Starting /dee2/code/volunteer_pipeline.sh SRR6958438 current disk space = 1547920896000 free memory = 1600256708 SRR6958438 SRAfilesize 285c8a501d9e0a3e02bd1558bbe36208 SRR6958438.sra SRR6958438.sra file validated SRR6958438 is paired end SRR6958438 is conventional basespace SRR6958438 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.938 31.0 18.0 33.0 18.0 34.0 2 29.52525 30.0 27.0 33.0 25.0 34.0 3 31.6825 33.0 31.0 33.0 29.0 34.0 4 32.34575 33.0 33.0 33.0 31.0 34.0 5 32.66125 33.0 33.0 34.0 31.0 34.0 6 36.0475 37.0 36.0 38.0 33.0 38.0 7 36.8965 38.0 37.0 38.0 35.0 38.0 8 37.184 38.0 38.0 38.0 36.0 38.0 9 37.0395 38.0 38.0 38.0 36.0 38.0 10-14 37.032650000000004 38.0 38.0 38.0 35.8 38.0 15-19 37.245850000000004 38.0 38.0 38.0 36.2 38.0 20-24 37.36514999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.501599999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.56335 38.0 38.0 38.0 37.8 38.0 35-39 37.52105 38.0 38.0 38.0 37.6 38.0 40-44 37.578700000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.32825 38.0 38.0 38.0 36.8 38.0 50-54 37.36725 38.0 38.0 38.0 37.0 38.0 55-59 37.08995 38.0 38.0 38.0 35.8 38.0 60-64 37.17755 38.0 38.0 38.0 36.2 38.0 65-69 37.17695 38.0 38.0 38.0 36.0 38.0 70-74 36.64475 38.0 37.8 38.0 34.4 38.0 75-79 37.02255 38.0 38.0 38.0 35.8 38.0 80-84 37.0937 38.0 38.0 38.0 36.0 38.0 85-89 37.01215 38.0 38.0 38.0 35.2 38.0 90-94 36.9456 38.0 38.0 38.0 35.0 38.0 95-99 36.8329 38.0 38.0 38.0 35.0 38.0 100-104 36.71679999999999 38.0 38.0 38.0 34.4 38.0 105-109 36.543699999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.3633 38.0 37.2 38.0 33.8 38.0 115-119 36.1897 38.0 37.4 38.0 33.2 38.0 120-124 36.0323 38.0 36.8 38.0 32.6 38.0 125-129 35.9873 38.0 36.8 38.0 33.2 38.0 130-134 35.7463 38.0 36.2 38.0 31.4 38.0 135-139 35.4358 38.0 36.0 38.0 31.0 38.0 140-144 35.09415 38.0 35.6 38.0 29.6 38.0 145-149 34.28795 38.0 35.0 38.0 26.2 38.0 150-151 30.31675 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 3.0 23 2.0 24 5.0 25 8.0 26 6.0 27 13.0 28 19.0 29 23.0 30 28.0 31 63.0 32 77.0 33 107.0 34 173.0 35 336.0 36 867.0 37 2266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.98074974670719 13.323201621073963 8.409321175278622 41.28672745694023 2 20.525 13.900000000000002 38.15 27.425 3 21.080270067516878 17.72943235808952 25.03125781445361 36.159039759939986 4 24.0 25.324999999999996 23.35 27.325 5 24.575 32.225 23.65 19.55 6 22.7 34.0 23.05 20.25 7 15.8 27.05 39.225 17.925 8 20.1 24.275 32.1 23.525 9 19.825 22.725 33.975 23.474999999999998 10-14 21.73 28.384999999999998 26.75 23.135 15-19 21.78 27.27 26.974999999999998 23.974999999999998 20-24 21.58 27.905 26.834999999999997 23.68 25-29 21.78 27.805000000000003 27.139999999999997 23.275000000000002 30-34 21.310000000000002 27.555000000000003 27.405 23.73 35-39 21.375 27.295 27.3 24.03 40-44 21.67 27.875 27.125 23.330000000000002 45-49 21.185000000000002 27.765 26.845000000000002 24.205 50-54 21.654999999999998 27.675 26.985 23.685000000000002 55-59 21.39 27.465 27.310000000000002 23.835 60-64 21.83 27.139999999999997 27.034999999999997 23.995 65-69 21.685 27.334999999999997 26.91 24.07 70-74 21.98 27.125 26.740000000000002 24.154999999999998 75-79 22.065 26.93 27.034999999999997 23.97 80-84 21.68 27.54 26.529999999999998 24.25 85-89 22.17 27.075 26.810000000000002 23.945 90-94 22.08 27.500000000000004 27.005000000000003 23.415 95-99 21.935 27.12 26.66 24.285 100-104 22.365591397849464 27.021755438859714 26.376594148537137 24.23605901475369 105-109 21.98 27.395000000000003 27.265 23.36 110-114 22.534013605442176 28.48139255702281 26.630652260904363 22.35394157663065 115-119 22.71544389950956 28.155339805825243 26.38374537083375 22.745470923831448 120-124 21.915000000000003 27.08 26.91 24.095 125-129 21.766561514195583 26.808872865655196 27.024185068349105 24.40038055180011 130-134 22.177197458602233 26.96483065686127 26.78973435389464 24.068237530641852 135-139 22.415 26.745 26.72 24.12 140-144 21.72 26.875 26.715 24.69 145-149 22.175 26.35 27.08 24.395 150-151 21.725 26.4625 26.237500000000004 25.