Starting /dee2/code/volunteer_pipeline.sh SRR6958436 current disk space = 1547713024000 free memory = 1600772268 SRR6958436 SRAfilesize 0d2a9a1042c4ff75c3d97bc90dd4d83d SRR6958436.sra SRR6958436.sra file validated SRR6958436 is paired end SRR6958436 is conventional basespace SRR6958436 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7035 33.0 32.0 34.0 18.0 34.0 2 32.1185 33.0 31.0 34.0 28.0 34.0 3 32.48425 33.0 33.0 34.0 29.0 34.0 4 32.659 33.0 33.0 34.0 32.0 34.0 5 32.7605 33.0 33.0 34.0 32.0 34.0 6 36.89175 38.0 37.0 38.0 35.0 38.0 7 37.13025 38.0 38.0 38.0 36.0 38.0 8 37.28925 38.0 38.0 38.0 37.0 38.0 9 37.446 38.0 38.0 38.0 37.0 38.0 10-14 37.478750000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.411699999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.460550000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.353699999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.283550000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.1009 38.0 38.0 38.0 36.0 38.0 40-44 37.055499999999995 38.0 38.0 38.0 36.0 38.0 45-49 37.1808 38.0 38.0 38.0 36.4 38.0 50-54 37.00750000000001 38.0 38.0 38.0 35.8 38.0 55-59 36.777550000000005 38.0 38.0 38.0 34.6 38.0 60-64 36.8775 38.0 38.0 38.0 35.0 38.0 65-69 37.01475000000001 38.0 38.0 38.0 35.6 38.0 70-74 37.0479 38.0 38.0 38.0 35.8 38.0 75-79 36.8452 38.0 38.0 38.0 35.0 38.0 80-84 36.52775 38.0 38.0 38.0 33.8 38.0 85-89 36.5334 38.0 37.8 38.0 33.8 38.0 90-94 36.57385 38.0 38.0 38.0 34.0 38.0 95-99 36.52695000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.28475 38.0 37.2 38.0 33.6 38.0 105-109 36.174699999999994 38.0 37.0 38.0 33.0 38.0 110-114 36.016000000000005 38.0 37.0 38.0 32.6 38.0 115-119 35.86905 38.0 36.6 38.0 32.2 38.0 120-124 35.54905 38.0 36.0 38.0 30.6 38.0 125-129 35.2509 38.0 35.6 38.0 28.6 38.0 130-134 35.185700000000004 38.0 35.0 38.0 28.8 38.0 135-139 34.79925 38.0 35.0 38.0 27.8 38.0 140-144 34.50515 38.0 35.0 38.0 26.4 38.0 145-149 33.6218 38.0 34.2 38.0 21.2 38.0 150-151 29.434875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 2.0 21 3.0 22 1.0 23 5.0 24 10.0 25 15.0 26 10.0 27 22.0 28 30.0 29 45.0 30 44.0 31 74.0 32 104.0 33 137.0 34 182.0 35 314.0 36 822.0 37 2177.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.6401028277635 9.3573264781491 7.480719794344473 43.52185089974293 2 20.7 12.85 37.55 28.9 3 18.975 14.099999999999998 25.525 41.4 4 25.424999999999997 23.474999999999998 21.95 29.15 5 27.875 27.725 23.575 20.825 6 22.675 32.625 21.95 22.75 7 18.65 25.45 36.95 18.95 8 20.45 24.7 29.225 25.624999999999996 9 20.0 21.75 33.7 24.55 10-14 23.28 25.674999999999997 26.245 24.8 15-19 23.165 24.515 26.25 26.07 20-24 22.814999999999998 25.314999999999998 26.640000000000004 25.230000000000004 25-29 23.355 25.185000000000002 25.8 25.66 30-34 23.169999999999998 25.34 25.945 25.545 35-39 23.935000000000002 25.174999999999997 25.665 25.224999999999998 40-44 22.89 24.805 26.255 26.05 45-49 23.025000000000002 24.97 26.07 25.935000000000002 50-54 23.255 25.195 26.0 25.55 55-59 22.935 24.92 26.41 25.735000000000003 60-64 23.36 24.595 25.965 26.08 65-69 23.119999999999997 25.105 25.95 25.825 70-74 23.7 25.480000000000004 25.85 24.97 75-79 23.47 25.25 