Starting /dee2/code/volunteer_pipeline.sh SRR6958435 current disk space = 1547801284608 free memory = 1598887528 SRR6958435 SRAfilesize dbc1dc495d1b9720463bd70d0e1680c6 SRR6958435.sra SRR6958435.sra file validated SRR6958435 is paired end SRR6958435 is conventional basespace SRR6958435 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34425 33.0 33.0 33.0 32.0 34.0 2 30.87325 32.0 31.0 33.0 27.0 34.0 3 32.09075 33.0 31.0 33.0 29.0 34.0 4 30.20975 31.0 29.0 33.0 27.0 33.0 5 32.30225 33.0 33.0 33.0 32.0 33.0 6 35.6575 37.0 35.0 38.0 31.0 38.0 7 36.23925 38.0 36.0 38.0 33.0 38.0 8 37.124 38.0 38.0 38.0 36.0 38.0 9 37.367 38.0 38.0 38.0 37.0 38.0 10-14 37.4041 38.0 38.0 38.0 37.0 38.0 15-19 37.48135 38.0 38.0 38.0 37.2 38.0 20-24 37.538599999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.487049999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.4794 38.0 38.0 38.0 37.2 38.0 35-39 37.39175 38.0 38.0 38.0 37.0 38.0 40-44 37.3871 38.0 38.0 38.0 37.0 38.0 45-49 37.37714999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.31994999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.11875 38.0 38.0 38.0 36.6 38.0 60-64 36.89195 38.0 38.0 38.0 36.0 38.0 65-69 37.15255 38.0 38.0 38.0 36.0 38.0 70-74 37.15925 38.0 38.0 38.0 36.0 38.0 75-79 37.052350000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.9129 38.0 38.0 38.0 35.4 38.0 85-89 36.84349999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.69925 38.0 38.0 38.0 34.4 38.0 95-99 36.67680000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.4988 38.0 38.0 38.0 34.0 38.0 105-109 36.378400000000006 38.0 37.8 38.0 33.6 38.0 110-114 36.195800000000006 38.0 37.4 38.0 33.4 38.0 115-119 35.964600000000004 38.0 37.2 38.0 32.6 38.0 120-124 35.75255 38.0 36.8 38.0 31.2 38.0 125-129 35.474000000000004 38.0 36.0 38.0 30.4 38.0 130-134 35.102250000000005 38.0 36.0 38.0 28.6 38.0 135-139 34.5621 38.0 35.2 38.0 27.2 38.0 140-144 34.2402 38.0 34.6 38.0 26.0 38.0 145-149 33.397000000000006 38.0 33.2 38.0 20.4 38.0 150-151 27.752250000000004 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 3.0 21 5.0 22 7.0 23 12.0 24 7.0 25 15.0 26 17.0 27 15.0 28 27.0 29 20.0 30 51.0 31 63.0 32 77.0 33 89.0 34 158.0 35 312.0 36 812.0 37 2301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.375 10.2 7.9750000000000005 32.45 2 25.3 10.225 33.475 31.0 3 20.75 15.15 28.000000000000004 36.1 4 26.924999999999997 20.150000000000002 23.575 29.349999999999998 5 28.225 25.674999999999997 23.425 22.675 6 25.1 30.075000000000003 22.025 22.8 7 18.025 24.525 38.725 18.725 8 21.4 23.400000000000002 28.775000000000002 26.424999999999997 9 22.0 22.725 31.624999999999996 23.65 10-14 23.728050427735255 25.233878633248285 25.84421431787483 25.19385662114163 15-19 23.085 23.945 26.325 26.645000000000003 20-24 23.555 24.9 25.585 25.96 25-29 23.745 25.105 25.785000000000004 25.365 30-34 23.835 24.33 26.090000000000003 25.745 35-39 24.205 24.135 25.55 26.11 40-44 24.169999999999998 23.985 26.029999999999998 25.814999999999998 45-49 23.87 24.709999999999997 25.264999999999997 26.155 50-54 24.035 24.22 25.295 26.450000000000003 55-59 24.167879913650285 24.629750489482404 25.237210703348563 25.96515889351875 60-64 24.06011258544431 24.30639324487334 25.598110172899073 26.035383996783274 65-69 24.825 24.25 25.095 25.83 70-74 24.495 24.785 24.86 25.86 75-79 24.425 24.125 25.495 25.955000000000002 80-84 23.66 24.34 25.45 