Starting /dee2/code/volunteer_pipeline.sh SRR6958441 current disk space = 1547722117120 free memory = 1593909244 SRR6958441 SRAfilesize 55b0d7a2fd0d0d66b1a190f48bdac07f SRR6958441.sra SRR6958441.sra file validated SRR6958441 is paired end SRR6958441 is conventional basespace SRR6958441 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.8 18.0 18.0 18.0 18.0 28.0 2 28.20625 27.0 27.0 32.0 25.0 32.0 3 27.58 29.0 25.0 31.0 18.0 33.0 4 32.182 33.0 32.0 33.0 32.0 33.0 5 32.6605 33.0 33.0 33.0 32.0 33.0 6 36.37025 38.0 36.0 38.0 34.0 38.0 7 36.60025 38.0 37.0 38.0 34.0 38.0 8 37.115 38.0 38.0 38.0 35.0 38.0 9 37.50875 38.0 38.0 38.0 37.0 38.0 10-14 37.5807 38.0 38.0 38.0 37.6 38.0 15-19 37.5537 38.0 38.0 38.0 37.6 38.0 20-24 37.63395 38.0 38.0 38.0 38.0 38.0 25-29 37.57465 38.0 38.0 38.0 38.0 38.0 30-34 37.5212 38.0 38.0 38.0 38.0 38.0 35-39 37.538650000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.4962 38.0 38.0 38.0 37.6 38.0 45-49 37.48085 38.0 38.0 38.0 37.2 38.0 50-54 37.4126 38.0 38.0 38.0 37.0 38.0 55-59 37.2663 38.0 38.0 38.0 36.8 38.0 60-64 37.102850000000004 38.0 38.0 38.0 36.4 38.0 65-69 37.2016 38.0 38.0 38.0 36.4 38.0 70-74 37.184250000000006 38.0 38.0 38.0 36.0 38.0 75-79 37.057 38.0 38.0 38.0 35.8 38.0 80-84 37.0929 38.0 38.0 38.0 36.0 38.0 85-89 36.972899999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.8909 38.0 38.0 38.0 35.0 38.0 95-99 36.677749999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.366200000000006 38.0 37.8 38.0 32.8 38.0 105-109 36.29785 38.0 37.8 38.0 33.0 38.0 110-114 36.10039999999999 38.0 37.6 38.0 32.8 38.0 115-119 35.7182 38.0 36.8 38.0 31.0 38.0 120-124 35.5056 38.0 36.2 38.0 29.8 38.0 125-129 35.3137 38.0 36.0 38.0 29.2 38.0 130-134 34.91385 38.0 35.6 38.0 27.8 38.0 135-139 34.182100000000005 38.0 33.8 38.0 25.6 38.0 140-144 33.833600000000004 38.0 33.0 38.0 23.6 38.0 145-149 33.29725 38.0 33.0 38.0 20.6 38.0 150-151 26.840375 32.5 17.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 6.0 21 2.0 22 11.0 23 6.0 24 3.0 25 9.0 26 15.0 27 31.0 28 19.0 29 21.0 30 46.0 31 64.0 32 70.0 33 89.0 34 202.0 35 357.0 36 1087.0 37 1955.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.200000000000003 11.025 27.35 34.425 2 24.725 10.725 34.025 30.525000000000002 3 20.75 16.275000000000002 26.0 36.975 4 25.2 22.1 23.125 29.575000000000003 5 26.200000000000003 27.35 23.825 22.625 6 25.374999999999996 30.075000000000003 22.35 22.2 7 18.25 23.849999999999998 38.65 19.25 8 20.599999999999998 23.125 27.975 28.299999999999997 9 20.275000000000002 22.55 32.85 24.325 10-14 23.46 25.740000000000002 25.615 25.185000000000002 15-19 23.499699939987998 24.649929985997197 25.70514102820564 26.14522904580916 20-24 23.419999999999998 24.685000000000002 25.765 26.13 25-29 23.315 24.87 25.55 26.265 30-34 23.43 25.005 25.264999999999997 26.3 35-39 23.89 24.855 25.365 25.89 40-44 24.025 24.834999999999997 25.979999999999997 25.16 45-49 23.59 25.424999999999997 24.79 26.195 50-54 23.775 24.635 25.545 26.045 55-59 23.71 24.495 25.445 26.35 60-64 23.843916140034104 24.74671481592938 25.398736081853745 26.01063296218277 65-69 23.645 24.615000000000002 25.840000000000003 25.900000000000002 70-74 23.605 24.46 25.61 26.325 75-79 23.95 24.240000000000002 25.580000000000002 26.229999999999997 80-84 23.84 24.855 25.05 26.255 85-89 23.48 24.455 25.46 26.605 90-94 24.044999999999998 24.29 25.835 25.83 95-99 23.73 24.11 25.795 26.365 100-104 24.025 24.68 24.959999999999997 26.334999999999997 105-109 24.22 24.175 25.03 26.575 110-114 24.315 24.275 25.080000000000002 26.33 115-119 23.865 24.345 25.380000000000003 26.41 120-124 24.415 24.57 24.9 26.115 125-129 24.235 24.67 24.945 26.150000000000002 130-134 24.11 24.55 24.77 26.57 135-139 24.12 24.345 24.925 26.61 140-144 24.59 24.32 24.665 26.424999999999997 145-149 24.2 24.51 24.745 26.545 150-151 23.9375 23.925 24.725 27.