Starting /dee2/code/volunteer_pipeline.sh SRR6958442 current disk space = 1547739955200 free memory = 1598517600 SRR6958442 SRAfilesize 1e66094a0ea83ef56e92b11bf1c86f32 SRR6958442.sra SRR6958442.sra file validated SRR6958442 is paired end SRR6958442 is conventional basespace SRR6958442 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.944 18.0 18.0 30.0 18.0 32.0 2 24.8945 25.0 18.0 29.0 18.0 31.0 3 27.53325 29.0 25.0 31.0 18.0 33.0 4 31.1735 32.0 32.0 33.0 27.0 33.0 5 32.09475 33.0 32.0 33.0 31.0 33.0 6 36.31425 38.0 36.0 38.0 33.0 38.0 7 37.09725 38.0 38.0 38.0 35.0 38.0 8 37.389 38.0 38.0 38.0 37.0 38.0 9 37.51875 38.0 38.0 38.0 37.0 38.0 10-14 37.5461 38.0 38.0 38.0 38.0 38.0 15-19 37.53415 38.0 38.0 38.0 38.0 38.0 20-24 37.668 38.0 38.0 38.0 38.0 38.0 25-29 37.666450000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.5446 38.0 38.0 38.0 38.0 38.0 35-39 37.51085 38.0 38.0 38.0 38.0 38.0 40-44 37.50565 38.0 38.0 38.0 38.0 38.0 45-49 37.53955 38.0 38.0 38.0 38.0 38.0 50-54 37.5663 38.0 38.0 38.0 38.0 38.0 55-59 37.44745 38.0 38.0 38.0 37.6 38.0 60-64 37.15015 38.0 38.0 38.0 36.6 38.0 65-69 37.43185 38.0 38.0 38.0 37.2 38.0 70-74 37.44480000000001 38.0 38.0 38.0 37.6 38.0 75-79 37.33605 38.0 38.0 38.0 37.0 38.0 80-84 37.38775 38.0 38.0 38.0 37.0 38.0 85-89 36.355149999999995 38.0 37.0 38.0 31.2 38.0 90-94 37.17415 38.0 38.0 38.0 36.6 38.0 95-99 37.14185 38.0 38.0 38.0 36.2 38.0 100-104 37.10415 38.0 38.0 38.0 36.0 38.0 105-109 36.921549999999996 38.0 38.0 38.0 35.4 38.0 110-114 36.3902 38.0 37.6 38.0 33.2 38.0 115-119 36.77785 38.0 38.0 38.0 35.0 38.0 120-124 36.7093 38.0 38.0 38.0 35.0 38.0 125-129 36.5647 38.0 38.0 38.0 34.4 38.0 130-134 36.391 38.0 38.0 38.0 34.0 38.0 135-139 36.29105 38.0 38.0 38.0 33.4 38.0 140-144 35.7001 38.0 37.6 38.0 31.0 38.0 145-149 34.2024 38.0 34.2 38.0 25.0 38.0 150-151 31.634375 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 1.0 20 4.0 21 2.0 22 0.0 23 1.0 24 4.0 25 6.0 26 7.0 27 8.0 28 22.0 29 20.0 30 25.0 31 36.0 32 53.0 33 97.0 34 105.0 35 249.0 36 677.0 37 2677.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.16407690281802 12.220173821437976 5.715038188043192 40.90071108770081 2 23.175 15.299999999999999 32.2 29.325000000000003 3 21.5 17.075000000000003 23.625 37.8 4 26.0 26.075 21.0 26.924999999999997 5 24.775 31.974999999999998 22.975 20.275000000000002 6 22.025 33.85 23.674999999999997 20.45 7 16.150000000000002 23.65 40.1 20.1 8 18.55 22.8 31.0 27.650000000000002 9 19.225 21.7 34.775 24.3 10-14 21.790000000000003 27.57 25.7 24.94 15-19 22.105 25.965 26.619999999999997 25.31 20-24 22.720000000000002 26.08 25.669999999999998 25.53 25-29 22.09 26.284999999999997 26.205000000000002 25.419999999999998 30-34 22.455 25.885 26.26 25.4 35-39 22.505 26.150000000000002 25.75 25.595000000000002 40-44 22.285 26.52 26.215 24.98 45-49 22.375 26.534999999999997 25.1 25.990000000000002 50-54 22.32 26.295 26.21 25.174999999999997 55-59 22.555 26.055 25.91 25.480000000000004 60-64 22.61 26.085 25.71 25.595000000000002 65-69 22.900000000000002 25.415 26.11 25.575 70-74 