303445517 55-59 21.6060803040152 27.946397319865994 26.50132506625331 23.946197309865493 60-64 21.281064053202662 27.336366818340917 26.88634431721586 24.496224811240563 65-69 21.85 27.125 27.065 23.96 70-74 21.315 27.3 26.71 24.675 75-79 21.52 27.245 27.245 23.990000000000002 80-84 22.105 26.650000000000002 26.66 24.585 85-89 22.005 27.305 26.889999999999997 23.799999999999997 90-94 21.97 27.029999999999998 26.724999999999998 24.275 95-99 21.54 26.955000000000002 27.38 24.125 100-104 22.066103305165257 26.601330066503326 27.13635681784089 24.196209810490522 105-109 22.096104805240262 27.211360568028404 26.89134456722836 23.801190059502975 110-114 22.63631815907954 27.063531765882942 26.43821910955478 23.861930965482742 115-119 22.28668600580174 27.7333199959988 27.2481744523357 22.73181954586376 120-124 22.025 26.51 27.375 24.09 125-129 21.740001001151324 27.7919607548681 26.230164689392804 24.23787355458778 130-134 21.65582791395698 27.168584292146075 26.503251625812908 24.67233616808404 135-139 22.009999999999998 27.145000000000003 26.565 24.279999999999998 140-144 21.959999999999997 27.05 26.634999999999998 24.355 145-149 22.400000000000002 27.150000000000002 26.634999999999998 23.815 150-151 22.1875 27.3625 25.6125 24.837500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 3.0 27 3.0 28 3.5 29 6.5 30 9.0 31 11.0 32 14.5 33 29.0 34 43.0 35 51.0 36 63.0 37 76.0 38 108.0 39 136.0 40 168.5 41 203.5 42 230.0 43 252.5 44 252.5 45 235.0 46 235.5 47 245.5 48 238.5 49 210.0 50 175.5 51 164.0 52 131.5 53 94.5 54 79.5 55 73.5 56 67.5 57 60.0 58 46.5 59 31.0 60 33.5 61 36.0 62 30.0 63 26.0 64 21.0 65 21.0 66 19.0 67 14.0 68 13.0 69 7.5 70 5.5 71 6.5 72 4.0 73 2.5 74 1.5 75 1.0 76 1.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.015 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.05 115-119 0.03 120-124 0.0 125-129 0.11499999999999999 130-134 0.05 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.1124999999999998 0.0 0.0 0.0 0.0 126-127 1.2999999999999998 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.2249999999999996 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138-139 2.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958434 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2775 34.0 33.0 34.0 33.0 34.0 2 33.34675 34.0 33.0 34.0 33.0 34.0 3 33.37075 34.0 33.0 34.0 33.0 34.0 4 33.3705 34.0 33.0 34.0 33.0 34.0 5 33.421 34.0 33.0 34.0 33.0 34.0 6 37.546 38.0 38.0 38.0 38.0 38.0 7 37.64025 38.0 38.0 38.0 38.0 38.0 8 37.5995 38.0 38.0 38.0 38.0 38.0 9 33.8505 38.0 34.0 38.0 16.0 38.0 10-14 37.27145 38.0 37.8 38.0 36.0 38.0 15-19 36.216249999999995 38.0 37.2 38.0 31.4 38.0 20-24 37.4797 38.0 38.0 38.0 37.8 38.0 25-29 37.532000000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.58285 38.0 38.0 38.0 38.0 38.0 35-39 37.57745 38.0 38.0 38.0 38.0 38.0 40-44 37.556000000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.54915 38.0 38.0 38.0 38.0 38.0 50-54 36.69445 38.0 37.8 38.0 34.0 38.0 55-59 37.4659 38.0 38.0 38.0 37.8 38.0 60-64 37.51095 38.0 38.0 38.0 38.0 38.0 65-69 37.4696 38.0 38.0 38.0 38.0 38.0 70-74 37.443349999999995 38.0 38.0 38.0 38.0 38.0 75-79 37.39815 38.0 38.0 38.0 37.4 38.0 80-84 37.3828 38.0 38.0 38.0 37.6 38.0 85-89 37.363099999999996 38.0 38.0 38.0 37.4 38.0 90-94 37.2925 38.0 38.0 38.0 37.0 38.0 95-99 37.230900000000005 38.0 38.0 38.0 37.0 38.0 100-104 35.9929 38.0 36.4 38.0 30.4 38.0 105-109 36.9711 38.0 38.0 38.0 35.8 38.0 110-114 34.403949999999995 37.6 33.6 38.0 25.0 38.0 115-119 36.772149999999996 38.0 38.0 38.0 35.0 38.0 120-124 35.30885000000001 38.0 35.4 38.0 29.0 38.0 125-129 36.6549 38.0 38.0 38.0 34.8 38.0 130-134 33.25435 37.2 31.2 38.0 21.8 38.0 135-139 34.82775 38.0 35.2 38.0 25.8 38.0 140-144 35.31275000000001 38.0 36.0 38.0 30.2 38.0 145-149 35.5163 38.0 37.4 38.0 31.0 38.0 150-151 32.064 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 0.0 16 1.0 17 4.0 18 2.0 19 2.0 20 3.0 21 1.0 22 0.0 23 5.0 24 1.0 25 13.0 26 12.0 27 15.0 28 16.0 29 20.0 30 24.0 31 31.0 32 51.0 33 74.0 34 129.0 35 270.0 36 880.0 37 2441.