Starting /dee2/code/volunteer_pipeline.sh SRR6958440 current disk space = 1547850088448 free memory = 1596839524 SRR6958440 SRAfilesize 44875ea72ae1d52ced34fd70425a66c8 SRR6958440.sra SRR6958440.sra file validated SRR6958440 is paired end SRR6958440 is conventional basespace SRR6958440 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.1875 32.0 25.0 33.0 18.0 34.0 2 29.46775 31.0 27.0 33.0 25.0 33.0 3 31.83825 33.0 31.0 33.0 29.0 34.0 4 32.7325 33.0 33.0 33.0 32.0 34.0 5 32.98325 33.0 33.0 34.0 32.0 34.0 6 36.99325 38.0 37.0 38.0 36.0 38.0 7 37.45425 38.0 38.0 38.0 37.0 38.0 8 37.6375 38.0 38.0 38.0 38.0 38.0 9 36.65125 38.0 38.0 38.0 35.0 38.0 10-14 37.40785 38.0 38.0 38.0 36.8 38.0 15-19 37.51465 38.0 38.0 38.0 37.4 38.0 20-24 37.527249999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.39385 38.0 38.0 38.0 37.0 38.0 30-34 37.66395 38.0 38.0 38.0 38.0 38.0 35-39 37.6013 38.0 38.0 38.0 37.6 38.0 40-44 37.64020000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.57379999999999 38.0 38.0 38.0 37.8 38.0 50-54 37.41945 38.0 38.0 38.0 37.4 38.0 55-59 37.10575 38.0 38.0 38.0 36.0 38.0 60-64 36.920550000000006 38.0 38.0 38.0 35.4 38.0 65-69 37.292550000000006 38.0 38.0 38.0 36.6 38.0 70-74 37.180550000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.2725 38.0 38.0 38.0 36.4 38.0 80-84 37.20955 38.0 38.0 38.0 36.0 38.0 85-89 37.0841 38.0 38.0 38.0 36.0 38.0 90-94 37.0707 38.0 38.0 38.0 36.0 38.0 95-99 37.0253 38.0 38.0 38.0 35.4 38.0 100-104 36.767199999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.78035 38.0 38.0 38.0 34.8 38.0 110-114 36.529399999999995 38.0 37.8 38.0 34.4 38.0 115-119 36.4702 38.0 38.0 38.0 34.0 38.0 120-124 36.4457 38.0 37.8 38.0 34.0 38.0 125-129 36.0979 38.0 37.0 38.0 33.4 38.0 130-134 35.863800000000005 38.0 36.2 38.0 32.4 38.0 135-139 35.828 38.0 36.2 38.0 32.2 38.0 140-144 35.35255 38.0 35.4 38.0 31.0 38.0 145-149 34.787 38.0 35.2 38.0 29.0 38.0 150-151 31.241749999999996 35.5 30.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 2.0 19 1.0 20 1.0 21 1.0 22 1.0 23 3.0 24 4.0 25 1.0 26 6.0 27 7.0 28 21.0 29 15.0 30 24.0 31 34.0 32 54.0 33 86.0 34 155.0 35 259.0 36 826.0 37 2495.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.60553278688525 10.835040983606557 9.195696721311474 45.36372950819672 2 19.15 13.950000000000001 39.525 27.375 3 19.875 16.900000000000002 24.725 38.5 4 24.575 24.3 21.85 29.275000000000002 5 24.224999999999998 29.45 25.25 21.075 6 22.075 34.35 24.3 19.275000000000002 7 17.45 25.85 39.25 17.45 8 20.150000000000002 25.025 30.0 24.825 9 18.6 24.575 34.825 22.0 10-14 21.529999999999998 27.785 27.005000000000003 23.68 15-19 21.685 27.295 27.060000000000002 23.96 20-24 21.595 27.08 27.405 23.919999999999998 25-29 21.8 28.144999999999996 26.57 23.485 30-34 21.735 27.525 26.784999999999997 23.955000000000002 35-39 21.48 27.66 26.840000000000003 24.02 40-44 21.5 27.855 26.685 23.96 45-49 21.634999999999998 27.224999999999998 26.729999999999997 24.41 50-54 21.76108805440272 27.33136656832842 26.741337066853344 24.16620831041552 55-59 21.98 26.979999999999997 26.99 24.05 60-64 21.765 27.525 26.905 23.805 65-69 22.065 27.384999999999998 26.745 23.805 70-74 22.25 26.87 26.455000000000002 24.425 75-79 21.745 26.979999999999997 26.685 24.59 80-84 22.14 26.93 26.540000000000003 24.39 85-89 22.045 27.21 26.645000000000003 24.099999999999998 90-94 22.259999999999998 26.584999999999997 26.765 24.39 95-99 21.94 26.645000000000003 26.790000000000003 24.625 100-104 21.54 27.229999999999997 27.075 24.154999999999998 105-109 22.106105305265263 27.27636381819091 26.741337066853344 23.876193809690484 110-114 21.91582002902758 27.335969170712175 26.68034632901256 24.067864471247685 115-119 22.570642660665165 27.261815453863463 26.501625406351586 23.66591647911978 120-124 22.18 26.815 26.685 24.32 125-129 22.730686426676012 26.44570169729134 26.76613428127973 24.057477594752914 130-134 22.5025025025025 26.996996996996998 26.18118118118118 24.31931931931932 135-139 22.42 26.939999999999998 26.325 24.315 140-144 22.264999999999997 26.340000000000003 27.075 24.32 145-149 22.78 27.055 26.240000000000002 23.925 150-151 22.15 26.625 26.075 25.