26.55 85-89 23.82 24.645 25.069999999999997 26.465 90-94 24.834999999999997 24.5 24.8 25.865 95-99 24.115000000000002 24.305 25.56 26.02 100-104 24.115000000000002 24.09 25.16 26.634999999999998 105-109 24.8 24.7 25.040000000000003 25.46 110-114 24.145 24.38 25.135 26.340000000000003 115-119 24.275 24.415 24.85 26.46 120-124 24.645 23.93 24.825 26.6 125-129 24.255 24.185000000000002 25.275 26.284999999999997 130-134 24.555 24.29 24.92 26.235000000000003 135-139 24.145 24.725 24.505 26.625 140-144 25.19 24.365000000000002 25.025 25.419999999999998 145-149 24.845 24.165 24.46 26.529999999999998 150-151 24.5625 24.6625 24.7875 25.9875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 2.0 27 3.5 28 1.5 29 1.0 30 3.5 31 4.5 32 12.0 33 18.0 34 21.0 35 29.5 36 31.5 37 43.0 38 62.5 39 84.5 40 98.5 41 127.5 42 170.5 43 177.0 44 183.0 45 200.0 46 198.0 47 203.0 48 203.5 49 179.0 50 159.5 51 151.0 52 142.0 53 126.0 54 105.5 55 101.5 56 105.5 57 100.0 58 88.0 59 84.0 60 82.5 61 71.5 62 75.5 63 78.0 64 68.0 65 67.0 66 59.5 67 49.5 68 52.0 69 46.5 70 31.5 71 24.0 72 21.0 73 14.5 74 12.5 75 9.5 76 4.5 77 2.5 78 1.5 79 2.5 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.055 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.40499999999999997 60-64 0.52 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.2625 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGACTT 10 0.0066283476 146.44302 4 TCCTTTG 10 0.0068857023 144.61249 2 >>END_MODULE SRR6958435 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81375 33.0 33.0 34.0 32.0 34.0 2 32.924 33.0 33.0 34.0 32.0 34.0 3 32.94425 34.0 33.0 34.0 32.0 34.0 4 32.869 34.0 33.0 34.0 32.0 34.0 5 32.96025 34.0 33.0 34.0 32.0 34.0 6 37.161 38.0 38.0 38.0 37.0 38.0 7 37.1615 38.0 38.0 38.0 37.0 38.0 8 37.105 38.0 38.0 38.0 37.0 38.0 9 37.1115 38.0 38.0 38.0 37.0 38.0 10-14 37.10825 38.0 38.0 38.0 37.0 38.0 15-19 37.0383 38.0 38.0 38.0 36.8 38.0 20-24 36.9774 38.0 38.0 38.0 36.0 38.0 25-29 36.92985 38.0 38.0 38.0 36.0 38.0 30-34 36.9731 38.0 38.0 38.0 36.2 38.0 35-39 36.98555 38.0 38.0 38.0 36.0 38.0 40-44 36.93245 38.0 38.0 38.0 36.0 38.0 45-49 36.952149999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.867850000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.8081 38.0 38.0 38.0 35.8 38.0 60-64 36.770399999999995 38.0 38.0 38.0 35.4 38.0 65-69 36.68835 38.0 38.0 38.0 34.8 38.0 70-74 36.75345 38.0 38.0 38.0 35.0 38.0 75-79 36.6046 38.0 38.0 38.0 35.0 38.0 80-84 36.6108 38.0 38.0 38.0 34.8 38.0 85-89 36.39835 38.0 38.0 38.0 34.4 38.0 90-94 36.322950000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.2415 38.0 38.0 38.0 33.8 38.0 100-104 36.14125 38.0 38.0 38.0 33.8 38.0 105-109 36.05965 38.0 38.0 38.0 33.4 38.0 110-114 35.7402 38.0 37.4 38.0 32.0 38.0 115-119 35.6121 38.0 36.8 38.0 31.8 38.0 120-124 35.55885000000001 38.0 36.6 38.0 31.2 38.0 125-129 35.6247 38.0 36.2 38.0 32.2 38.0 130-134 35.30385 38.0 36.0 38.0 31.0 38.0 135-139 35.0903 38.0 36.0 38.0 30.0 38.0 140-144 34.5646 38.0 35.0 38.0 27.8 38.0 145-149 33.8516 38.0 34.0 38.0 24.4 38.0 150-151 29.732999999999997 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 2.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 3.0 12 2.0 13 1.0 14 2.0 15 4.0 16 3.0 17 6.0 18 2.0 19 3.0 20 4.0 21 7.0 22 12.0 23 12.0 24 7.0 25 16.0 26 22.0 27 22.0 28 27.0 29 36.0 30 50.0 31 49.0 32 56.0 33 88.0 34 128.0 35 234.0 36 591.0 37 2591.