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.85 20.125 13.575000000000001 32.45 2 29.549999999999997 24.349999999999998 29.65 16.45 3 22.25 26.825 29.775000000000002 21.15 4 25.95 30.875000000000004 22.650000000000002 20.525 5 27.700000000000003 32.45 21.375 18.475 6 21.075 38.550000000000004 23.35 17.025000000000002 7 20.775 19.975 37.675 21.575 8 22.25 25.15 27.55 25.05 9 22.6 24.375 28.749999999999996 24.275 10-14 25.245 27.744999999999997 24.8 22.21 15-19 24.42 27.025 26.07 22.485 20-24 24.62 26.939999999999998 26.245 22.195 25-29 24.745 26.695 26.155 22.405 30-34 24.27 27.42 26.045 22.264999999999997 35-39 24.295 26.99 26.279999999999998 22.435 40-44 24.560000000000002 27.405 26.19 21.845 45-49 24.474999999999998 27.04 26.44 22.045 50-54 25.085 26.815 26.44 21.66 55-59 24.89 26.58 26.565 21.965 60-64 24.735 26.400000000000002 26.755000000000003 22.11 65-69 24.695 27.295 26.685 21.325 70-74 24.205 26.584999999999997 27.075 22.134999999999998 75-79 24.39 26.465 27.284999999999997 21.86 80-84 23.765 26.669999999999998 26.93 22.634999999999998 85-89 24.115000000000002 26.875 27.175 21.834999999999997 90-94 24.605 26.765 26.6 22.03 95-99 24.279999999999998 26.834999999999997 26.375 22.509999999999998 100-104 24.785 26.75 26.755000000000003 21.709999999999997 105-109 24.610000000000003 26.455000000000002 26.85 22.085 110-114 24.62 27.439999999999998 26.565 21.375 115-119 24.415 27.11 26.605 21.87 120-124 24.38 27.505000000000003 26.455000000000002 21.66 125-129 24.45 26.93 26.545 22.075 130-134 24.884999999999998 27.075 26.625 21.415 135-139 24.21 27.26 26.790000000000003 21.740000000000002 140-144 24.34 27.46 26.965 21.235 145-149 24.83 26.83 27.029999999999998 21.310000000000002 150-151 25.55 27.525 26.787499999999998 20.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 1.5 27 1.5 28 4.0 29 5.5 30 4.5 31 7.5 32 16.5 33 25.0 34 35.0 35 43.0 36 58.5 37 81.0 38 99.5 39 130.5 40 165.5 41 201.0 42 224.5 43 236.0 44 246.0 45 238.5 46 232.5 47 229.0 48 214.0 49 202.0 50 169.5 51 139.0 52 132.0 53 116.5 54 105.0 55 89.0 56 66.0 57 64.0 58 70.5 59 55.5 60 39.5 61 39.5 62 36.0 63 32.5 64 29.5 65 21.5 66 17.5 67 18.0 68 15.5 69 11.5 70 9.0 71 5.0 72 3.5 73 3.0 74 1.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.27631248430042704 0.5499999999999999 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.3624999999999998 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.875 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762632 spots for SRR6958434.sra Written 762632 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra Read 762625 spots for SRR6958434.sra Written 762625 spots for SRR6958434.sra SRR ids: ['SRR6958434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q8ylq0vj SRR6958434.sra spots: 15252507 blocks: [[1, 762625], [762626, 1525250], [1525251, 2287875], [2287876, 3050500], [3050501, 3813125], [3813126, 4575750], [4575751, 5338375], [5338376, 6101000], [6101001, 6863625], [6863626, 7626250], [7626251, 8388875], [8388876, 9151500], [9151501, 9914125], [9914126, 10676750], [10676751, 11439375], [11439376, 12202000], [12202001, 12964625], [12964626, 13727250], [13727251, 14489875], [14489876, 15252507]] SRR6958434 file size 5146873 SRR6958434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958434 SRR6958434_1.fastq SRR6958434_2.fastq Input file: SRR6958434_1.fastq Paired file: SRR6958434_2.fastq trimmed: SRR6958434-trimmed-pair1.fastq, SRR6958434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:02:10 2024 >> started Fri Dec 6 23:02:28 2024 >> done (18.283s) 15252507 read pairs processed; of these: 4377 ( 0.03%) short read pairs filtered out after trimming by size control 3409 ( 0.02%) empty read pairs filtered out after trimming by size control 15244721 (99.95%) read pairs available; of these: 6221106 (40.81%) trimmed read pairs available after processing 9023615 (59.