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 0.5 24 1.0 25 2.0 26 2.0 27 1.5 28 2.5 29 6.5 30 12.0 31 15.0 32 22.5 33 32.5 34 39.0 35 52.0 36 65.5 37 85.5 38 107.5 39 131.5 40 160.5 41 194.0 42 230.5 43 243.5 44 245.0 45 250.0 46 242.5 47 229.0 48 228.5 49 201.0 50 163.0 51 141.0 52 120.5 53 104.5 54 90.5 55 80.0 56 67.0 57 54.0 58 44.5 59 43.0 60 44.5 61 39.0 62 33.5 63 32.0 64 28.0 65 24.0 66 20.0 67 18.0 68 12.5 69 8.5 70 7.5 71 3.5 72 3.0 73 3.5 74 2.5 75 2.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.095 115-119 0.025 120-124 0.0 125-129 0.135 130-134 0.1 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 1.9125 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.4625000000000004 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 35 0.0033146844 62.13214 145 >>END_MODULE SRR6958440 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25825 34.0 33.0 34.0 33.0 34.0 2 33.36425 34.0 33.0 34.0 33.0 34.0 3 33.40175 34.0 33.0 34.0 33.0 34.0 4 33.313 34.0 33.0 34.0 33.0 34.0 5 33.3695 34.0 33.0 34.0 33.0 34.0 6 37.54175 38.0 38.0 38.0 38.0 38.0 7 37.577 38.0 38.0 38.0 38.0 38.0 8 37.54225 38.0 38.0 38.0 38.0 38.0 9 34.368 38.0 35.0 38.0 16.0 38.0 10-14 37.25485 38.0 37.8 38.0 36.8 38.0 15-19 36.264149999999994 38.0 37.2 38.0 31.8 38.0 20-24 37.4679 38.0 38.0 38.0 37.8 38.0 25-29 37.490700000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.55649999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.536199999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.5104 38.0 38.0 38.0 38.0 38.0 45-49 37.48125 38.0 38.0 38.0 38.0 38.0 50-54 36.62745 38.0 38.0 38.0 34.0 38.0 55-59 37.38605 38.0 38.0 38.0 37.6 38.0 60-64 37.43135 38.0 38.0 38.0 38.0 38.0 65-69 37.3909 38.0 38.0 38.0 38.0 38.0 70-74 37.32775 38.0 38.0 38.0 37.2 38.0 75-79 37.287099999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.28415 38.0 38.0 38.0 37.0 38.0 85-89 37.2909 38.0 38.0 38.0 37.0 38.0 90-94 37.19160000000001 38.0 38.0 38.0 36.8 38.0 95-99 37.128499999999995 38.0 38.0 38.0 36.8 38.0 100-104 35.75509999999999 38.0 36.2 38.0 30.0 38.0 105-109 36.7711 38.0 38.0 38.0 35.0 38.0 110-114 34.203450000000004 37.6 33.0 38.0 24.8 38.0 115-119 36.66105 38.0 38.0 38.0 34.8 38.0 120-124 35.31265 38.0 35.8 38.0 28.6 38.0 125-129 36.60340000000001 38.0 38.0 38.0 34.4 38.0 130-134 33.335350000000005 37.2 31.6 38.0 21.8 38.0 135-139 34.823750000000004 38.0 35.2 38.0 26.0 38.0 140-144 35.225899999999996 38.0 35.8 38.0 30.2 38.0 145-149 35.2193 38.0 36.0 38.0 31.0 38.0 150-151 31.771 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 2.0 17 1.0 18 0.0 19 2.0 20 3.0 21 4.0 22 5.0 23 7.0 24 9.0 25 8.0 26 12.0 27 15.0 28 16.0 29 19.0 30 33.0 31 39.0 32 52.0 33 68.0 34 119.0 35 266.0 36 921.0 37 2390.