26.08 25.2 80-84 22.805 25.124999999999996 25.555 26.515 85-89 24.395 24.855 25.825 24.925 90-94 23.244999999999997 24.5 26.275 25.979999999999997 95-99 23.335 24.474999999999998 25.995 26.195 100-104 24.18 24.33 26.245 25.245 105-109 23.599999999999998 25.119999999999997 25.365 25.915 110-114 23.135 24.93 26.400000000000002 25.535000000000004 115-119 23.515 24.79 25.919999999999998 25.775 120-124 23.84 25.009999999999998 25.555 25.595000000000002 125-129 24.279999999999998 25.130000000000003 25.665 24.925 130-134 23.9 25.005 25.03 26.064999999999998 135-139 23.65 24.665 25.36 26.325 140-144 23.69 24.55 25.855 25.905 145-149 24.05 24.81 25.45 25.69 150-151 23.76547068383548 24.79059882485311 25.19064883110389 26.253281660207527 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 3.5 28 3.0 29 2.5 30 5.0 31 10.0 32 16.5 33 16.5 34 20.0 35 27.0 36 40.0 37 59.5 38 81.5 39 108.0 40 131.0 41 159.0 42 169.0 43 175.5 44 194.0 45 201.0 46 203.0 47 205.0 48 193.5 49 179.0 50 167.5 51 147.0 52 140.5 53 138.5 54 114.5 55 97.0 56 94.5 57 94.0 58 89.5 59 84.0 60 79.0 61 71.0 62 68.0 63 64.5 64 57.5 65 51.5 66 50.0 67 45.5 68 37.5 69 24.5 70 13.5 71 12.5 72 13.0 73 11.0 74 8.0 75 5.0 76 5.0 77 4.5 78 1.0 79 1.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26896899420217 98.45 2 0.6301991429291656 1.25 3 0.10083186286866651 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8500000000000001 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.9125 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958436 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94775 33.0 33.0 34.0 32.0 34.0 2 32.9265 34.0 33.0 34.0 32.0 34.0 3 32.96175 34.0 33.0 34.0 32.0 34.0 4 33.00425 34.0 33.0 34.0 32.0 34.0 5 32.90675 34.0 33.0 34.0 32.0 34.0 6 37.0605 38.0 38.0 38.0 36.0 38.0 7 36.91 38.0 38.0 38.0 36.0 38.0 8 37.028 38.0 38.0 38.0 36.0 38.0 9 36.972 38.0 38.0 38.0 36.0 38.0 10-14 36.987649999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.92495 38.0 38.0 38.0 35.8 38.0 20-24 36.97155 38.0 38.0 38.0 36.0 38.0 25-29 37.04235 38.0 38.0 38.0 36.0 38.0 30-34 37.073249999999994 38.0 38.0 38.0 36.2 38.0 35-39 37.06 38.0 38.0 38.0 36.2 38.0 40-44 36.922850000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.9077 38.0 38.0 38.0 35.8 38.0 50-54 36.85895000000001 38.0 38.0 38.0 35.2 38.0 55-59 36.884299999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.8219 38.0 38.0 38.0 35.4 38.0 65-69 36.747299999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.597750000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.3893 38.0 38.0 38.0 33.8 38.0 80-84 36.35195 38.0 38.0 38.0 33.8 38.0 85-89 36.1683 38.0 38.0 38.0 33.4 38.0 90-94 36.14595 38.0 37.8 38.0 33.2 38.0 95-99 36.0116 38.0 37.2 38.0 32.8 38.0 100-104 35.9222 38.0 37.0 38.0 32.6 38.0 105-109 35.67445 38.0 36.8 38.0 30.6 38.0 110-114 35.428399999999996 38.0 36.0 38.0 29.6 38.0 115-119 35.213499999999996 38.0 36.0 38.0 28.2 38.0 120-124 35.113800000000005 38.0 35.8 38.0 28.2 38.0 125-129 35.00255 38.0 35.6 38.0 28.4 38.0 130-134 34.637 38.0 35.0 38.0 26.2 38.0 135-139 34.0932 38.0 34.2 38.0 23.2 38.0 140-144 33.977850000000004 38.0 34.4 38.0 23.6 38.0 145-149 33.13745 38.0 33.6 38.0 18.8 38.0 