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.0 29 3.5 30 7.0 31 9.0 32 7.5 33 13.0 34 20.0 35 29.5 36 39.5 37 53.5 38 72.5 39 93.5 40 121.0 41 158.5 42 178.0 43 171.0 44 185.0 45 201.0 46 205.5 47 208.5 48 197.0 49 188.0 50 179.0 51 147.0 52 127.0 53 112.5 54 96.0 55 96.0 56 98.5 57 101.0 58 93.5 59 78.0 60 68.0 61 64.5 62 66.0 63 61.5 64 56.5 65 56.5 66 52.5 67 52.0 68 48.0 69 44.0 70 35.0 71 24.0 72 21.5 73 19.5 74 18.5 75 11.0 76 2.0 77 1.5 78 2.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.31 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1124999999999998 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTGAG 10 0.006843168 144.91249 1 CACAGAA 10 0.006843168 144.91249 1 TTTGTAA 10 0.006843168 144.91249 8 >>END_MODULE SRR6958441 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958441_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88725 33.0 33.0 34.0 32.0 34.0 2 33.0015 34.0 33.0 34.0 32.0 34.0 3 33.05975 34.0 33.0 34.0 33.0 34.0 4 33.00075 34.0 33.0 34.0 32.0 34.0 5 32.99625 34.0 33.0 34.0 32.0 34.0 6 37.216 38.0 38.0 38.0 37.0 38.0 7 37.1615 38.0 38.0 38.0 37.0 38.0 8 37.21125 38.0 38.0 38.0 37.0 38.0 9 37.191 38.0 38.0 38.0 37.0 38.0 10-14 37.18769999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.117450000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.1028 38.0 38.0 38.0 37.0 38.0 25-29 37.0848 38.0 38.0 38.0 37.0 38.0 30-34 37.101600000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.0901 38.0 38.0 38.0 36.8 38.0 40-44 37.0368 38.0 38.0 38.0 36.8 38.0 45-49 37.02695 38.0 38.0 38.0 36.8 38.0 50-54 36.8949 38.0 38.0 38.0 36.2 38.0 55-59 36.81515 38.0 38.0 38.0 36.0 38.0 60-64 36.8848 38.0 38.0 38.0 36.0 38.0 65-69 36.83515 38.0 38.0 38.0 36.0 38.0 70-74 36.772949999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.810500000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.725350000000006 38.0 38.0 38.0 35.2 38.0 85-89 36.5812 38.0 38.0 38.0 35.0 38.0 90-94 36.46855000000001 38.0 38.0 38.0 34.6 38.0 95-99 36.344750000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.352850000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.187200000000004 38.0 38.0 38.0 34.0 38.0 110-114 35.922450000000005 38.0 38.0 38.0 33.2 38.0 115-119 35.7318 38.0 37.8 38.0 32.4 38.0 120-124 35.755849999999995 38.0 37.6 38.0 33.0 38.0 125-129 35.62845 38.0 36.8 38.0 32.4 38.0 130-134 35.3746 38.0 36.2 38.0 31.4 38.0 135-139 35.251599999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.958299999999994 38.0 36.0 38.0 30.0 38.0 145-149 34.2231 38.0 35.2 38.0 27.0 38.0 150-151 30.26425 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 3.0 4 2.0 5 1.0 6 2.0 7 2.0 8 1.0 9 2.0 10 0.0 11 0.0 12 2.0 13 4.0 14 0.0 15 2.0 16 2.0 17 8.0 18 4.0 19 5.0 20 2.0 21 6.0 22 7.0 23 7.0 24 6.0 25 13.0 26 14.0 27 26.0 28 14.0 29 33.0 30 42.0 31 44.0 32 59.0 33 73.0 34 119.0 35 210.0 36 497.0 37 2770.