22.314999999999998 26.47 25.75 25.465 75-79 22.015 25.655 26.265 26.064999999999998 80-84 22.355 25.61 26.41 25.624999999999996 85-89 22.415 26.240000000000002 25.445 25.900000000000002 90-94 22.384999999999998 26.045 26.135 25.435000000000002 95-99 22.615 25.805 26.290000000000003 25.290000000000003 100-104 22.235 26.26 25.61 25.895000000000003 105-109 23.565 25.31 25.845000000000002 25.28 110-114 22.595000000000002 25.89 26.290000000000003 25.224999999999998 115-119 22.884999999999998 25.8 26.025 25.290000000000003 120-124 22.869999999999997 25.990000000000002 25.405 25.735000000000003 125-129 22.875 26.090000000000003 25.814999999999998 25.22 130-134 22.71 26.3 25.314999999999998 25.674999999999997 135-139 23.18 26.105 25.41 25.305 140-144 22.919999999999998 25.95 25.369999999999997 25.759999999999998 145-149 23.125 25.355 25.585 25.935000000000002 150-151 22.782434630301516 26.53571875390967 24.871762792443388 25.810083823345426 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 1.5 28 1.5 29 4.0 30 7.5 31 9.5 32 14.5 33 27.0 34 37.5 35 42.0 36 48.5 37 62.0 38 82.5 39 127.0 40 165.0 41 176.0 42 182.5 43 192.5 44 205.0 45 220.0 46 227.5 47 232.0 48 218.0 49 172.0 50 152.5 51 149.5 52 133.0 53 112.0 54 99.5 55 93.5 56 84.0 57 81.0 58 74.0 59 57.5 60 46.5 61 47.0 62 50.5 63 47.5 64 42.5 65 43.0 66 45.5 67 36.5 68 28.5 69 24.5 70 21.5 71 18.5 72 13.5 73 10.5 74 8.0 75 8.0 76 6.0 77 2.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3499999999999996 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.5875 0.0 0.0 0.0 0.0 132-133 6.1125 0.0 0.0 0.0 0.0 134-135 6.5125 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138-139 7.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.005945122 28.99 65-69 >>END_MODULE SRR6958442 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78525 33.0 33.0 34.0 32.0 34.0 2 33.11275 34.0 33.0 34.0 32.0 34.0 3 33.1805 34.0 33.0 34.0 33.0 34.0 4 33.26675 34.0 33.0 34.0 33.0 34.0 5 32.9595 34.0 33.0 34.0 32.0 34.0 6 37.353 38.0 38.0 38.0 37.0 38.0 7 37.40575 38.0 38.0 38.0 38.0 38.0 8 37.3905 38.0 38.0 38.0 38.0 38.0 9 37.35675 38.0 38.0 38.0 38.0 38.0 10-14 37.16825 38.0 38.0 38.0 37.0 38.0 15-19 37.36635 38.0 38.0 38.0 37.6 38.0 20-24 37.458999999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.153499999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.39665 38.0 38.0 38.0 37.8 38.0 35-39 37.30025 38.0 38.0 38.0 37.6 38.0 40-44 37.01565000000001 38.0 38.0 38.0 36.6 38.0 45-49 37.0423 38.0 38.0 38.0 36.4 38.0 50-54 36.8962 38.0 38.0 38.0 35.6 38.0 55-59 37.30095 38.0 38.0 38.0 37.4 38.0 60-64 37.2548 38.0 38.0 38.0 37.2 38.0 65-69 36.4868 38.0 38.0 38.0 33.8 38.0 70-74 37.070299999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.162099999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.082950000000004 38.0 38.0 38.0 36.8 38.0 85-89 36.965999999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.8027 38.0 38.0 38.0 35.6 38.0 95-99 35.59415 38.0 36.8 38.0 28.4 38.0 100-104 36.697900000000004 38.0 38.0 38.0 34.8 38.0 105-109 35.902249999999995 38.0 37.2 38.0 31.2 38.0 