Starting /dee2/code/volunteer_pipeline.sh SRR6958437 current disk space = 1547612991488 free memory = 1601803040 SRR6958437 SRAfilesize b8d10171d505faabdae8b711e333f487 SRR6958437.sra SRR6958437.sra file validated SRR6958437 is paired end SRR6958437 is conventional basespace SRR6958437 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.64275 33.0 32.0 34.0 18.0 34.0 2 32.0575 33.0 31.0 34.0 28.0 34.0 3 32.4615 33.0 33.0 34.0 29.0 34.0 4 32.3695 33.0 33.0 34.0 31.0 34.0 5 32.65625 33.0 33.0 34.0 32.0 34.0 6 36.84575 38.0 37.0 38.0 35.0 38.0 7 37.04725 38.0 38.0 38.0 36.0 38.0 8 37.148 38.0 38.0 38.0 36.0 38.0 9 37.4095 38.0 38.0 38.0 37.0 38.0 10-14 37.378949999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.3532 38.0 38.0 38.0 37.0 38.0 20-24 37.4353 38.0 38.0 38.0 37.0 38.0 25-29 37.3343 38.0 38.0 38.0 37.0 38.0 30-34 37.2464 38.0 38.0 38.0 36.8 38.0 35-39 37.0741 38.0 38.0 38.0 36.0 38.0 40-44 37.04655 38.0 38.0 38.0 36.0 38.0 45-49 37.107600000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.9673 38.0 38.0 38.0 35.4 38.0 55-59 36.811600000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.80865 38.0 38.0 38.0 34.8 38.0 65-69 37.06435 38.0 38.0 38.0 36.0 38.0 70-74 37.00015 38.0 38.0 38.0 35.4 38.0 75-79 36.771950000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.510549999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.4141 38.0 37.8 38.0 33.6 38.0 90-94 36.4991 38.0 38.0 38.0 34.0 38.0 95-99 36.45375 38.0 37.6 38.0 33.8 38.0 100-104 36.2706 38.0 37.2 38.0 33.4 38.0 105-109 36.00175 38.0 37.0 38.0 32.4 38.0 110-114 35.8991 38.0 36.8 38.0 32.0 38.0 115-119 35.83015 38.0 36.2 38.0 31.6 38.0 120-124 35.53225 38.0 36.0 38.0 31.0 38.0 125-129 35.295 38.0 35.8 38.0 28.6 38.0 130-134 35.133050000000004 38.0 35.0 38.0 28.4 38.0 135-139 34.747299999999996 38.0 35.0 38.0 27.6 38.0 140-144 34.4397 38.0 34.6 38.0 25.6 38.0 145-149 33.432 38.0 34.0 38.0 20.4 38.0 150-151 29.310000000000002 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 2.0 20 1.0 21 1.0 22 4.0 23 4.0 24 5.0 25 13.0 26 17.0 27 20.0 28 37.0 29 38.0 30 52.0 31 93.0 32 105.0 33 122.0 34 216.0 35 336.0 36 799.0 37 2132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.23668639053255 9.21018780550553 7.1777720607152045 43.37535374324672 2 20.65 11.975 38.375 28.999999999999996 3 18.85 14.399999999999999 26.200000000000003 40.550000000000004 4 24.85 22.400000000000002 21.925 30.825000000000003 5 26.674999999999997 28.499999999999996 23.175 21.65 6 24.3 31.825 22.15 21.725 7 18.15 24.275 37.175000000000004 20.4 8 20.7 24.425 29.15 25.724999999999998 9 19.2 21.0 34.975 24.825 10-14 22.220000000000002 26.224999999999998 26.384999999999998 25.169999999999998 15-19 22.58 25.115 26.35 25.955000000000002 20-24 22.845 24.7 26.665 25.790000000000003 25-29 22.56 25.740000000000002 25.990000000000002 25.71 30-34 23.330000000000002 25.06 26.224999999999998 25.385 35-39 22.915 25.11 26.14 25.835 40-44 22.62 26.33 25.755 25.295 45-49 23.27 25.525 25.83 25.374999999999996 50-54 23.05 25.465 26.3 25.185000000000002 55-59 23.385 25.069999999999997 25.97 25.575 60-64 23.22 25.31 25.745 25.724999999999998 65-69 22.85 24.965 26.534999999999997 25.650000000000002 70-74 