Starting /dee2/code/volunteer_pipeline.sh SRR6958439 current disk space = 1547862646784 free memory = 1476568048 SRR6958439 SRAfilesize 7fdea3bbf61973f10d1775efd6bbe649 SRR6958439.sra SRR6958439.sra file validated SRR6958439 is paired end SRR6958439 is conventional basespace SRR6958439 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.64375 18.0 18.0 18.0 2.0 25.0 2 27.6965 27.0 27.0 30.0 25.0 31.0 3 29.20175 29.0 27.0 31.0 25.0 33.0 4 31.54775 33.0 31.0 33.0 29.0 33.0 5 32.73575 33.0 33.0 33.0 32.0 33.0 6 36.50525 38.0 37.0 38.0 34.0 38.0 7 37.3805 38.0 38.0 38.0 37.0 38.0 8 37.1755 38.0 38.0 38.0 36.0 38.0 9 37.57675 38.0 38.0 38.0 37.0 38.0 10-14 37.5786 38.0 38.0 38.0 38.0 38.0 15-19 37.5758 38.0 38.0 38.0 38.0 38.0 20-24 37.51255 38.0 38.0 38.0 37.8 38.0 25-29 37.440999999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.092 38.0 38.0 38.0 36.4 38.0 35-39 37.5998 38.0 38.0 38.0 38.0 38.0 40-44 37.488350000000004 38.0 38.0 38.0 37.6 38.0 45-49 37.45125 38.0 38.0 38.0 37.4 38.0 50-54 37.18405 38.0 38.0 38.0 36.8 38.0 55-59 37.324850000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.477500000000006 38.0 38.0 38.0 37.4 38.0 65-69 37.234049999999996 38.0 38.0 38.0 36.6 38.0 70-74 36.0735 38.0 35.8 38.0 30.6 38.0 75-79 37.19475 38.0 38.0 38.0 36.2 38.0 80-84 37.26925 38.0 38.0 38.0 36.8 38.0 85-89 36.08215 38.0 36.8 38.0 30.2 38.0 90-94 34.2161 38.0 34.0 38.0 21.8 38.0 95-99 35.88365 38.0 37.0 38.0 31.2 38.0 100-104 35.80505 38.0 37.2 38.0 29.8 38.0 105-109 35.83805 38.0 36.8 38.0 31.2 38.0 110-114 35.995 38.0 37.6 38.0 32.6 38.0 115-119 36.48655 38.0 38.0 38.0 34.0 38.0 120-124 36.6104 38.0 38.0 38.0 34.2 38.0 125-129 36.4619 38.0 38.0 38.0 34.0 38.0 130-134 36.49185000000001 38.0 38.0 38.0 34.2 38.0 135-139 36.2355 38.0 37.8 38.0 33.4 38.0 140-144 35.4917 38.0 36.0 38.0 31.2 38.0 145-149 34.79344999999999 38.0 35.6 38.0 30.0 38.0 150-151 30.895249999999997 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 3.0 21 1.0 22 0.0 23 3.0 24 2.0 25 12.0 26 11.0 27 14.0 28 29.0 29 33.0 30 50.0 31 50.0 32 74.0 33 94.0 34 182.0 35 363.0 36 918.0 37 2158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.51083238312429 8.865450399087798 25.883694412770808 38.740022805017105 2 25.2 13.200000000000001 35.35 26.25 3 23.05 17.275 24.675 35.0 4 27.175 24.625 23.05 25.15 5 24.0 29.225 25.15 21.625 6 21.349999999999998 32.025 24.325 22.3 7 16.7 24.65 40.0 18.65 8 19.75 24.6 28.95 26.700000000000003 9 19.025 21.975 33.475 25.525 10-14 22.45 26.91 25.945 24.695 15-19 22.55 25.759999999999998 26.605 25.085 20-24 22.541127056352817 25.601280064003202 26.336316815840792 25.52127606380319 25-29 22.49612480624031 26.48632431621581 25.91629581479074 25.101255062753136 30-34 22.535 25.635 26.375 25.455 35-39 22.431121556077805 25.691284564228212 26.531326566328318 25.346267313365665 40-44 22.736136806840342 26.131306565328266 25.976298814940748 25.156257812890644 45-49 22.065 25.779999999999998 26.85 25.305 50-54 22.825 25.485000000000003 26.495 25.195 55-59 22.596129806490325 25.66628331416571 