110-114 36.66555 38.0 38.0 38.0 35.0 38.0 115-119 36.6 38.0 38.0 38.0 34.6 38.0 120-124 35.4444 38.0 36.6 38.0 28.2 38.0 125-129 36.0785 38.0 37.6 38.0 33.0 38.0 130-134 36.046 38.0 38.0 38.0 32.8 38.0 135-139 34.6873 38.0 35.2 38.0 26.0 38.0 140-144 35.205499999999994 38.0 36.0 38.0 30.0 38.0 145-149 33.852599999999995 38.0 34.6 38.0 23.0 38.0 150-151 29.519875 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 1.0 6 1.0 7 0.0 8 1.0 9 2.0 10 1.0 11 2.0 12 2.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 3.0 19 2.0 20 3.0 21 2.0 22 6.0 23 5.0 24 12.0 25 16.0 26 16.0 27 12.0 28 19.0 29 23.0 30 38.0 31 49.0 32 57.0 33 99.0 34 151.0 35 216.0 36 664.0 37 2586.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.434858714678676 19.30482620655164 9.952488122030507 31.30782695673918 2 30.15 23.5 28.075 18.275 3 22.8 24.875 29.549999999999997 22.775000000000002 4 27.175 31.724999999999998 19.8 21.3 5 28.725 34.2 18.6 18.475 6 22.55 35.5 21.224999999999998 20.724999999999998 7 21.7 20.45 35.8 22.05 8 23.175 22.95 25.55 28.325 9 22.8 23.25 27.500000000000004 26.450000000000003 10-14 26.145000000000003 27.0 23.16 23.695 15-19 26.136306815340767 25.6112805640282 24.661233061653082 23.59117955897795 20-24 25.81 25.77 25.145 23.275000000000002 25-29 26.21 25.89 24.805 23.095 30-34 25.255 25.759999999999998 25.419999999999998 23.565 35-39 25.27 25.15 25.230000000000004 24.349999999999998 40-44 25.555 25.924999999999997 24.995 23.525 45-49 26.215 25.979999999999997 24.740000000000002 23.064999999999998 50-54 25.371268563428174 26.446322316115804 24.751237561878096 23.43117155857793 55-59 25.656282814140706 25.98629931496575 24.74123706185309 23.61618080904045 60-64 25.7 25.39 25.145 23.765 65-69 25.650000000000002 26.1 25.34 22.91 70-74 25.679999999999996 25.56 25.22 23.54 75-79 25.295 25.974999999999998 25.39 23.34 80-84 25.071253562678137 25.351267563378173 25.766288314415718 23.811190559527976 85-89 26.009999999999998 25.495 25.285000000000004 23.21 90-94 25.5 26.245 25.535000000000004 22.720000000000002 95-99 25.509999999999998 26.045 25.555 22.89 100-104 26.76 25.8 24.82 22.62 105-109 26.296314815740786 26.241312065603278 24.946247312365617 22.516125806290315 110-114 25.855 26.26 25.09 22.795 115-119 26.365 26.215 24.91 22.509999999999998 120-124 26.16 26.16 25.264999999999997 22.415 125-129 26.35 26.105 25.435000000000002 22.11 130-134 26.474999999999998 25.919999999999998 25.35 22.255 135-139 26.740000000000002 26.279999999999998 24.88 22.1 140-144 27.034999999999997 26.245 25.31 21.41 145-149 26.735 26.3 24.46 22.505 150-151 27.785419532324624 25.62210829060898 25.659622358384393 20.932849818682005 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 2.5 29 7.5 30 10.0 31 8.5 32 17.0 33 23.5 34 24.5 35 35.5 36 50.5 37 70.0 38 97.5 39 115.5 40 127.0 41 147.5 42 168.0 43 178.0 44 190.5 45 204.0 46 201.0 47 211.0 48 204.0 49 175.5 50 157.0 51 149.5 52 138.5 53 105.0 54 93.0 55 87.5 56 84.0 57 87.0 58 77.0 59 76.0 60 76.0 61 68.5 62 61.0 63 55.5 64 53.0 65 51.0 66 51.0 67 52.0 68 48.5 69 39.5 70 32.0 71 22.5 72 20.0 