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 20.05 11.924999999999999 27.325 2 30.13286537979443 22.56204562547004 26.272248683880672 21.03284031085485 3 24.278906445949335 25.20692249811889 27.2886882367695 23.225482819162277 4 26.278836509528585 30.867602808425275 19.53360080240722 23.319959879638915 5 26.84883429430935 32.41413888192529 19.353221358736526 21.38380546502883 6 23.915768362998246 32.56455251942843 20.681875156680874 22.837803960892455 7 22.16094259212835 19.603910754575082 33.66758586111808 24.56756079217849 8 24.17940365823102 23.352543222250063 22.25006264094212 30.2179904785768 9 23.339182752569563 23.364251692153424 26.57307595888694 26.72348959639007 10-14 25.76342576342576 25.66815423958281 23.206137491851777 25.36228250513965 15-19 26.50481540930979 24.7341492776886 23.95666131621188 24.804373996789728 20-24 25.171739457453747 25.40239683096826 23.732638018352304 25.693225693225692 25-29 26.434302908726178 25.235707121364094 23.931795386158473 24.398194583751255 30-34 26.26698080104266 25.309539325279463 23.324477417414407 25.09900245626347 35-39 26.41263474555026 25.585359739283025 23.04336926548007 24.958636249686638 40-44 26.217923015236565 25.260625501202888 23.315958299919807 25.205493183640737 45-49 25.872093023255815 25.2556134723336 24.132919005613473 24.739374498797112 50-54 26.515265453451647 24.65533664210157 24.078808843435105 24.75058906101168 55-59 26.283336675355923 24.463605373972328 24.248044916783638 25.00501303388811 60-64 25.62791397202587 24.911014187597132 24.19912768837419 25.26194415200281 65-69 26.225563909774436 24.992481203007518 23.784461152882205 24.99749373433584 70-74 26.338748495788206 25.095266746891298 23.741476133172885 24.82450862414761 75-79 26.158857429215736 25.15159107992984 23.56802806314207 25.12152342771235 80-84 26.542374580263616 25.20924171803739 23.810955746003106 24.437427955695885 85-89 26.691729323308273 25.047619047619047 23.98997493734336 24.270676691729324 90-94 26.726817042606516 25.418546365914786 23.318295739348372 24.536340852130326 95-99 26.265917978542063 25.49383335004512 23.668906046325077 24.571342625087738 100-104 26.7184758084733 25.389822010528956 23.975933817999497 23.915768362998246 105-109 25.988672247005162 25.537567039246152 23.933637411658566 24.540123302090123 110-114 26.22342559165664 25.245687926193337 23.826714801444044 24.704171680705976 115-119 26.442428191889316 25.600280715825352 23.99117750263171 23.966113589653617 120-124 26.18593922374887 25.754688596931103 23.859191655801826 24.200180523518203 125-129 26.442139026712773 25.284418383200517 24.091615295945473 24.181827294141232 130-134 26.93734335839599 25.94987468671679 23.759398496240603 23.35338345864662 135-139 26.602515912394125 26.006114368766603 24.06154462988022 23.32982508895905 140-144 27.477816212964356 25.397302852559285 23.6526796009425 23.472201333533864 145-149 26.997894314649557 25.945051639426453 23.6087436077409 23.448310438183096 150-151 27.174730508899476 26.12183504637754 24.12885434946102 22.57458009526197 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 4.5 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 1.0 29 2.5 30 3.5 31 3.5 32 4.5 33 7.5 34 12.0 35 18.0 36 26.5 37 41.5 38 60.5 39 76.5 40 99.5 41 120.5 42 148.5 43 183.5 44 198.0 45 194.5 46 188.5 47 192.5 48 182.5 49 170.5 50 166.5 51 149.0 52 128.5 53 106.0 54 107.5 55 116.0 56 106.0 57 97.5 58 96.5 59 97.5 60 85.0 61 84.5 62 84.0 63 77.0 64 70.5 65 66.0 66 65.5 67 64.5 68 61.0 69 51.0 70 42.5 71 31.0 72 25.0 73 22.0 74 19.0 75 15.0 76 9.0 77 4.0 78 1.