26.306315315765787 25.43127156357818 60-64 22.535 25.61 26.355 25.5 65-69 23.085 25.535000000000004 25.985000000000003 25.395 70-74 22.95 26.005 25.985000000000003 25.06 75-79 23.185 25.88 25.869999999999997 25.064999999999998 80-84 22.68 25.595000000000002 26.369999999999997 25.355 85-89 23.46 25.41 25.935000000000002 25.195 90-94 22.99 25.8 26.040000000000003 25.169999999999998 95-99 22.66 25.685000000000002 26.700000000000003 24.955 100-104 23.435 25.355 26.195 25.014999999999997 105-109 23.1 25.480000000000004 25.564999999999998 25.855 110-114 23.375 25.290000000000003 26.200000000000003 25.135 115-119 22.655 25.645 26.484999999999996 25.215 120-124 23.1 25.580000000000002 25.765 25.555 125-129 23.685000000000002 25.5 25.715 25.1 130-134 23.315 25.36 26.115 25.21 135-139 23.29 25.71 25.255 25.745 140-144 23.21 25.380000000000003 25.96 25.45 145-149 23.66 25.905 25.66 24.775 150-151 24.099999999999998 25.4875 24.65 25.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.0 27 2.5 28 2.5 29 6.0 30 11.0 31 15.5 32 15.5 33 18.0 34 29.0 35 46.0 36 57.0 37 71.5 38 105.0 39 130.5 40 150.5 41 163.5 42 187.5 43 212.0 44 217.5 45 215.5 46 194.5 47 191.0 48 204.5 49 206.0 50 165.0 51 130.5 52 128.5 53 114.0 54 105.5 55 96.0 56 94.0 57 84.5 58 64.5 59 64.0 60 68.0 61 67.0 62 59.5 63 47.0 64 36.5 65 32.5 66 34.5 67 33.0 68 26.5 69 25.0 70 22.5 71 15.0 72 10.5 73 7.0 74 4.0 75 2.0 76 1.0 77 2.0 78 1.5 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.005 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 1.9249999999999998 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.6624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATTG 10 0.0068519996 144.85 145 >>END_MODULE SRR6958439 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958439_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80825 33.0 33.0 34.0 32.0 34.0 2 33.152 34.0 33.0 34.0 33.0 34.0 3 33.1045 34.0 33.0 34.0 33.0 34.0 4 33.1745 34.0 33.0 34.0 33.0 34.0 5 33.1085 34.0 33.0 34.0 33.0 34.0 6 37.3425 38.0 38.0 38.0 37.0 38.0 7 37.325 38.0 38.0 38.0 37.0 38.0 8 37.36225 38.0 38.0 38.0 38.0 38.0 9 37.18875 38.0 38.0 38.0 37.0 38.0 10-14 37.1654 38.0 38.0 38.0 37.0 38.0 15-19 37.08195 38.0 38.0 38.0 36.8 38.0 20-24 36.828050000000005 38.0 38.0 38.0 35.8 38.0 25-29 36.939750000000004 38.0 38.0 38.0 36.0 38.0 30-34 37.19975 38.0 38.0 38.0 37.0 38.0 35-39 37.119899999999994 38.0 38.0 38.0 36.6 38.0 40-44 36.07745 38.0 36.0 38.0 32.0 38.0 45-49 36.812 38.0 37.6 38.0 34.8 38.0 50-54 37.11395 38.0 38.0 38.0 36.6 38.0 55-59 37.0653 38.0 38.0 38.0 36.8 38.0 60-64 35.712900000000005 38.0 35.6 38.0 30.6 38.0 65-69 35.562650000000005 38.0 35.6 38.0 30.8 38.0 70-74 34.553749999999994 37.6 33.6 38.0 27.4 38.0 75-79 36.4268 38.0 38.0 38.0 34.2 38.0 80-84 36.3574 38.0 38.0 38.0 34.0 38.0 85-89 36.331450000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.68125 38.0 38.0 38.0 35.2 38.0 95-99 36.7729 38.0 38.0 38.0 35.0 38.0 100-104 36.70545 38.0 38.0 38.0 35.0 38.0 105-109 36.53935 38.0 38.0 38.0 35.0 38.0 110-114 36.424549999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.17495 38.0 38.0 38.0 33.8 38.0 120-124 35.53555 38.0 37.0 38.0 30.4 38.0 125-129 35.557249999999996 38.0 36.6 38.0 30.6 38.0 130-134 35.925599999999996 38.0 37.6 38.0 33.0 38.0 135-139 35.564150000000005 38.0 36.6 38.0 31.0 38.0 140-144 35.4561 38.0 36.0 38.0 31.0 38.0 145-149 35.20715 38.0 36.0 38.0 30.4 38.0 150-151 29.95275 35.