150-151 27.886000000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 3.0 15 0.0 16 1.0 17 8.0 18 2.0 19 3.0 20 8.0 21 6.0 22 9.0 23 13.0 24 16.0 25 20.0 26 22.0 27 31.0 28 34.0 29 41.0 30 66.0 31 76.0 32 101.0 33 140.0 34 191.0 35 300.0 36 705.0 37 2193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.375 17.9 10.75 36.975 2 29.2 23.95 27.525 19.325 3 21.630407601900476 26.806701675418854 27.231807951987996 24.33108277069267 4 25.93148287071768 30.857714428607153 20.155038759689923 23.055763940985248 5 28.307076769192296 31.282820705176295 20.655163790947736 19.754938734683673 6 23.7 36.15 20.575 19.575 7 23.075000000000003 19.125 35.05 22.75 8 23.325000000000003 21.95 25.6 29.125 9 23.325000000000003 22.900000000000002 27.650000000000002 26.125 10-14 25.45 26.345000000000002 22.939999999999998 25.264999999999997 15-19 24.87 25.674999999999997 24.415 25.040000000000003 20-24 25.545 25.56 24.585 24.310000000000002 25-29 25.855 25.314999999999998 24.285 24.545 30-34 25.415 25.874999999999996 24.14 24.57 35-39 25.695 25.955000000000002 24.224999999999998 24.125 40-44 25.785000000000004 25.564999999999998 24.315 24.335 45-49 25.674999999999997 25.47 24.46 24.395 50-54 25.424999999999997 25.795 24.05 24.73 55-59 26.06 25.305 24.43 24.205 60-64 25.88 24.75 24.565 24.805 65-69 25.545 25.605 24.67 24.18 70-74 25.430000000000003 25.025 24.645 24.9 75-79 25.55 25.369999999999997 24.525 24.555 80-84 26.640000000000004 25.885 23.96 23.515 85-89 26.040000000000003 25.495 24.37 24.095 90-94 26.08 24.91 24.759999999999998 24.25 95-99 25.935000000000002 25.874999999999996 24.32 23.87 100-104 25.595000000000002 25.264999999999997 24.5 24.64 105-109 25.56 25.77 24.63 24.04 110-114 25.97 26.21 24.685000000000002 23.135 115-119 26.11 25.72 24.21 23.96 120-124 25.86 26.33 23.990000000000002 23.82 125-129 25.974999999999998 26.215 24.305 23.505000000000003 130-134 26.064999999999998 25.35 24.69 23.895 135-139 26.19 26.02 24.315 23.474999999999998 140-144 26.36 26.085 24.26 23.294999999999998 145-149 26.450000000000003 26.055 23.974999999999998 23.52 150-151 26.20327540942618 26.16577072134017 24.440555069383674 23.19039879984998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 2.0 27 1.0 28 1.0 29 1.5 30 2.5 31 6.0 32 10.0 33 16.0 34 23.0 35 30.5 36 44.0 37 62.0 38 70.0 39 85.5 40 115.0 41 138.5 42 167.0 43 182.0 44 180.5 45 182.5 46 178.5 47 183.0 48 185.0 49 172.5 50 167.5 51 153.5 52 139.5 53 127.5 54 109.0 55 103.0 56 103.0 57 105.5 58 94.5 59 86.0 60 91.5 61 87.0 62 75.0 63 65.5 64 68.0 65 63.5 66 50.0 67 45.0 68 43.0 69 43.5 70 41.0 71 30.5 72 18.0 73 17.0 74 14.5 75 5.5 76 3.5 77 2.0 78 1.5 79 1.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88438133874239 97.5 2 0.9127789046653144 1.7999999999999998 3 0.12677484787018256 0.375 4 0.05070993914807302 0.2 5 0.02535496957403651 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0125 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.025 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.0625 0.0 0.0 0.0 0.025 96-97 0.1 0.0 0.0 0.0 0.025 98-99 0.1 0.0 0.0 0.0 0.025 100-101 0.1 0.0 0.0 0.0 0.025 102-103 0.1 0.0 0.0 0.0 0.025 104-105 0.125 0.0 0.0 0.0 0.025 106-107 0.16249999999999998 