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.6 19.625 10.674999999999999 27.1 2 29.674185463659146 22.606516290726816 25.839598997493734 21.879699248120303 3 23.182957393483708 25.914786967418546 26.64160401002506 24.260651629072683 4 25.70855279658891 30.072736393278156 20.441434662653624 23.777276147479306 5 27.723516153268218 29.7771099423992 20.210368144252442 22.28900576008014 6 23.766591535186578 34.610568494866015 19.083395942900076 22.539444027047335 7 23.552994237033325 20.846905537459286 31.996993234778255 23.60310699072914 8 24.204460035078927 22.199949887246305 22.350288148333753 31.245301929341018 9 23.847695390781563 22.49498997995992 26.20240480961924 27.45490981963928 10-14 26.30154832890715 25.70526632259358 22.403166808638574 25.590018539860697 15-19 25.38083784325516 25.501102425335738 23.75726598516737 25.360793746241733 20-24 25.80709845598556 25.641668337677963 23.395829155805092 25.15540405053138 25-29 26.312095844403228 25.23434758634518 23.339515765201263 25.11404080405033 30-34 25.490097768864377 25.018801704687892 24.056154424667834 25.434946101779893 35-39 26.30497946097585 24.79210499949905 23.81023945496443 25.092676084560665 40-44 26.1137559508895 24.590328238536706 23.532949135554997 25.762966675018795 45-49 26.155772602053595 25.30428249436514 23.140495867768596 25.399449035812673 50-54 26.3516219463356 24.659591509811772 23.918702442931515 25.070084100921104 55-59 26.001803245842513 24.69445001001803 24.22360248447205 25.080144259667403 60-64 25.955613446220127 24.828415410049598 24.096989128801162 25.118982014929113 65-69 26.08957018334836 25.02755234946398 24.080753431519888 24.80212403566777 70-74 26.051893408134642 24.33880985774394 24.05329593267882 25.556000801442597 75-79 25.99719382641812 24.50891962317098 24.659250350771696 24.834636199639206 80-84 26.41537768433699 25.2390248786104 23.57210792411273 24.773489512939882 85-89 26.07389606488435 25.382997897266446 23.595674376689697 24.94743166115951 90-94 26.46366504732809 25.18154955676867 23.73416136625432 24.620624029648923 95-99 26.403847117166755 25.276762009717977 23.543555577818964 24.775835295296297 100-104 26.679020383632995 25.056342965893723 23.478739920869433 24.785896729603845 105-109 26.338458456453147 25.056342965893723 24.08974808433916 24.515450493313967 110-114 25.79514149762084 25.008765339343853 24.48785374405209 24.708239418983222 115-119 26.73113538430704 25.613788956809298 23.103517386511673 24.55155827237198 120-124 26.372966207759703 25.591989987484354 23.914893617021278 24.12015018773467 125-129 26.48605338274325 25.309229305423408 23.37623316140017 24.828484150433173 130-134 26.723059212172785 25.451724310526053 23.754942689824315 24.07027378747685 135-139 26.956783013671192 25.30422154339226 23.626621262957585 24.112374179978968 140-144 26.62493740610916 25.898848272408614 23.395092638958438 24.081121682523783 145-149 26.59222912076908 25.741037452433407 23.688163428800323 23.978569997997194 150-151 26.027054108216436 25.964428857715433 23.547094188376754 24.461422845691384 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 2.0 27 3.5 28 4.5 29 4.5 30 7.0 31 6.5 32 7.0 33 11.0 34 10.5 35 17.0 36 28.5 37 43.5 38 58.5 39 75.0 40 93.5 41 124.0 42 163.0 43 173.5 44 184.5 45 188.5 46 184.5 47 175.5 48 161.0 49 167.5 50 165.5 51 157.0 52 133.0 53 102.5 54 103.0 55 112.0 56 103.5 57 101.0 58 93.0 59 91.5 60 93.0 61 78.0 62 85.0 63 88.0 64 78.0 65 68.5 66 67.0 67 71.0 68 62.5 69 45.0 70 38.0 71 38.5 72 33.0 73 25.5 74 22.0 75 16.0 76 7.5 77 7.5 78 5.