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.325 4 0.3 5 0.27499999999999997 6 0.27499999999999997 7 0.27499999999999997 8 0.22499999999999998 9 0.27499999999999997 10-14 0.28500000000000003 15-19 0.32 20-24 0.28500000000000003 25-29 0.3 30-34 0.255 35-39 0.27499999999999997 40-44 0.24 45-49 0.24 50-54 0.265 55-59 0.26 60-64 0.265 65-69 0.25 70-74 0.27999999999999997 75-79 0.22499999999999998 80-84 0.23500000000000001 85-89 0.25 90-94 0.25 95-99 0.27 100-104 0.27499999999999997 105-109 0.245 110-114 0.27999999999999997 115-119 0.255 120-124 0.29 125-129 0.23500000000000001 130-134 0.25 135-139 0.23500000000000001 140-144 0.265 145-149 0.27 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.8250000000000002 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.85 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166600 spots for SRR6958441.sra Written 1166600 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra Read 1166596 spots for SRR6958441.sra Written 1166596 spots for SRR6958441.sra SRR ids: ['SRR6958441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h36px934 SRR6958441.sra spots: 23331924 blocks: [[1, 1166596], [1166597, 2333192], [2333193, 3499788], [3499789, 4666384], [4666385, 5832980], [5832981, 6999576], [6999577, 8166172], [8166173, 9332768], [9332769, 10499364], [10499365, 11665960], [11665961, 12832556], [12832557, 13999152], [13999153, 15165748], [15165749, 16332344], [16332345, 17498940], [17498941, 18665536], [18665537, 19832132], [19832133, 20998728], [20998729, 22165324], [22165325, 23331924]] SRR6958441 file size 7884723 SRR6958441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958441 SRR6958441_1.fastq SRR6958441_2.fastq Input file: SRR6958441_1.fastq Paired file: SRR6958441_2.fastq trimmed: SRR6958441-trimmed-pair1.fastq, SRR6958441-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:10:36 2024 >> started Fri Dec 6 23:11:02 2024 >> done (26.024s) 23331924 read pairs processed; of these: 28763 ( 0.12%) short read pairs filtered out after trimming by size control 70828 ( 0.30%) empty read pairs filtered out after trimming by size control 23232333 (99.57%) read pairs available; of these: 10913486 (46.98%) trimmed read pairs available after processing 12318847 (53.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 11 0.00% 21 4 0.00% 22 9 0.00% 23 7 0.00% 24 10 0.00% 25 6 0.00% 26 10 0.00% 27 13 0.00% 28 15 0.00% 29 17 0.00% 30 15 0.00% 31 7 0.00% 32 10 0.00% 33 8 0.00% 34 12 0.00% 35 11 0.00% 36 13 0.00% 37 16 0.00% 38 15 0.00% 39 12 0.00% 40 19 0.00% 41 16 0.00% 42 18 0.00% 43 14 0.00% 44 23 0.00% 45 22 0.00% 46 22 0.00% 47 23 0.00% 48 27 0.00% 49 32 0.00% 50 30 0.00% 51 36 0.00% 52 55 0.00% 53 51 0.00% 54 59 0.00% 55 48 0.00% 56 71 0.00% 57 77 0.00% 58 73 0.00% 59 109 0.00% 60 106 0.00% 61 131 0.00% 62 139 0.00% 63 163 0.00% 64 178 0.00% 65 215 0.00% 66 233 0.00% 67 248 0.00% 68 264 0.00% 69 300 0.00% 70 332 0.00% 71 391 0.00% 72 451 0.00% 73 486 0.00% 74 625 0.00% 75 667 0.00% 76 742 0.00% 77 822 0.00% 78 903 0.00% 79 1064 0.00% 80 1222 0.01% 81 1468 0.01% 82 1608 0.01% 83 1992 0.01% 84 3171 0.01% 85 3827 0.02% 86 4035 0.02% 87 4381 0.02% 88 4468 0.02% 89 4915 0.02% 90 5079 0.02% 91 5394 0.02% 92 5811 0.03% 93 6337 0.03% 94 6823 0.03% 95 