73 17.5 74 10.0 75 5.0 76 2.5 77 2.0 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.40221216691804923 0.8 3 0.0 0.0 4 0.050276520864756154 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 6.0625 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACCT 10 0.006830828 145.0 4 >>END_MODULE Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907670 spots for SRR6958442.sra Written 907670 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra Read 907668 spots for SRR6958442.sra Written 907668 spots for SRR6958442.sra SRR ids: ['SRR6958442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oq9xzcan SRR6958442.sra spots: 18153362 blocks: [[1, 907668], [907669, 1815336], [1815337, 2723004], [2723005, 3630672], [3630673, 4538340], [4538341, 5446008], [5446009, 6353676], [6353677, 7261344], [7261345, 8169012], [8169013, 9076680], [9076681, 9984348], [9984349, 10892016], [10892017, 11799684], [11799685, 12707352], [12707353, 13615020], [13615021, 14522688], [14522689, 15430356], [15430357, 16338024], [16338025, 17245692], [17245693, 18153362]] SRR6958442 file size 6129878 SRR6958442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958442 SRR6958442_1.fastq SRR6958442_2.fastq Input file: SRR6958442_1.fastq Paired file: SRR6958442_2.fastq trimmed: SRR6958442-trimmed-pair1.fastq, SRR6958442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:10:00 2024 >> started Fri Dec 6 23:10:22 2024 >> done (21.517s) 18153362 read pairs processed; of these: 11939 ( 0.07%) short read pairs filtered out after trimming by size control 9985 ( 0.06%) empty read pairs filtered out after trimming by size control 18131438 (99.88%) read pairs available; of these: 6560992 (36.19%) trimmed read pairs available after processing 11570446 (63.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 10 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 7 0.00% 25 10 0.00% 26 5 0.00% 27 8 0.00% 28 10 0.00% 29 13 0.00% 30 6 0.00% 31 12 0.00% 32 9 0.00% 33 6 0.00% 34 9 0.00% 35 19 0.00% 36 24 0.00% 37 19 0.00% 38 16 0.00% 39 22 0.00% 40 22 0.00% 41 18 0.00% 42 24 0.00% 43 14 0.00% 44 29 0.00% 45 30 0.00% 46 30 0.00% 47 39 0.00% 48 49 0.00% 49 54 0.00% 50 58 0.00% 51 73 0.00% 52 60 0.00% 53 85 0.00% 54 91 0.00% 55 90 0.00% 56 97 0.00% 57 115 0.00% 58 135 0.00% 59 162 0.00% 60 177 0.00% 61 215 0.00% 62 224 0.00% 63 247 0.00% 64 313 0.00% 65 290 0.00% 66 343 0.00% 67 375 0.00% 68 474 0.00% 69 518 0.00% 70 587 0.00% 71 721 0.00% 72 777 0.00% 73 881 0.00% 74 929 0.01% 75 1131 0.01% 76 1270 0.01% 77 1456 0.01% 78 1555 0.01% 79 1790 0.01% 80 1967 0.01% 81 2242 0.01% 82 2520 0.01% 83 2912 0.02% 84 3662 0.02% 85 4257 0.02% 86 4480 0.02% 87 5038 0.03% 88 5575 0.03% 89 5798 0.03% 90 6317 0.03% 91 6987 0.04% 92 7627 0.04% 93 8121 0.04% 94 8841 0.05% 95 9434 0.05% 96 10098 0.06% 97 10901 0.06% 98 11515 0.06% 99 12418 0.07% 100 13474 0.07% 101 14076 0.08% 102 15262 0.08% 103 16176 0.09% 104 17000 0.09% 105 18133 0.10% 106 19317 0.11% 107 20104 0.11% 108 21095 0.12% 109 22207 0.12% 110 23466 0.13% 111 24467 0.13% 112 25852 0.14% 113 27053 0.15% 114 28211 0.16% 