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.25 4 0.325 5 0.17500000000000002 6 0.17500000000000002 7 0.22499999999999998 8 0.22499999999999998 9 0.2 10-14 0.215 15-19 0.22 20-24 0.26 25-29 0.255 30-34 0.27499999999999997 35-39 0.19 40-44 0.22499999999999998 45-49 0.17500000000000002 50-54 0.12 55-59 0.18 60-64 0.19499999999999998 65-69 0.19 70-74 0.18 75-79 0.22 80-84 0.11499999999999999 85-89 0.13 90-94 0.165 95-99 0.185 100-104 0.165 105-109 0.165 110-114 0.17500000000000002 115-119 0.21 120-124 0.125 125-129 0.155 130-134 0.105 135-139 0.155 140-144 0.15 145-149 0.13999999999999999 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52191641182468 96.65 2 1.1722731906218145 2.3 3 0.1783893985728848 0.525 4 0.10193679918450561 0.4 5 0.025484199796126403 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.2625 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACCT 10 0.006830828 145.0 3 >>END_MODULE Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276460 spots for SRR6958435.sra Written 1276460 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra Read 1276445 spots for SRR6958435.sra Written 1276445 spots for SRR6958435.sra SRR ids: ['SRR6958435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g0bvpcpi SRR6958435.sra spots: 25528915 blocks: [[1, 1276445], [1276446, 2552890], [2552891, 3829335], [3829336, 5105780], [5105781, 6382225], [6382226, 7658670], [7658671, 8935115], [8935116, 10211560], [10211561, 11488005], [11488006, 12764450], [12764451, 14040895], [14040896, 15317340], [15317341, 16593785], [16593786, 17870230], [17870231, 19146675], [19146676, 20423120], [20423121, 21699565], [21699566, 22976010], [22976011, 24252455], [24252456, 25528915]] SRR6958435 file size 8629211 SRR6958435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958435 SRR6958435_1.fastq SRR6958435_2.fastq Input file: SRR6958435_1.fastq Paired file: SRR6958435_2.fastq trimmed: SRR6958435-trimmed-pair1.fastq, SRR6958435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:04:31 2024 >> started Fri Dec 6 23:04:57 2024 >> done (25.999s) 25528915 read pairs processed; of these: 39202 ( 0.15%) short read pairs filtered out after trimming by size control 60087 ( 0.24%) empty read pairs filtered out after trimming by size control 25429626 (99.61%) read pairs available; of these: 10717173 (42.14%) trimmed read pairs available after processing 14712453 (57.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 7 0.00% 21 10 0.00% 22 12 0.00% 23 8 0.00% 24 7 0.00% 25 12 0.00% 26 9 0.00% 27 10 0.00% 28 9 0.00% 29 13 0.00% 30 9 0.00% 31 13 0.00% 32 8 0.00% 33 12 0.00% 34 21 0.00% 35 14 0.00% 36 14 0.00% 37 15 0.00% 38 13 0.00% 39 19 0.00% 40 15 0.00% 41 18 0.00% 42 19 0.00% 43 24 0.00% 44 18 0.00% 45 26 0.00% 46 29 0.00% 47 40 0.00% 48 27 0.00% 49 46 0.00% 50 55 0.00% 51 64 0.00% 52 57 0.00% 53 62 0.00% 54 74 0.00% 55 69 0.00% 56 74 0.00% 57 95 0.00% 58 79 0.00% 59 119 0.00% 60 112 0.00% 61 143 0.00% 62 174 0.00% 63 179 0.00% 64 176 0.00% 65 190 0.00% 66 215 0.00% 67 259 0.00% 68 280 0.00% 69 319 0.00% 70 354 0.00% 71 421 0.00% 72 441 0.00% 73 532 0.00% 74 577 0.00% 75 633 0.00% 76 756 0.00% 77 873 0.00% 78 889 0.00% 79 1032 0.00% 80 1111 0.00% 81 1291 0.01% 82 1472 0.01% 83 1846 0.01% 84 3178 0.01% 85 3796 