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 3 0.00% 26 5 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 2 0.00% 31 6 0.00% 32 6 0.00% 33 4 0.00% 34 3 0.00% 35 9 0.00% 36 4 0.00% 37 9 0.00% 38 4 0.00% 39 4 0.00% 40 3 0.00% 41 7 0.00% 42 6 0.00% 43 2 0.00% 44 6 0.00% 45 9 0.00% 46 9 0.00% 47 7 0.00% 48 11 0.00% 49 15 0.00% 50 17 0.00% 51 8 0.00% 52 12 0.00% 53 17 0.00% 54 15 0.00% 55 22 0.00% 56 26 0.00% 57 21 0.00% 58 39 0.00% 59 35 0.00% 60 34 0.00% 61 38 0.00% 62 49 0.00% 63 47 0.00% 64 58 0.00% 65 79 0.00% 66 68 0.00% 67 93 0.00% 68 100 0.00% 69 105 0.00% 70 109 0.00% 71 128 0.00% 72 173 0.00% 73 165 0.00% 74 217 0.00% 75 195 0.00% 76 296 0.00% 77 301 0.00% 78 349 0.00% 79 367 0.00% 80 453 0.00% 81 543 0.00% 82 583 0.00% 83 681 0.00% 84 862 0.01% 85 1084 0.01% 86 1214 0.01% 87 1307 0.01% 88 1380 0.01% 89 1494 0.01% 90 1613 0.01% 91 1774 0.01% 92 1915 0.01% 93 2091 0.01% 94 2335 0.02% 95 2605 0.02% 96 2748 0.02% 97 3033 0.02% 98 3442 0.02% 99 4187 0.03% 100 4249 0.03% 101 5009 0.03% 102 4248 0.03% 103 4665 0.03% 104 5126 0.03% 105 5333 0.03% 106 5866 0.04% 107 6222 0.04% 108 6439 0.04% 109 7131 0.05% 110 7408 0.05% 111 7882 0.05% 112 8453 0.06% 113 8768 0.06% 114 9690 0.06% 115 10373 0.07% 116 10854 0.07% 117 11581 0.08% 118 12132 0.08% 119 12506 0.08% 120 13114 0.09% 121 14123 0.09% 122 14702 0.10% 123 15746 0.10% 124 16768 0.11% 125 17613 0.12% 126 18689 0.12% 127 19980 0.13% 128 21194 0.14% 129 22580 0.15% 130 24696 0.16% 131 25642 0.17% 132 27272 0.18% 133 29450 0.19% 134 31627 0.21% 135 33802 0.22% 136 36863 0.24% 137 39870 0.26% 138 42781 0.28% 139 47637 0.31% 140 51541 0.34% 141 57108 0.37% 142 65317 0.43% 143 74104 0.49% 144 88838 0.58% 145 109460 0.72% 146 141875 0.93% 147 200097 1.31% 148 322606 2.12% 149 669349 4.39% 150 3734037 24.49% 151 9023615 59.19% 15244721 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=5.26 fanout-score-rank=18 prefix-density=0.40 prefix-fanout=3.7 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=107.92 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.6 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCGCCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCAGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=24 prefix-density=0.32 prefix-fanout=3.2 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=349.94 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.7 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958434 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:03:29 Started mapping on | Dec 06 23:03:29 Finished on | Dec 06 23:04:43 Mapping speed, Million of reads per hour | 741.64 Number of input reads | 15244721 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15048944 Uniquely mapped reads % | 98.72% Average mapped length | 298.04 Number of splices: Total | 17990151 Number of splices: Annotated (sjdb) | 16978739 Number of splices: GT/AG | 17768820 Number of splices: GC/AG | 201697 Number of splices: AT/AC | 7055 Number of splices: Non-canonical | 12579 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 102878 % of reads mapped to multiple loci | 0.67% Number of reads mapped to too many loci | 6949 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.22% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 95890 95890 95890 N_multimapping 102878 102878 102878 N_noFeature 597654 14640416 729995 N_ambiguous 325408 1939 49849 UnstrandedReadsAssigned:14125882 PositiveStrandReadsAssigned:406589 NegativeStrandReadsAssigned:14269100 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958434-trimmed-pair1.fastq SRR6958434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,244,721 reads, 14,285,981 reads pseudoaligned [quant] estimated average fragment length: 244.023 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52973 SRR6958434.ke.tsv 35125 SRR6958434.se.tsv 88098 total ==> SRR6958434.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.447 0 0 PNS24247 1044 800.977 47.9901 6.71606 PNS24249 1928 1684.98 35.2216 2.34314 PNS24246 1044 800.977 47.9901 6.71606 PNS24248 1044 800.977 47.9901 6.71606 PNS24244 1471 1227.98 44.8081 4.09025 PNS24243 293 81.0472 0 0 KQK14069 1603 1359.98 2357.55 194.318 KQK14071 474 235.104 41.2532 19.6689 ==> SRR6958434.se.tsv <== BRADI_1g14170v3 2849 BRADI_1g53295v3 280 BRADI_1g59795v3 208 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 315 BRADI_1g74790v3 216 BRADI_1g09890v3 0 BRADI_1g77505v3 195 BRADI_1g48960v3 0 SRR6958434 completed mapping pipeline successfully