23.075000000000003 25.205 25.895000000000003 25.825 75-79 23.195 25.05 26.375 25.380000000000003 80-84 23.36 25.245 25.679999999999996 25.715 85-89 23.419999999999998 25.775 24.86 25.945 90-94 23.005 25.165 26.0 25.83 95-99 23.105 25.064999999999998 26.185000000000002 25.645 100-104 23.599999999999998 25.319999999999997 25.585 25.495 105-109 23.566178308915443 24.586229311465573 26.151307565378268 25.696284814240713 110-114 23.405 25.145 25.935000000000002 25.515 115-119 23.09 25.330000000000002 25.905 25.674999999999997 120-124 23.3 25.605 25.115 25.979999999999997 125-129 23.02 25.515 25.905 25.56 130-134 23.715 25.485000000000003 25.215 25.585 135-139 23.41 25.3 25.5 25.790000000000003 140-144 23.535 25.27 25.755 25.44 145-149 23.915 25.180000000000003 25.130000000000003 25.775 150-151 23.50587646911728 25.268817204301076 25.568892223055762 25.656414103525883 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 3.0 28 4.0 29 2.5 30 1.5 31 6.0 32 15.5 33 16.0 34 18.0 35 35.5 36 45.5 37 56.0 38 72.0 39 97.0 40 127.5 41 144.5 42 166.5 43 186.5 44 205.0 45 222.5 46 229.5 47 223.5 48 216.5 49 196.0 50 160.5 51 150.5 52 148.0 53 122.0 54 103.5 55 109.5 56 105.0 57 91.0 58 81.5 59 78.5 60 72.0 61 64.5 62 55.0 63 48.5 64 52.5 65 46.5 66 36.5 67 37.5 68 33.5 69 25.0 70 20.0 71 14.0 72 12.0 73 13.5 74 9.0 75 3.5 76 4.0 77 4.5 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.025 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.025 0.0 0.0 0.0 0.025 90-91 0.025 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.07500000000000001 0.0 0.0 0.0 0.025 96-97 0.175 0.0 0.0 0.0 0.025 98-99 0.2 0.0 0.0 0.0 0.025 100-101 0.25 0.0 0.0 0.0 0.025 102-103 0.2625 0.0 0.0 0.0 0.025 104-105 0.3125 0.0 0.0 0.0 0.025 106-107 0.4125 0.0 0.0 0.0 0.025 108-109 0.5375000000000001 0.0 0.0 0.0 0.025 110-111 0.6125 0.0 0.0 0.0 0.025 112-113 0.6875 0.0 0.0 0.0 0.025 114-115 0.7625 0.0 0.0 0.0 0.025 116-117 0.8500000000000001 0.0 0.0 0.0 0.025 118-119 1.0 0.0 0.0 0.0 0.025 120-121 1.2125 0.0 0.0 0.0 0.025 122-123 1.3624999999999998 0.0 0.0 0.0 0.025 124-125 1.4875 0.0 0.0 0.0 0.025 126-127 1.6 0.0 0.0 0.0 0.025 128-129 1.8 0.0 0.0 0.0 0.025 130-131 1.9874999999999998 0.0 0.0 0.0 0.025 132-133 2.175 0.0 0.0 0.0 0.025 134-135 2.4625 0.0 0.0 0.0 0.025 136-137 2.625 0.0 0.0 0.0 0.025 138-139 2.9625000000000004 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGCAT 10 0.006832588 144.9875 145 >>END_MODULE SRR6958437 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958437_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93325 33.0 33.0 34.0 32.0 34.0 2 32.9005 33.0 33.0 34.0 32.0 34.0 3 32.89275 34.0 33.0 34.0 32.0 34.0 4 32.91125 34.0 33.0 34.0 32.0 34.0 5 32.80025 34.0 33.0 34.0 32.0 34.0 6 37.0665 38.0 38.0 38.0 36.0 38.0 7 36.94675 38.0 38.0 38.0 36.0 38.0 8 36.964 38.0 38.0 38.0 36.0 38.0 9 37.02375 38.0 38.0 38.0 36.0 38.0 10-14 36.924099999999996 38.0 38.0 38.0 35.4 38.0 15-19 36.8519 38.0 38.0 38.0 35.6 38.0 20-24 36.9509 38.0 38.0 38.0 36.0 38.0 25-29 37.0236 38.0 38.0 38.0 36.0 38.0 30-34 37.061249999999994 38.0 38.0 38.0 36.0 38.0 35-39 37.027499999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.9371 38.0 38.0 38.0 36.0 38.0 45-49 36.808350000000004 