0.01% 86 4130 0.02% 87 4361 0.02% 88 4468 0.02% 89 4723 0.02% 90 4993 0.02% 91 5033 0.02% 92 5511 0.02% 93 5865 0.02% 94 6050 0.02% 95 6753 0.03% 96 6905 0.03% 97 7449 0.03% 98 7805 0.03% 99 8291 0.03% 100 8868 0.03% 101 9461 0.04% 102 10188 0.04% 103 10957 0.04% 104 11587 0.05% 105 12438 0.05% 106 13303 0.05% 107 14087 0.06% 108 14713 0.06% 109 15842 0.06% 110 16621 0.07% 111 17385 0.07% 112 18861 0.07% 113 19670 0.08% 114 21029 0.08% 115 22586 0.09% 116 23889 0.09% 117 24598 0.10% 118 25909 0.10% 119 27078 0.11% 120 28570 0.11% 121 30037 0.12% 122 31148 0.12% 123 32959 0.13% 124 34860 0.14% 125 37294 0.15% 126 38905 0.15% 127 40986 0.16% 128 42185 0.17% 129 44497 0.17% 130 46705 0.18% 131 48080 0.19% 132 52208 0.21% 133 55029 0.22% 134 58363 0.23% 135 62031 0.24% 136 65169 0.26% 137 69196 0.27% 138 73786 0.29% 139 78710 0.31% 140 84625 0.33% 141 91747 0.36% 142 102402 0.40% 143 114989 0.45% 144 133662 0.53% 145 159662 0.63% 146 198745 0.78% 147 276196 1.09% 148 439009 1.73% 149 959835 3.77% 150 6741670 26.51% 151 14712453 57.86% 25429626 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=27 prefix-density=0.67 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=46.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=3.0 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=128.87 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=4.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958435 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:05:47 Started mapping on | Dec 06 23:05:47 Finished on | Dec 06 23:07:22 Mapping speed, Million of reads per hour | 963.65 Number of input reads | 25429626 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24817938 Uniquely mapped reads % | 97.59% Average mapped length | 297.36 Number of splices: Total | 28170019 Number of splices: Annotated (sjdb) | 26435580 Number of splices: GT/AG | 27813104 Number of splices: GC/AG | 326561 Number of splices: AT/AC | 11162 Number of splices: Non-canonical | 19192 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 147341 % of reads mapped to multiple loci | 0.58% Number of reads mapped to too many loci | 9929 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 486361 486361 486361 N_multimapping 147341 147341 147341 N_noFeature 695396 24150941 869663 N_ambiguous 583689 3392 92332 UnstrandedReadsAssigned:23538853 PositiveStrandReadsAssigned:663605 NegativeStrandReadsAssigned:23855943 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958435-trimmed-pair1.fastq SRR6958435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,429,626 reads, 23,853,104 reads pseudoaligned [quant] estimated average fragment length: 266.494 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958435.ke.tsv 35125 SRR6958435.se.tsv 88098 total ==> SRR6958435.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.937 0 0 PNS24247 1044 778.506 86.1879 6.82369 PNS24249 1928 1662.51 86.7377 3.21573 PNS24246 1044 778.506 86.1879 6.82369 PNS24248 1044 778.506 86.1879 6.82369 PNS24244 1471 1205.51 19.6987 1.00717 PNS24243 293 81.591 0 0 KQK14069 1603 1337.51 5333.51 245.783 KQK14071 474 222.718 100.668 27.8595 ==> SRR6958435.se.tsv <== BRADI_1g14170v3 6082 BRADI_1g53295v3 272 BRADI_1g59795v3 254 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 481 BRADI_1g74790v3 158 BRADI_1g09890v3 0 BRADI_1g77505v3 290 BRADI_1g48960v3 0 SRR6958435 completed mapping pipeline successfully