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 0.0 5 1.0 6 0.0 7 0.0 8 3.0 9 0.0 10 1.0 11 5.0 12 1.0 13 2.0 14 3.0 15 0.0 16 1.0 17 2.0 18 3.0 19 1.0 20 4.0 21 4.0 22 5.0 23 8.0 24 6.0 25 14.0 26 17.0 27 28.0 28 34.0 29 32.0 30 57.0 31 55.0 32 61.0 33 107.0 34 143.0 35 248.0 36 659.0 37 2487.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.050000000000004 17.875 11.125 31.95 2 28.925 24.6 28.375 18.099999999999998 3 23.05 24.474999999999998 29.299999999999997 23.175 4 25.525 30.55 21.45 22.475 5 27.500000000000004 33.725 19.625 19.15 6 23.375 35.425000000000004 20.925 20.275000000000002 7 21.65 19.75 34.75 23.849999999999998 8 23.799999999999997 24.8 23.625 27.775 9 22.375 23.825 27.625 26.174999999999997 10-14 24.98 26.735 23.7 24.585 15-19 25.230000000000004 26.095000000000002 24.21 24.465 20-24 25.535000000000004 25.75 25.195 23.52 25-29 25.724999999999998 25.665 24.695 23.915 30-34 25.61 26.195 24.375 23.82 35-39 25.34 26.029999999999998 24.9 23.73 40-44 25.624999999999996 25.380000000000003 25.495 23.5 45-49 25.27 25.7 25.085 23.945 50-54 25.380000000000003 26.150000000000002 25.169999999999998 23.3 55-59 25.945 25.385 25.069999999999997 23.599999999999998 60-64 25.705 25.14 25.025 24.13 65-69 25.66 25.825 25.025 23.49 70-74 25.47 25.765 25.14 23.625 75-79 25.435000000000002 26.384999999999998 25.124999999999996 23.055 80-84 25.259999999999998 25.645 25.080000000000002 24.015 85-89 26.445 25.455 24.625 23.474999999999998 90-94 25.4 25.81 25.374999999999996 23.415 95-99 25.19 26.105 25.855 22.85 100-104 25.424999999999997 25.755 25.2 23.62 105-109 25.045 26.625 24.81 23.52 110-114 25.645 26.51 24.884999999999998 22.96 115-119 25.615 26.295 24.81 23.28 120-124 25.745 26.08 25.34 22.835 125-129 25.555 26.165 25.16 23.119999999999997 130-134 25.735000000000003 26.064999999999998 25.11 23.09 135-139 25.52 26.605 25.09 22.785 140-144 25.82 26.325 25.55 22.305 145-149 25.990000000000002 26.305 25.319999999999997 22.384999999999998 150-151 26.337500000000002 26.625 24.45 22.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.0 26 1.0 27 2.0 28 4.0 29 4.0 30 7.0 31 14.0 32 18.0 33 24.0 34 26.0 35 32.5 36 47.5 37 62.0 38 74.0 39 96.5 40 129.5 41 154.0 42 173.5 43 183.5 44 192.5 45 196.5 46 195.5 47 206.0 48 198.5 49 173.5 50 173.5 51 162.5 52 142.0 53 124.0 54 101.0 55 94.5 56 87.5 57 81.5 58 73.0 59 69.5 60 73.5 61 73.0 62 67.0 63 58.5 64 55.5 65 50.5 66 49.5 67 51.5 68 42.0 69 33.0 70 26.5 71 24.5 72 24.0 73 14.5 74 9.0 75 8.0 76 4.5 77 1.5 78 0.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59788891681328 99.075 2 0.3267152550892184 0.65 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.025131942699170642 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 1.9249999999999998 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.35 0.0 0.0 0.0 0.0 138-139 2.