38.0 38.0 38.0 35.4 38.0 50-54 36.70890000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.8294 38.0 38.0 38.0 35.2 38.0 60-64 36.7539 38.0 38.0 38.0 35.2 38.0 65-69 36.624199999999995 38.0 38.0 38.0 34.4 38.0 70-74 36.5138 38.0 38.0 38.0 34.2 38.0 75-79 36.2438 38.0 38.0 38.0 33.4 38.0 80-84 36.19235 38.0 38.0 38.0 33.6 38.0 85-89 36.07885 38.0 37.6 38.0 33.0 38.0 90-94 36.09140000000001 38.0 37.8 38.0 33.0 38.0 95-99 35.9207 38.0 37.0 38.0 32.2 38.0 100-104 35.675749999999994 38.0 36.6 38.0 31.6 38.0 105-109 35.5667 38.0 36.8 38.0 30.4 38.0 110-114 35.290099999999995 38.0 36.0 38.0 29.4 38.0 115-119 35.127300000000005 38.0 35.8 38.0 28.4 38.0 120-124 35.1151 38.0 35.6 38.0 28.8 38.0 125-129 34.889799999999994 38.0 35.0 38.0 27.8 38.0 130-134 34.4328 38.0 34.8 38.0 25.0 38.0 135-139 33.8972 38.0 34.0 38.0 22.2 38.0 140-144 33.687599999999996 38.0 34.2 38.0 20.6 38.0 145-149 32.74475 38.0 33.4 38.0 15.0 38.0 150-151 27.596125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 0.0 6 3.0 7 1.0 8 0.0 9 0.0 10 2.0 11 3.0 12 2.0 13 1.0 14 1.0 15 2.0 16 3.0 17 2.0 18 6.0 19 6.0 20 6.0 21 9.0 22 7.0 23 7.0 24 18.0 25 13.0 26 22.0 27 31.0 28 49.0 29 41.0 30 70.0 31 79.0 32 103.0 33 164.0 34 200.0 35 327.0 36 711.0 37 2106.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.449999999999996 17.575 10.45 37.525 2 27.250000000000004 24.5 28.1 20.150000000000002 3 21.635817908954476 25.78789394697349 28.864432216108053 23.71185592796398 4 24.937468734367183 30.740370185092548 20.985492746373186 23.336668334167083 5 27.33866933466733 32.716358179089546 20.410205102551277 19.534767383691847 6 22.125 35.199999999999996 21.099999999999998 21.575 7 23.425 19.400000000000002 35.65 21.525 8 24.85 22.05 26.375 26.724999999999998 9 24.275 22.6 27.775 25.35 10-14 25.569999999999997 26.6 23.419999999999998 24.41 15-19 25.869999999999997 25.77 24.4 23.96 20-24 25.669999999999998 25.775 23.885 24.67 25-29 25.869999999999997 25.83 24.335 23.965 30-34 25.0 25.705 25.180000000000003 24.115000000000002 35-39 25.11 26.155 24.43 24.305 40-44 25.77 25.335 24.555 24.34 45-49 25.765 26.235000000000003 24.425 23.575 50-54 25.96 25.924999999999997 24.54 23.575 55-59 26.075 25.795 24.66 23.47 60-64 25.465 25.95 24.88 23.705000000000002 65-69 26.5 25.5 24.14 23.86 70-74 25.745 25.35 24.740000000000002 24.165 75-79 26.1 25.535000000000004 25.074999999999996 23.29 80-84 25.790000000000003 25.645 24.72 23.845 85-89 25.840000000000003 25.585 24.84 23.735 90-94 25.615 25.82 25.34 23.225 95-99 25.47 26.095000000000002 24.91 23.525 100-104 26.155 25.095 25.09 23.66 105-109 25.869999999999997 25.355 24.84 23.935000000000002 110-114 25.885 26.715 24.415 22.985 115-119 25.956297814890743 26.21131056552828 24.48122406120306 23.35116755837792 120-124 26.02 26.279999999999998 24.445 23.255 125-129 25.869999999999997 25.52 24.935 23.674999999999997 130-134 26.38 25.52 24.33 23.77 135-139 26.13 26.19 24.69 22.99 140-144 26.11 26.384999999999998 24.755 22.75 145-149 26.779999999999998 26.255 24.215 22.75 150-151 26.19732399649869 26.897586594973117 23.858947105164436 23.046142303363762 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 4.0 27 4.5 28 3.5 29 4.0 30 6.0 31 10.0 32 12.5 33 14.5 34 16.5 35 27.5 36 36.5 37 48.5 38 70.5 39 93.5 40 121.0 41 143.5 42 170.0 43 187.5 44 197.0 45 214.5 46 201.5 47 190.0 48 194.0 49 191.0 50 179.5 51 146.0 52 135.5 53 127.5 54 100.0 55 92.0 56 90.0 57 89.0 58 97.0 59 95.0 60 82.0 61 74.0 62 70.5 63 70.0 64 66.5 65 51.5 66 43.5 67 44.0 68 39.5 69 35.5 70 29.0 71 17.5 72 16.5 73 16.5 74 12.5 75 9.0 76 2.5 77 1.5 78 1.