0.0 0.0 0.0 0.025 108-109 0.325 0.0 0.0 0.0 0.025 110-111 0.4125 0.0 0.0 0.0 0.025 112-113 0.475 0.0 0.0 0.0 0.025 114-115 0.6125 0.0 0.0 0.0 0.025 116-117 0.7 0.0 0.0 0.0 0.025 118-119 0.875 0.0 0.0 0.0 0.025 120-121 1.1125 0.0 0.0 0.0 0.025 122-123 1.25 0.0 0.0 0.0 0.025 124-125 1.4 0.0 0.0 0.0 0.025 126-127 1.4625 0.0 0.0 0.0 0.025 128-129 1.5625 0.0 0.0 0.0 0.025 130-131 1.65 0.0 0.0 0.0 0.025 132-133 1.7875 0.0 0.0 0.0 0.025 134-135 1.9125 0.0 0.0 0.0 0.025 136-137 2.0875 0.0 0.0 0.0 0.025 138-139 2.3125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTACC 10 0.006830828 145.0 6 CCAGCAG 10 0.006830828 145.0 145 >>END_MODULE Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225056 spots for SRR6958436.sra Written 1225056 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra Read 1225050 spots for SRR6958436.sra Written 1225050 spots for SRR6958436.sra SRR ids: ['SRR6958436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4t0n11s9 SRR6958436.sra spots: 24501006 blocks: [[1, 1225050], [1225051, 2450100], [2450101, 3675150], [3675151, 4900200], [4900201, 6125250], [6125251, 7350300], [7350301, 8575350], [8575351, 9800400], [9800401, 11025450], [11025451, 12250500], [12250501, 13475550], [13475551, 14700600], [14700601, 15925650], [15925651, 17150700], [17150701, 18375750], [18375751, 19600800], [19600801, 20825850], [20825851, 22050900], [22050901, 23275950], [23275951, 24501006]] SRR6958436 file size 8280886 SRR6958436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958436 SRR6958436_1.fastq SRR6958436_2.fastq Input file: SRR6958436_1.fastq Paired file: SRR6958436_2.fastq trimmed: SRR6958436-trimmed-pair1.fastq, SRR6958436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:04:20 2024 >> started Fri Dec 6 23:04:47 2024 >> done (26.738s) 24501006 read pairs processed; of these: 14049 ( 0.06%) short read pairs filtered out after trimming by size control 10009 ( 0.04%) empty read pairs filtered out after trimming by size control 24476948 (99.90%) read pairs available; of these: 8799574 (35.95%) trimmed read pairs available after processing 15677374 (64.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 6 0.00% 22 5 0.00% 23 6 0.00% 24 9 0.00% 25 7 0.00% 26 6 0.00% 27 4 0.00% 28 5 0.00% 29 10 0.00% 30 7 0.00% 31 6 0.00% 32 4 0.00% 33 14 0.00% 34 8 0.00% 35 15 0.00% 36 13 0.00% 37 11 0.00% 38 10 0.00% 39 14 0.00% 40 15 0.00% 41 16 0.00% 42 17 0.00% 43 21 0.00% 44 22 0.00% 45 21 0.00% 46 17 0.00% 47 27 0.00% 48 26 0.00% 49 37 0.00% 50 43 0.00% 51 38 0.00% 52 32 0.00% 53 52 0.00% 54 51 0.00% 55 78 0.00% 56 78 0.00% 57 81 0.00% 58 78 0.00% 59 91 0.00% 60 103 0.00% 61 106 0.00% 62 118 0.00% 63 150 0.00% 64 160 0.00% 65 168 0.00% 66 196 0.00% 67 201 0.00% 68 247 0.00% 69 255 0.00% 70 304 0.00% 71 312 0.00% 72 410 0.00% 73 458 0.00% 74 479 0.00% 75 529 0.00% 76 600 0.00% 77 694 0.00% 78 728 0.00% 79 884 0.00% 80 988 0.00% 81 1055 0.00% 82 1292 0.01% 83 1410 0.01% 84 2173 0.01% 85 2731 0.01% 86 2891 0.01% 87 3113 0.01% 88 3156 0.01% 89 3316 0.01% 90 3444 0.01% 91 3763 0.02% 92 4024 0.02% 93 4395 0.02% 94 4753 0.02% 95 5102 0.02% 96 5356 0.02% 97 5863 0.02% 98 6146 0.03% 99 6590 0.03% 100 7130 0.03% 101 7754 0.03% 102 8053 