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 2.0 27 4.5 28 3.5 29 3.5 30 6.0 31 9.5 32 19.0 33 32.5 34 43.5 35 53.5 36 71.5 37 97.5 38 120.0 39 142.5 40 179.5 41 208.5 42 226.5 43 251.5 44 270.5 45 262.0 46 246.5 47 233.0 48 209.5 49 176.5 50 158.5 51 144.5 52 112.0 53 97.5 54 90.0 55 76.5 56 68.5 57 57.5 58 48.5 59 40.0 60 38.5 61 36.0 62 22.5 63 19.0 64 16.0 65 13.0 66 14.0 67 12.0 68 11.5 69 13.5 70 9.0 71 7.0 72 6.0 73 2.5 74 3.5 75 3.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.04 115-119 0.09 120-124 0.0 125-129 0.145 130-134 0.055 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3250000000000002 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.6749999999999998 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.6 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.25 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958438 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25425 33.0 33.0 34.0 33.0 34.0 2 33.33925 34.0 33.0 34.0 33.0 34.0 3 33.392 34.0 33.0 34.0 33.0 34.0 4 33.26925 34.0 33.0 34.0 33.0 34.0 5 33.40275 34.0 33.0 34.0 33.0 34.0 6 37.598 38.0 38.0 38.0 38.0 38.0 7 37.58175 38.0 38.0 38.0 38.0 38.0 8 37.542 38.0 38.0 38.0 38.0 38.0 9 37.56625 38.0 38.0 38.0 38.0 38.0 10-14 36.94925 38.0 37.8 38.0 35.2 38.0 15-19 37.4354 38.0 38.0 38.0 37.6 38.0 20-24 37.5355 38.0 38.0 38.0 38.0 38.0 25-29 37.535450000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.58945000000001 38.0 38.0 38.0 38.0 38.0 35-39 36.894650000000006 38.0 38.0 38.0 35.6 38.0 40-44 37.52194999999999 38.0 38.0 38.0 37.8 38.0 45-49 37.260000000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.06505 38.0 38.0 38.0 35.8 38.0 55-59 36.6764 38.0 37.6 38.0 33.8 38.0 60-64 37.50315 38.0 38.0 38.0 38.0 38.0 65-69 37.16785 38.0 38.0 38.0 36.8 38.0 70-74 37.418350000000004 38.0 38.0 38.0 37.4 38.0 75-79 37.074099999999994 38.0 38.0 38.0 36.2 38.0 80-84 37.4124 38.0 38.0 38.0 37.6 38.0 85-89 37.3993 38.0 38.0 38.0 37.6 38.0 90-94 37.28015 38.0 38.0 38.0 37.0 38.0 95-99 37.2485 38.0 38.0 38.0 36.8 38.0 100-104 36.432500000000005 38.0 37.4 38.0 32.8 38.0 105-109 36.23715 38.0 37.4 38.0 31.6 38.0 110-114 36.848 38.0 38.0 38.0 35.0 38.0 115-119 37.0406 38.0 38.0 38.0 36.0 38.0 120-124 36.80875 38.0 38.0 38.0 35.4 38.0 125-129 36.6768 38.0 38.0 38.0 35.0 38.0 130-134 36.5068 38.0 38.0 38.0 34.4 38.0 135-139 36.1754 38.0 38.0 38.0 33.8 38.0 140-144 35.472350000000006 38.0 36.4 38.0 31.8 38.0 145-149 35.07195 38.0 36.2 38.0 31.0 38.0 150-151 30.13725 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 3.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 1.0 21 0.0 22 0.0 23 3.0 24 9.0 25 7.0 26 4.0 27 6.0 28 12.0 29 18.0 30 19.0 31 29.0 32 47.0 33 70.0 34 124.0 35 202.0 36 594.0 37 2840.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 18.65 12.45 32.4 2 29.099999999999998 24.9 29.175 16.825000000000003 3 21.9 26.775 29.049999999999997 22.275 4 25.7 31.924999999999997 22.55 19.825 5 26.35 33.75 21.9 18.0 6 22.05 37.4 21.224999999999998 19.325 7 22.400000000000002 20.599999999999998 37.1 19.900000000000002 8 22.675 23.799999999999997 27.775 25.75 9 22.525000000000002 23.1 28.975 25.4 10-14 24.89 27.57 24.95 22.59 15-19 24.785 26.405 26.395000000000003 22.415 20-24 24.834999999999997 27.525 25.635 22.005 25-29 24.779999999999998 27.07 26.305 21.845 30-34 24.55 27.1 26.32 22.03 35-39 24.675 27.77 26.075 21.48 40-44 24.595 