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7063572149344097 1.4000000000000001 3 0.10090817356205853 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.5999999999999996 0.0 0.0 0.0 0.0 138-139 2.9124999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110399 spots for SRR6958437.sra Written 1110399 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra Read 1110395 spots for SRR6958437.sra Written 1110395 spots for SRR6958437.sra SRR ids: ['SRR6958437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hjk8cdas SRR6958437.sra spots: 22207904 blocks: [[1, 1110395], [1110396, 2220790], [2220791, 3331185], [3331186, 4441580], [4441581, 5551975], [5551976, 6662370], [6662371, 7772765], [7772766, 8883160], [8883161, 9993555], [9993556, 11103950], [11103951, 12214345], [12214346, 13324740], [13324741, 14435135], [14435136, 15545530], [15545531, 16655925], [16655926, 17766320], [17766321, 18876715], [18876716, 19987110], [19987111, 21097505], [21097506, 22207904]] SRR6958437 file size 7503829 SRR6958437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958437 SRR6958437_1.fastq SRR6958437_2.fastq Input file: SRR6958437_1.fastq Paired file: SRR6958437_2.fastq trimmed: SRR6958437-trimmed-pair1.fastq, SRR6958437-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:04:02 2024 >> started Fri Dec 6 23:04:30 2024 >> done (27.587s) 22207904 read pairs processed; of these: 13869 ( 0.06%) short read pairs filtered out after trimming by size control 11727 ( 0.05%) empty read pairs filtered out after trimming by size control 22182308 (99.88%) read pairs available; of these: 8145845 (36.72%) trimmed read pairs available after processing 14036463 (63.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 11 0.00% 22 6 0.00% 23 11 0.00% 24 4 0.00% 25 5 0.00% 26 6 0.00% 27 7 0.00% 28 6 0.00% 29 6 0.00% 30 6 0.00% 31 4 0.00% 32 9 0.00% 33 5 0.00% 34 11 0.00% 35 9 0.00% 36 8 0.00% 37 3 0.00% 38 10 0.00% 39 6 0.00% 40 13 0.00% 41 10 0.00% 42 21 0.00% 43 13 0.00% 44 25 0.00% 45 14 0.00% 46 27 0.00% 47 26 0.00% 48 34 0.00% 49 22 0.00% 50 28 0.00% 51 41 0.00% 52 45 0.00% 53 53 0.00% 54 49 0.00% 55 72 0.00% 56 55 0.00% 57 72 0.00% 58 79 0.00% 59 94 0.00% 60 107 0.00% 61 118 0.00% 62 145 0.00% 63 153 0.00% 64 172 0.00% 65 195 0.00% 66 181 0.00% 67 244 0.00% 68 237 0.00% 69 309 0.00% 70 362 0.00% 71 400 0.00% 72 431 0.00% 73 488 0.00% 74 595 0.00% 75 649 0.00% 76 674 0.00% 77 825 0.00% 78 882 0.00% 79 1007 0.00% 80 1107 0.00% 81 1227 0.01% 82 1458 0.01% 83 1647 0.01% 84 2452 0.01% 85 3024 0.01% 86 3153 0.01% 87 3347 0.02% 88 3717 0.02% 89 3787 0.02% 90 3960 0.02% 91 4148 0.02% 92 4455 0.02% 93 4766 0.02% 94 5319 0.02% 95 5590 0.03% 96 5925 0.03% 97 6442 0.03% 98 6870 0.03% 99 7169 0.03% 100 7809 0.04% 101 8117 0.04% 102 8668 0.04% 103 9334 0.04% 104 9877 0.04% 105 10201 