0.03% 103 8983 0.04% 104 9266 0.04% 105 9863 0.04% 106 10782 0.04% 107 11344 0.05% 108 11839 0.05% 109 12501 0.05% 110 13462 0.05% 111 14409 0.06% 112 15400 0.06% 113 16080 0.07% 114 16874 0.07% 115 18153 0.07% 116 19054 0.08% 117 20259 0.08% 118 21314 0.09% 119 22210 0.09% 120 23350 0.10% 121 24668 0.10% 122 25749 0.11% 123 27015 0.11% 124 28848 0.12% 125 30068 0.12% 126 31724 0.13% 127 33786 0.14% 128 35438 0.14% 129 37317 0.15% 130 39332 0.16% 131 41766 0.17% 132 44539 0.18% 133 47820 0.20% 134 50099 0.20% 135 53115 0.22% 136 56946 0.23% 137 60561 0.25% 138 64860 0.26% 139 70808 0.29% 140 76383 0.31% 141 83724 0.34% 142 93842 0.38% 143 106457 0.43% 144 123253 0.50% 145 152148 0.62% 146 188930 0.77% 147 261561 1.07% 148 407634 1.67% 149 853872 3.49% 150 5269557 21.53% 151 15677374 64.05% 24476948 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=24 prefix-density=0.93 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=58.41 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=24 prefix-density=0.66 prefix-fanout=2.3 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=443.03 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=18.3 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958436 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:05:57 Started mapping on | Dec 06 23:05:57 Finished on | Dec 06 23:07:29 Mapping speed, Million of reads per hour | 957.79 Number of input reads | 24476948 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 24145482 Uniquely mapped reads % | 98.65% Average mapped length | 297.99 Number of splices: Total | 28569965 Number of splices: Annotated (sjdb) | 26944666 Number of splices: GT/AG | 28206098 Number of splices: GC/AG | 333961 Number of splices: AT/AC | 10743 Number of splices: Non-canonical | 19163 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 141809 % of reads mapped to multiple loci | 0.58% Number of reads mapped to too many loci | 12937 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 198748 198748 198748 N_multimapping 141809 141809 141809 N_noFeature 729610 23465419 907579 N_ambiguous 594220 3115 93763 UnstrandedReadsAssigned:22821652 PositiveStrandReadsAssigned:676948 NegativeStrandReadsAssigned:23144140 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958436-trimmed-pair1.fastq SRR6958436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,476,948 reads, 23,154,307 reads pseudoaligned [quant] estimated average fragment length: 273.111 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR6958436.ke.tsv 35125 SRR6958436.se.tsv 88098 total ==> SRR6958436.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.373 0 0 PNS24247 1044 771.889 63.3441 5.274 PNS24249 1928 1655.89 37.9861 1.47429 PNS24246 1044 771.889 63.3441 5.274 PNS24248 1044 771.889 63.3441 5.274 PNS24244 1471 1198.89 41.9817 2.25045 PNS24243 293 77.6463 0 0 KQK14069 1603 1330.89 7782.78 375.822 KQK14071 474 216.718 86.0224 25.5097 ==> SRR6958436.se.tsv <== BRADI_1g14170v3 8619 BRADI_1g53295v3 284 BRADI_1g59795v3 233 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 306 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 249 BRADI_1g48960v3 0 SRR6958436 completed mapping pipeline successfully