27.529999999999998 25.6 22.275 45-49 25.09 27.235 25.814999999999998 21.86 50-54 24.485 27.21 26.33 21.975 55-59 24.32 27.025 26.125 22.53 60-64 25.22 27.105 25.825 21.85 65-69 23.905 26.810000000000002 26.825 22.46 70-74 23.895 26.6 26.99 22.515 75-79 24.13 26.669999999999998 27.12 22.08 80-84 24.135 27.27 26.615 21.98 85-89 24.0 26.955000000000002 26.945000000000004 22.1 90-94 23.66 27.284999999999997 27.295 21.759999999999998 95-99 24.035 27.005000000000003 27.18 21.78 100-104 24.64 26.93 26.625 21.805 105-109 23.755000000000003 27.310000000000002 26.945000000000004 21.990000000000002 110-114 24.404999999999998 27.305 26.71 21.58 115-119 24.125 27.584999999999997 26.415 21.875 120-124 24.34 27.12 26.55 21.990000000000002 125-129 24.88 26.52 26.96 21.64 130-134 24.81 27.435 26.450000000000003 21.305 135-139 24.3 27.400000000000002 26.86 21.44 140-144 25.064999999999998 27.195000000000004 26.784999999999997 20.955 145-149 25.230000000000004 27.1 26.584999999999997 21.085 150-151 24.9375 27.3 26.8 20.962500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.5 27 2.0 28 3.5 29 5.0 30 8.5 31 13.0 32 16.5 33 24.0 34 37.0 35 50.5 36 67.5 37 92.5 38 107.0 39 125.0 40 165.0 41 190.5 42 210.0 43 235.5 44 249.5 45 254.5 46 238.5 47 215.0 48 207.5 49 194.5 50 164.5 51 144.0 52 125.5 53 102.5 54 91.0 55 86.5 56 76.5 57 70.5 58 62.5 59 52.0 60 46.0 61 37.0 62 30.5 63 34.0 64 35.0 65 23.5 66 20.0 67 20.5 68 15.5 69 11.5 70 10.5 71 7.5 72 5.0 73 4.0 74 3.0 75 1.5 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.35175879396984927 0.7000000000000001 3 0.0 0.0 4 0.05025125628140704 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.0250000000000004 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.275 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.6125 0.0 0.0 0.0 0.0 136-137 5.112500000000001 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564236 spots for SRR6958438.sra Written 564236 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra Read 564226 spots for SRR6958438.sra Written 564226 spots for SRR6958438.sra SRR ids: ['SRR6958438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_42n2kw6m SRR6958438.sra spots: 11284530 blocks: [[1, 564226], [564227, 1128452], [1128453, 1692678], [1692679, 2256904], [2256905, 2821130], [2821131, 3385356], [3385357, 3949582], [3949583, 4513808], [4513809, 5078034], [5078035, 5642260], [5642261, 6206486], [6206487, 6770712], [6770713, 7334938], [7334939, 7899164], [7899165, 8463390], [8463391, 9027616], [9027617, 9591842], [9591843, 10156068], [10156069, 10720294], [10720295, 11284530]] SRR6958438 file size 3802256 SRR6958438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958438 SRR6958438_1.fastq SRR6958438_2.fastq Input file: SRR6958438_1.fastq Paired file: SRR6958438_2.fastq trimmed: SRR6958438-trimmed-pair1.fastq, SRR6958438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:05:40 2024 >> started Fri Dec 6 23:05:51 2024 >> done (10.977s) 11284530 read pairs processed; of these: 5602 ( 0.05%) short read pairs filtered out after trimming by size control 3313 ( 0.03%) empty read pairs filtered out after trimming by size control 11275615 (99.92%) read pairs available; of these: 3924505 (34.81%) trimmed read pairs available after processing 7351110 (65.