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGA 10 0.006830828 145.0 145 CGTGAGA 10 0.006830828 145.0 8 >>END_MODULE Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233098 spots for SRR6958439.sra Written 1233098 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra Read 1233093 spots for SRR6958439.sra Written 1233093 spots for SRR6958439.sra SRR ids: ['SRR6958439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__awcwpdf SRR6958439.sra spots: 24661865 blocks: [[1, 1233093], [1233094, 2466186], [2466187, 3699279], [3699280, 4932372], [4932373, 6165465], [6165466, 7398558], [7398559, 8631651], [8631652, 9864744], [9864745, 11097837], [11097838, 12330930], [12330931, 13564023], [13564024, 14797116], [14797117, 16030209], [16030210, 17263302], [17263303, 18496395], [18496396, 19729488], [19729489, 20962581], [20962582, 22195674], [22195675, 23428767], [23428768, 24661865]] SRR6958439 file size 8335396 SRR6958439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958439 SRR6958439_1.fastq SRR6958439_2.fastq Input file: SRR6958439_1.fastq Paired file: SRR6958439_2.fastq trimmed: SRR6958439-trimmed-pair1.fastq, SRR6958439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:12:57 2024 >> started Fri Dec 6 23:17:23 2024 >> done (265.379s) 24661865 read pairs processed; of these: 15879 ( 0.06%) short read pairs filtered out after trimming by size control 15040 ( 0.06%) empty read pairs filtered out after trimming by size control 24630946 (99.87%) read pairs available; of these: 8751438 (35.53%) trimmed read pairs available after processing 15879508 (64.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 5 0.00% 21 0 0.00% 22 0 0.00% 23 5 0.00% 24 6 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 10 0.00% 29 5 0.00% 30 6 0.00% 31 4 0.00% 32 9 0.00% 33 7 0.00% 34 8 0.00% 35 9 0.00% 36 7 0.00% 37 10 0.00% 38 14 0.00% 39 8 0.00% 40 15 0.00% 41 8 0.00% 42 18 0.00% 43 13 0.00% 44 18 0.00% 45 7 0.00% 46 14 0.00% 47 11 0.00% 48 15 0.00% 49 19 0.00% 50 16 0.00% 51 27 0.00% 52 29 0.00% 53 31 0.00% 54 45 0.00% 55 28 0.00% 56 48 0.00% 57 34 0.00% 58 49 0.00% 59 52 0.00% 60 70 0.00% 61 59 0.00% 62 79 0.00% 63 98 0.00% 64 115 0.00% 65 114 0.00% 66 131 0.00% 67 130 0.00% 68 174 0.00% 69 201 0.00% 70 198 0.00% 71 234 0.00% 72 272 0.00% 73 278 0.00% 74 341 0.00% 75 385 0.00% 76 425 0.00% 77 473 0.00% 78 566 0.00% 79 649 0.00% 80 761 0.00% 81 852 0.00% 82 955 0.00% 83 1212 0.00% 84 1877 0.01% 85 2583 0.01% 86 2612 0.01% 87 2691 0.01% 88 2856 0.01% 89 3108 0.01% 90 3272 0.01% 91 3332 0.01% 92 3582 0.01% 93 4095 0.02% 94 4356 0.02% 95 4690 0.02% 96 4860 0.02% 97 5234 0.02% 98 5587 0.02% 99 6180 0.03% 100 6554 0.03% 101 6923 0.03% 102 7671 0.03% 103 8263 0.03% 104 8955 0.04% 105 9467 0.04% 106 10197 0.04% 107 10760 0.04% 108 11139 0.05% 109 12113 0.05% 110 12475 0.05% 111 13332 0.05% 112 14441 0.06% 113 15207 0.06% 114 16209 0.07% 115 17428 0.07% 