7387 0.03% 96 7824 0.03% 97 8523 0.04% 98 8921 0.04% 99 9687 0.04% 100 10496 0.05% 101 11195 0.05% 102 12381 0.05% 103 13086 0.06% 104 14036 0.06% 105 15059 0.06% 106 15913 0.07% 107 16955 0.07% 108 17609 0.08% 109 19199 0.08% 110 20306 0.09% 111 21395 0.09% 112 22874 0.10% 113 24294 0.10% 114 25690 0.11% 115 27799 0.12% 116 28810 0.12% 117 30450 0.13% 118 31694 0.14% 119 32888 0.14% 120 34456 0.15% 121 35987 0.15% 122 37874 0.16% 123 40441 0.17% 124 42860 0.18% 125 45063 0.19% 126 46849 0.20% 127 49340 0.21% 128 50904 0.22% 129 52694 0.23% 130 55019 0.24% 131 56939 0.25% 132 60668 0.26% 133 63897 0.28% 134 66913 0.29% 135 70365 0.30% 136 74060 0.32% 137 77555 0.33% 138 81426 0.35% 139 86125 0.37% 140 92021 0.40% 141 99202 0.43% 142 109054 0.47% 143 120327 0.52% 144 137945 0.59% 145 162240 0.70% 146 201305 0.87% 147 274776 1.18% 148 424178 1.83% 149 920758 3.96% 150 6717725 28.92% 151 12318847 53.02% 23232333 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=20 prefix-density=0.61 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=177.86 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.9 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=17 prefix-density=0.43 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=88.26 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=14.2 sequence=CCGCCGCCGCCG SRR6958441 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:11:41 Started mapping on | Dec 06 23:11:41 Finished on | Dec 06 23:13:37 Mapping speed, Million of reads per hour | 721.00 Number of input reads | 23232333 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 22472065 Uniquely mapped reads % | 96.73% Average mapped length | 296.19 Number of splices: Total | 24981690 Number of splices: Annotated (sjdb) | 23472989 Number of splices: GT/AG | 24662240 Number of splices: GC/AG | 286131 Number of splices: AT/AC | 12158 Number of splices: Non-canonical | 21161 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177298 % of reads mapped to multiple loci | 0.76% Number of reads mapped to too many loci | 17918 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 601065 601065 601065 N_multimapping 177298 177298 177298 N_noFeature 682240 21888385 851948 N_ambiguous 492147 3132 79186 UnstrandedReadsAssigned:21297678 PositiveStrandReadsAssigned:580548 NegativeStrandReadsAssigned:21540931 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958441 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958441-trimmed-pair1.fastq SRR6958441-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,232,333 reads, 21,593,086 reads pseudoaligned [quant] estimated average fragment length: 258.046 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR6958441.ke.tsv 35125 SRR6958441.se.tsv 88098 total ==> SRR6958441.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.407 90.669 8.91329 PNS24247 1044 786.954 61.9221 5.2554 PNS24249 1928 1670.95 103.22 4.12578 PNS24246 1044 786.954 61.9221 5.2554 PNS24248 1044 786.954 61.9221 5.2554 PNS24244 1471 1213.95 30.345 1.66953 PNS24243 293 87.4976 0 0 KQK14069 1603 1345.95 1620.3 80.4036 KQK14071 474 231.093 8.83976 2.55483 ==> SRR6958441.se.tsv <== BRADI_1g14170v3 1712 BRADI_1g53295v3 647 BRADI_1g59795v3 247 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 586 BRADI_1g74790v3 481 BRADI_1g09890v3 1 BRADI_1g77505v3 373 BRADI_1g48960v3 1 SRR6958441 completed mapping pipeline successfully