115 29783 0.16% 116 30689 0.17% 117 32116 0.18% 118 33038 0.18% 119 33909 0.19% 120 34994 0.19% 121 36818 0.20% 122 37790 0.21% 123 39533 0.22% 124 41459 0.23% 125 42983 0.24% 126 44126 0.24% 127 45831 0.25% 128 46952 0.26% 129 48040 0.26% 130 49620 0.27% 131 51461 0.28% 132 53074 0.29% 133 54505 0.30% 134 57036 0.31% 135 59124 0.33% 136 61424 0.34% 137 63096 0.35% 138 65618 0.36% 139 68253 0.38% 140 70932 0.39% 141 75871 0.42% 142 81296 0.45% 143 87385 0.48% 144 95954 0.53% 145 109374 0.60% 146 128117 0.71% 147 163190 0.90% 148 234044 1.29% 149 493481 2.72% 150 3407695 18.79% 151 11570446 63.81% 18131438 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=46.86 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=13.0 sequence=AGCTTCTCCTTGATCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.32 fanout-score-rank=20 prefix-density=0.35 prefix-fanout=3.8 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=208.15 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=20.1 sequence=AGGAAGAAGGGGATCAAGGACAAGATCAAGGAGAAGCTCCCTGGTGGTGGCCACAAAGACGGGCAGCAGACCACGGCGACCGGTGGCACCTACGGGCAGCAAAC SRR6958442 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:11:37 Started mapping on | Dec 06 23:11:37 Finished on | Dec 06 23:13:22 Mapping speed, Million of reads per hour | 621.65 Number of input reads | 18131438 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17678287 Uniquely mapped reads % | 97.50% Average mapped length | 295.12 Number of splices: Total | 20281444 Number of splices: Annotated (sjdb) | 19056017 Number of splices: GT/AG | 20008568 Number of splices: GC/AG | 230781 Number of splices: AT/AC | 10046 Number of splices: Non-canonical | 32049 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169675 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 11272 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 292253 292253 292253 N_multimapping 169675 169675 169675 N_noFeature 754521 17207561 917608 N_ambiguous 369910 2489 63392 UnstrandedReadsAssigned:16553856 PositiveStrandReadsAssigned:468237 NegativeStrandReadsAssigned:16697287 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958442-trimmed-pair1.fastq SRR6958442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,131,438 reads, 16,717,347 reads pseudoaligned [quant] estimated average fragment length: 256.066 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR6958442.ke.tsv 35125 SRR6958442.se.tsv 88098 total ==> SRR6958442.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.536 14.0726 1.86896 PNS24247 1044 788.934 34.6905 3.98001 PNS24249 1928 1672.93 58.7208 3.17708 PNS24246 1044 788.934 34.6905 3.98001 PNS24248 1044 788.934 34.6905 3.98001 PNS24244 1471 1215.93 50.1352 3.73205 PNS24243 293 94.1653 0 0 KQK14069 1603 1347.93 504.155 33.854 KQK14071 474 237.278 3.1781 1.21234 ==> SRR6958442.se.tsv <== BRADI_1g14170v3 549 BRADI_1g53295v3 491 BRADI_1g59795v3 320 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 493 BRADI_1g74790v3 353 BRADI_1g09890v3 0 BRADI_1g77505v3 278 BRADI_1g48960v3 1 SRR6958442 completed mapping pipeline successfully