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 4 0.00% 28 7 0.00% 29 1 0.00% 30 4 0.00% 31 3 0.00% 32 0 0.00% 33 5 0.00% 34 5 0.00% 35 5 0.00% 36 3 0.00% 37 3 0.00% 38 4 0.00% 39 7 0.00% 40 5 0.00% 41 2 0.00% 42 14 0.00% 43 6 0.00% 44 9 0.00% 45 9 0.00% 46 5 0.00% 47 9 0.00% 48 11 0.00% 49 13 0.00% 50 10 0.00% 51 18 0.00% 52 16 0.00% 53 25 0.00% 54 18 0.00% 55 20 0.00% 56 33 0.00% 57 28 0.00% 58 33 0.00% 59 38 0.00% 60 51 0.00% 61 51 0.00% 62 50 0.00% 63 67 0.00% 64 85 0.00% 65 80 0.00% 66 96 0.00% 67 136 0.00% 68 111 0.00% 69 126 0.00% 70 146 0.00% 71 189 0.00% 72 201 0.00% 73 260 0.00% 74 280 0.00% 75 313 0.00% 76 320 0.00% 77 348 0.00% 78 425 0.00% 79 470 0.00% 80 513 0.00% 81 594 0.01% 82 741 0.01% 83 798 0.01% 84 1066 0.01% 85 1284 0.01% 86 1374 0.01% 87 1560 0.01% 88 1640 0.01% 89 1681 0.01% 90 1891 0.02% 91 2173 0.02% 92 2318 0.02% 93 2419 0.02% 94 2828 0.03% 95 2902 0.03% 96 3162 0.03% 97 3388 0.03% 98 3566 0.03% 99 3940 0.03% 100 4207 0.04% 101 4481 0.04% 102 4845 0.04% 103 4987 0.04% 104 5418 0.05% 105 5774 0.05% 106 6304 0.06% 107 6609 0.06% 108 7120 0.06% 109 7215 0.06% 110 7512 0.07% 111 8142 0.07% 112 8450 0.07% 113 9046 0.08% 114 9668 0.09% 115 10429 0.09% 116 10725 0.10% 117 11073 0.10% 118 11254 0.10% 119 11728 0.10% 120 12346 0.11% 121 13021 0.12% 122 13717 0.12% 123 14503 0.13% 124 15329 0.14% 125 15612 0.14% 126 16451 0.15% 127 17361 0.15% 128 18104 0.16% 129 18913 0.17% 130 19696 0.17% 131 20521 0.18% 132 22078 0.20% 133 23060 0.20% 134 24209 0.21% 135 25651 0.23% 136 27356 0.24% 137 28567 0.25% 138 30235 0.27% 139 32740 0.29% 140 35289 0.31% 141 37829 0.34% 142 41788 0.37% 143 46851 0.42% 144 53785 0.48% 145 64250 0.57% 146 80183 0.71% 147 108834 0.97% 148 168600 1.50% 149 355343 3.15% 150 2323264 20.60% 151 7351110 65.19% 11275615 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=21 prefix-density=0.81 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=65.92 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.5 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=84.88 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.5 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958438 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:06:41 Started mapping on | Dec 06 23:06:41 Finished on | Dec 06 23:07:46 Mapping speed, Million of reads per hour | 624.50 Number of input reads | 11275615 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10910535 Uniquely mapped reads % | 96.76% Average mapped length | 297.68 Number of splices: Total | 12945040 Number of splices: Annotated (sjdb) | 12203238 Number of splices: GT/AG | 12782487 Number of splices: GC/AG | 148427 Number of splices: AT/AC | 4790 Number of splices: Non-canonical | 9336 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 121163 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 18814 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 1.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 246281 246281 246281 N_multimapping 121163 121163 121163 N_noFeature 443908 10599504 540620 N_ambiguous 254406 1444 40616 UnstrandedReadsAssigned:10212221 PositiveStrandReadsAssigned:309587 NegativeStrandReadsAssigned:10329299 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958438-trimmed-pair1.fastq SRR6958438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,275,615 reads, 10,367,062 reads pseudoaligned [quant] estimated average fragment length: 235.928 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR6958438.ke.tsv 35125 SRR6958438.se.tsv 88098 total ==> SRR6958438.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 701.452 2.09822e-08 4.43831e-09 PNS24247 1044 809.072 31.3326 5.7461 PNS24249 1928 1693.07 15.814 1.3859 PNS24246 1044 809.072 31.3326 5.7461 PNS24248 1044 809.072 31.3326 5.7461 PNS24244 1471 1236.07 6.18823 0.742825 PNS24243 293 85.4467 0 0 KQK14069 1603 1368.07 2974.89 322.646 KQK14071 474 242.923 32.3997 19.7896 ==> SRR6958438.se.tsv <== BRADI_1g14170v3 3328 BRADI_1g53295v3 142 BRADI_1g59795v3 94 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 150 BRADI_1g74790v3 58 BRADI_1g09890v3 0 BRADI_1g77505v3 130 BRADI_1g48960v3 0 SRR6958438 completed mapping pipeline successfully