116 18305 0.07% 117 18918 0.08% 118 20098 0.08% 119 20849 0.08% 120 22092 0.09% 121 22833 0.09% 122 24183 0.10% 123 25743 0.10% 124 27574 0.11% 125 28871 0.12% 126 30704 0.12% 127 31862 0.13% 128 33217 0.13% 129 34741 0.14% 130 36589 0.15% 131 38090 0.15% 132 40396 0.16% 133 43014 0.17% 134 45788 0.19% 135 48474 0.20% 136 52120 0.21% 137 55343 0.22% 138 58004 0.24% 139 62710 0.25% 140 67468 0.27% 141 73048 0.30% 142 81078 0.33% 143 91592 0.37% 144 105440 0.43% 145 124123 0.50% 146 155278 0.63% 147 211255 0.86% 148 331852 1.35% 149 708803 2.88% 150 5709529 23.18% 151 15879508 64.47% 24630946 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=20 prefix-density=0.53 prefix-fanout=3.0 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=219.41 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.7 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=21 prefix-density=0.40 prefix-fanout=2.7 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=27.31 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958439 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:22:50 Started mapping on | Dec 06 23:22:51 Finished on | Dec 07 00:01:07 Mapping speed, Million of reads per hour | 38.62 Number of input reads | 24630946 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23447244 Uniquely mapped reads % | 95.19% Average mapped length | 297.74 Number of splices: Total | 27414260 Number of splices: Annotated (sjdb) | 25860144 Number of splices: GT/AG | 27025486 Number of splices: GC/AG | 323679 Number of splices: AT/AC | 11190 Number of splices: Non-canonical | 53905 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406296 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 37996 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 788656 788656 788656 N_multimapping 406296 406296 406296 N_noFeature 1050197 22806747 1222745 N_ambiguous 559877 2917 93067 UnstrandedReadsAssigned:21837170 PositiveStrandReadsAssigned:637580 NegativeStrandReadsAssigned:22131432 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958439 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958439-trimmed-pair1.fastq SRR6958439-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,630,946 reads, 22,161,947 reads pseudoaligned [quant] estimated average fragment length: 275.069 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52973 SRR6958439.ke.tsv 35125 SRR6958439.se.tsv 88098 total ==> SRR6958439.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.576 0.00197862 0.00020054 PNS24247 1044 769.931 74.2453 6.47578 PNS24249 1928 1653.93 50.8105 2.06305 PNS24246 1044 769.931 74.2453 6.47578 PNS24248 1044 769.931 74.2453 6.47578 PNS24244 1471 1196.93 57.4515 3.22335 PNS24243 293 79.433 1 0.845422 KQK14069 1603 1328.93 3888.67 196.505 KQK14071 474 217.501 118.423 36.5637 ==> SRR6958439.se.tsv <== BRADI_1g14170v3 4902 BRADI_1g53295v3 1927 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 560 BRADI_1g74790v3 117 BRADI_1g09890v3 0 BRADI_1g77505v3 357 BRADI_1g48960v3 0 SRR6958439 completed mapping pipeline successfully