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.725 17.65 13.3 35.325 2 28.425 24.125 29.625 17.825 3 21.475 26.625 29.175 22.725 4 25.525 30.925000000000004 21.025 22.525000000000002 5 27.775 33.775 20.825 17.625 6 20.65 38.975 22.05 18.325 7 21.2 21.175 37.925 19.7 8 23.075000000000003 24.425 26.1 26.400000000000002 9 22.55 23.724999999999998 29.9 23.825 10-14 25.25 27.35 24.515 22.884999999999998 15-19 24.925 26.88 26.090000000000003 22.105 20-24 25.155 27.060000000000002 25.729999999999997 22.055 25-29 24.615000000000002 26.950000000000003 25.53 22.905 30-34 24.785 26.435 26.275 22.505 35-39 24.175 27.060000000000002 26.32 22.445 40-44 24.535 26.93 25.905 22.63 45-49 24.25 27.345000000000002 25.869999999999997 22.535 50-54 24.685000000000002 26.465 26.63 22.220000000000002 55-59 24.72 27.205000000000002 25.7 22.375 60-64 25.145 26.625 26.44 21.790000000000003 65-69 24.435000000000002 26.815 26.125 22.625 70-74 25.1 25.96 26.82 22.12 75-79 24.495 26.185000000000002 27.16 22.16 80-84 24.44 26.935 26.525 22.1 85-89 24.5 26.490000000000002 27.065 21.945 90-94 24.65 26.584999999999997 26.68 22.085 95-99 24.54 27.08 26.14 22.24 100-104 24.63 26.68 26.474999999999998 22.215 105-109 24.62 26.810000000000002 26.784999999999997 21.785 110-114 24.240000000000002 27.134999999999998 26.705000000000002 21.92 115-119 25.169999999999998 26.534999999999997 26.545 21.75 120-124 24.779999999999998 27.0 26.545 21.675 125-129 24.68 27.305 26.375 21.64 130-134 24.905 27.334999999999997 26.150000000000002 21.61 135-139 24.834999999999997 26.72 26.63 21.815 140-144 25.174999999999997 27.055 26.43 21.34 145-149 25.145 26.834999999999997 26.575 21.445 150-151 24.375 27.212500000000002 26.474999999999998 21.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 2.0 27 1.5 28 4.0 29 7.0 30 8.5 31 12.0 32 22.0 33 28.0 34 33.5 35 43.5 36 59.0 37 79.5 38 94.0 39 129.0 40 154.5 41 167.5 42 202.0 43 229.0 44 240.0 45 247.5 46 242.0 47 233.5 48 223.5 49 199.0 50 162.5 51 134.0 52 124.5 53 109.0 54 95.0 55 85.0 56 69.5 57 59.0 58 64.0 59 57.5 60 45.0 61 46.0 62 45.5 63 45.0 64 38.0 65 29.5 66 30.0 67 22.5 68 19.5 69 19.0 70 12.0 71 7.0 72 4.5 73 4.5 74 2.0 75 0.5 76 0.0 77 1.5 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.2761737383881496 0.5499999999999999 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATGGA 10 0.006830828 145.0 6 GAAGAGC 30 0.0017973486 72.5 145 >>END_MODULE Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644271 spots for SRR6958440.sra Written 644271 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra Read 644258 spots for SRR6958440.sra Written 644258 spots for SRR6958440.sra SRR ids: ['SRR6958440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tcclg8pk SRR6958440.sra spots: 12885173 blocks: [[1, 644258], [644259, 1288516], [1288517, 1932774], [1932775, 2577032], [2577033, 3221290], [3221291, 3865548], [3865549, 4509806], [4509807, 5154064], [5154065, 5798322], [5798323, 6442580], [6442581, 7086838], [7086839, 7731096], [7731097, 8375354], [8375355, 9019612], [9019613, 9663870], [9663871, 10308128], [10308129, 10952386], [10952387, 11596644], [11596645, 12240902], [12240903, 12885173]] SRR6958440 file size 4344661 SRR6958440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958440 SRR6958440_1.fastq SRR6958440_2.fastq Input file: SRR6958440_1.fastq Paired file: SRR6958440_2.fastq trimmed: SRR6958440-trimmed-pair1.fastq, SRR6958440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:07:14 2024 >> started Fri Dec 6 23:07:26 2024 >> done (12.600s) 12885173 read pairs processed; of these: 5464 ( 0.04%) short read pairs filtered out after trimming by size control 5052 ( 0.04%) empty read pairs filtered out after trimming by size control 12874657 (99.92%) read pairs available; of these: 5281004 (41.02%) trimmed read pairs available after processing 7593653 (58.