0.05% 106 11019 0.05% 107 11963 0.05% 108 12282 0.06% 109 13218 0.06% 110 13592 0.06% 111 14590 0.07% 112 15448 0.07% 113 16231 0.07% 114 16993 0.08% 115 18402 0.08% 116 19434 0.09% 117 19961 0.09% 118 21469 0.10% 119 21829 0.10% 120 23304 0.11% 121 24330 0.11% 122 25342 0.11% 123 26447 0.12% 124 28275 0.13% 125 29876 0.13% 126 30936 0.14% 127 32677 0.15% 128 34309 0.15% 129 35847 0.16% 130 37956 0.17% 131 39960 0.18% 132 42349 0.19% 133 45278 0.20% 134 47588 0.21% 135 50341 0.23% 136 53624 0.24% 137 57459 0.26% 138 61252 0.28% 139 67075 0.30% 140 72021 0.32% 141 78502 0.35% 142 88268 0.40% 143 99473 0.45% 144 115519 0.52% 145 141782 0.64% 146 176387 0.80% 147 241852 1.09% 148 379304 1.71% 149 793908 3.58% 150 4795501 21.62% 151 14036463 63.28% 22182308 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=27 prefix-density=0.93 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=36.44 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=16 prefix-density=0.59 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=54.63 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958437 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:05:58 Started mapping on | Dec 06 23:05:59 Finished on | Dec 06 23:07:50 Mapping speed, Million of reads per hour | 719.43 Number of input reads | 22182308 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21744125 Uniquely mapped reads % | 98.02% Average mapped length | 297.69 Number of splices: Total | 25781911 Number of splices: Annotated (sjdb) | 24302451 Number of splices: GT/AG | 25450870 Number of splices: GC/AG | 303413 Number of splices: AT/AC | 9513 Number of splices: Non-canonical | 18115 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 130923 % of reads mapped to multiple loci | 0.59% Number of reads mapped to too many loci | 17456 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.82% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 316019 316019 316019 N_multimapping 130923 130923 130923 N_noFeature 684466 21122813 850327 N_ambiguous 537117 2713 82990 UnstrandedReadsAssigned:20522542 PositiveStrandReadsAssigned:618599 NegativeStrandReadsAssigned:20810808 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958437 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958437-trimmed-pair1.fastq SRR6958437-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,182,308 reads, 20,823,412 reads pseudoaligned [quant] estimated average fragment length: 272.032 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR6958437.ke.tsv 35125 SRR6958437.se.tsv 88098 total ==> SRR6958437.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.444 0 0 PNS24247 1044 772.968 67.8652 6.35035 PNS24249 1928 1656.97 50.5453 2.20637 PNS24246 1044 772.968 67.8652 6.35035 PNS24248 1044 772.968 67.8652 6.35035 PNS24244 1471 1199.97 19.859 1.19702 PNS24243 293 79.4498 0 0 KQK14069 1603 1331.97 8066.84 438.048 KQK14071 474 218.687 106.121 35.0985 ==> SRR6958437.se.tsv <== BRADI_1g14170v3 8919 BRADI_1g53295v3 221 BRADI_1g59795v3 178 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 234 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 210 BRADI_1g48960v3 0 SRR6958437 completed mapping pipeline successfully