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 0 0.00% 27 2 0.00% 28 3 0.00% 29 5 0.00% 30 5 0.00% 31 6 0.00% 32 4 0.00% 33 2 0.00% 34 3 0.00% 35 3 0.00% 36 1 0.00% 37 4 0.00% 38 4 0.00% 39 4 0.00% 40 3 0.00% 41 7 0.00% 42 6 0.00% 43 6 0.00% 44 11 0.00% 45 6 0.00% 46 2 0.00% 47 9 0.00% 48 7 0.00% 49 10 0.00% 50 17 0.00% 51 18 0.00% 52 14 0.00% 53 16 0.00% 54 27 0.00% 55 25 0.00% 56 18 0.00% 57 30 0.00% 58 35 0.00% 59 31 0.00% 60 30 0.00% 61 40 0.00% 62 46 0.00% 63 57 0.00% 64 58 0.00% 65 63 0.00% 66 76 0.00% 67 80 0.00% 68 87 0.00% 69 110 0.00% 70 102 0.00% 71 129 0.00% 72 160 0.00% 73 194 0.00% 74 220 0.00% 75 235 0.00% 76 261 0.00% 77 295 0.00% 78 325 0.00% 79 352 0.00% 80 418 0.00% 81 433 0.00% 82 592 0.00% 83 627 0.00% 84 945 0.01% 85 1163 0.01% 86 1176 0.01% 87 1286 0.01% 88 1378 0.01% 89 1466 0.01% 90 1517 0.01% 91 1728 0.01% 92 1872 0.01% 93 2092 0.02% 94 2325 0.02% 95 2415 0.02% 96 2628 0.02% 97 2897 0.02% 98 3092 0.02% 99 4012 0.03% 100 4249 0.03% 101 4738 0.04% 102 4117 0.03% 103 4322 0.03% 104 4533 0.04% 105 4832 0.04% 106 5479 0.04% 107 5740 0.04% 108 6140 0.05% 109 6458 0.05% 110 6768 0.05% 111 7206 0.06% 112 7588 0.06% 113 8427 0.07% 114 8857 0.07% 115 9468 0.07% 116 10181 0.08% 117 10450 0.08% 118 11081 0.09% 119 11551 0.09% 120 12214 0.09% 121 13171 0.10% 122 13863 0.11% 123 14381 0.11% 124 15430 0.12% 125 16324 0.13% 126 17100 0.13% 127 18158 0.14% 128 19218 0.15% 129 20309 0.16% 130 21744 0.17% 131 22959 0.18% 132 24476 0.19% 133 26566 0.21% 134 28052 0.22% 135 30447 0.24% 136 33015 0.26% 137 34999 0.27% 138 37524 0.29% 139 40942 0.32% 140 44687 0.35% 141 49884 0.39% 142 56137 0.44% 143 63593 0.49% 144 74926 0.58% 145 93067 0.72% 146 118955 0.92% 147 166783 1.30% 148 267533 2.08% 149 553168 4.30% 150 3151851 24.48% 151 7593653 58.98% 12874657 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=27 prefix-density=0.70 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=35.79 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=20 prefix-density=0.52 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=417.97 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.0 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958440 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:08:13 Started mapping on | Dec 06 23:08:13 Finished on | Dec 06 23:09:50 Mapping speed, Million of reads per hour | 477.82 Number of input reads | 12874657 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12437835 Uniquely mapped reads % | 96.61% Average mapped length | 297.37 Number of splices: Total | 14834583 Number of splices: Annotated (sjdb) | 13982629 Number of splices: GT/AG | 14626516 Number of splices: GC/AG | 175133 Number of splices: AT/AC | 5586 Number of splices: Non-canonical | 27348 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 152509 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 12271 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 288027 288027 288027 N_multimapping 152509 152509 152509 N_noFeature 488598 12011595 591359 N_ambiguous 366482 1464 43406 UnstrandedReadsAssigned:11582755 PositiveStrandReadsAssigned:424776 NegativeStrandReadsAssigned:11803070 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958440-trimmed-pair1.fastq SRR6958440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,874,657 reads, 11,794,947 reads pseudoaligned [quant] estimated average fragment length: 248.044 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR6958440.ke.tsv 35125 SRR6958440.se.tsv 88098 total ==> SRR6958440.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.46 0 0 PNS24247 1044 796.956 34.6661 5.78369 PNS24249 1928 1680.96 22.171 1.75373 PNS24246 1044 796.956 34.6661 5.78369 PNS24248 1044 796.956 34.6661 5.78369 PNS24244 1471 1223.96 52.8306 5.73924 PNS24243 293 80.5893 0 0 KQK14069 1603 1355.96 5692.39 558.192 KQK14071 474 232.265 84.567 48.4118 ==> SRR6958440.se.tsv <== BRADI_1g14170v3 6471 BRADI_1g53295v3 654 BRADI_1g59795v3 77 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 166 BRADI_1g74790v3 48 BRADI_1g09890v3 0 BRADI_1g77505v3 136 BRADI_1g48960v3 0 SRR6958440 completed mapping pipeline successfully