Starting /dee2/code/volunteer_pipeline.sh SRR6958443 current disk space = 1547683614720 free memory = 1594971704 SRR6958443 SRAfilesize b7289d6e13a2a69d9f0486bcfa1d5be4 SRR6958443.sra SRR6958443.sra file validated SRR6958443 is paired end SRR6958443 is conventional basespace SRR6958443 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958443_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.15975 30.0 18.0 33.0 18.0 33.0 2 25.493 27.0 18.0 31.0 18.0 33.0 3 28.1055 29.0 27.0 31.0 18.0 33.0 4 30.21875 31.0 29.0 33.0 27.0 33.0 5 31.85875 33.0 31.0 33.0 29.0 33.0 6 36.18 38.0 36.0 38.0 33.0 38.0 7 36.97925 38.0 37.0 38.0 35.0 38.0 8 37.13775 38.0 38.0 38.0 35.0 38.0 9 37.45425 38.0 38.0 38.0 37.0 38.0 10-14 37.4885 38.0 38.0 38.0 37.2 38.0 15-19 37.56225 38.0 38.0 38.0 38.0 38.0 20-24 37.59415 38.0 38.0 38.0 38.0 38.0 25-29 37.5456 38.0 38.0 38.0 38.0 38.0 30-34 37.5865 38.0 38.0 38.0 38.0 38.0 35-39 37.548500000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.48145000000001 38.0 38.0 38.0 37.8 38.0 45-49 37.485850000000006 38.0 38.0 38.0 37.2 38.0 50-54 37.39314999999999 38.0 38.0 38.0 37.0 38.0 55-59 36.95355 38.0 38.0 38.0 37.0 38.0 60-64 36.6873 38.0 38.0 38.0 36.0 38.0 65-69 37.1015 38.0 38.0 38.0 36.2 38.0 70-74 37.20225 38.0 38.0 38.0 36.4 38.0 75-79 37.2389 38.0 38.0 38.0 36.4 38.0 80-84 37.08 38.0 38.0 38.0 36.0 38.0 85-89 37.04975 38.0 38.0 38.0 36.0 38.0 90-94 36.940599999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.8889 38.0 38.0 38.0 35.0 38.0 100-104 36.725350000000006 38.0 38.0 38.0 34.8 38.0 105-109 36.60414999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.43765 38.0 38.0 38.0 33.8 38.0 115-119 36.4221 38.0 38.0 38.0 33.4 38.0 120-124 36.059900000000006 38.0 37.6 38.0 32.6 38.0 125-129 35.638400000000004 38.0 36.2 38.0 31.0 38.0 130-134 35.62025 38.0 36.8 38.0 30.6 38.0 135-139 34.87605 38.0 35.8 38.0 28.6 38.0 140-144 34.46939999999999 38.0 34.8 38.0 26.6 38.0 145-149 33.94385 38.0 34.4 38.0 25.0 38.0 150-151 28.795875 34.5 18.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 0.0 19 0.0 20 1.0 21 2.0 22 6.0 23 4.0 24 5.0 25 8.0 26 10.0 27 21.0 28 19.0 29 34.0 30 35.0 31 63.0 32 84.0 33 82.0 34 185.0 35 297.0 36 785.0 37 2352.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.675000000000004 13.8 9.55 34.975 2 19.75 13.425 33.425 33.4 3 20.549999999999997 17.9 27.05 34.5 4 24.15 24.575 23.150000000000002 28.125 5 24.925 27.650000000000002 24.349999999999998 23.075000000000003 6 22.625 31.95 23.599999999999998 21.825 7 17.5 23.625 38.074999999999996 20.8 8 20.875 23.275000000000002 28.925 26.924999999999997 9 19.55 22.175 32.35 25.924999999999997 10-14 22.55014756640488 26.24681106497924 25.801610724826173 25.40143064378971 15-19 22.91 25.77 25.91 25.41 20-24 22.11 25.83 26.115 25.945 25-29 22.97 25.88 25.515 25.635 30-34 21.985 26.055 25.635 26.325 35-39 22.919999999999998 26.11 25.465 25.505 40-44 23.18 25.585 25.09 26.145000000000003 45-49 22.965 25.455 25.845000000000002 25.735000000000003 50-54 22.765 25.775 25.650000000000002 25.81 55-59 22.679682363057 25.446360831520913 25.86110970613525 26.012847099286834 60-64 23.141797490219986 25.509322765838544 25.682060661484527 25.666819082456943 65-69 22.671679197994987 25.764411027568922 25.48872180451128 26.075187969924812 70-74 23.155 25.0 25.740000000000002 26.105 75-79 23.265 25.91 24.884999999999998 25.94 80-84 22.884999999999998 25.72 25.35 26.045 85-89 22.75 25.27 25.35 26.63 90-94 23.185 25.564999999999998 25.47 25.779999999999998 95-99 23.465 25.314999999999998 25.330000000000002 25.89 100-104 23.455000000000002 25.740000000000002 24.68 26.125 105-109 23.01 24.88 25.34 26.77 110-114 23.31 24.93 25.52 26.240000000000002 115-119 23.22 24.98 25.85 25.95 120-124 23.599999999999998 24.985 25.505 25.91 125-129 23.325000000000003 25.165 25.230000000000004 26.279999999999998 130-134 23.89 25.105 25.230000000000004 25.775 135-139 23.425 25.064999999999998 25.19 26.32 140-144 22.830000000000002 25.424999999999997 25.46 26.284999999999997 145-149 23.535 25.36 24.55 26.555 150-151 23.674999999999997 25.0 25.112499999999997 26.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.0 28 3.5 29 7.0 30 12.0 31 13.5 32 18.5 33 23.0 34 29.5 35 44.0 36 55.0 37 59.5 38 73.5 39 119.0 40 148.5 41 149.5 42 151.5 43 178.0 44 199.5 45 192.0 46 192.0 47 197.0 48 199.5 49 188.0 50 180.5 51 167.5 52 145.0 53 133.0 54 116.0 55 98.0 56 83.5 57 77.0 58 74.5 59 64.0 60 56.0 61 53.5 62 53.5 63 55.0 64 49.5 65 42.5 66 40.5 67 43.0 68 39.5 69 31.0 70 30.0 71 26.5 72 21.5 73 16.5 74 13.0 75 10.5 76 6.5 77 5.5 78 3.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.045 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 1.145 60-64 1.585 65-69 0.25 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6499999999999999 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.6125 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.6625 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATCCA 10 0.0068573058 144.8125 4 >>END_MODULE SRR6958443 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958443_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77575 33.0 33.0 34.0 32.0 34.0 2 32.796 33.0 33.0 34.0 32.0 34.0 3 32.8645 34.0 33.0 34.0 32.0 34.0 4 32.763 34.0 33.0 34.0 32.0 34.0 5 32.793 34.0 33.0 34.0 32.0 34.0 6 36.95575 38.0 38.0 38.0 36.0 38.0 7 36.8335 38.0 38.0 38.0 36.0 38.0 8 36.881 38.0 38.0 38.0 36.0 38.0 9 36.8425 38.0 38.0 38.0 36.0 38.0 10-14 36.7986 38.0 38.0 38.0 36.0 38.0 15-19 36.7688 38.0 38.0 38.0 36.0 38.0 20-24 36.7066 38.0 38.0 38.0 36.0 38.0 25-29 36.71935 38.0 38.0 38.0 36.0 38.0 30-34 36.73655 38.0 38.0 38.0 36.0 38.0 35-39 36.67355 38.0 38.0 38.0 36.0 38.0 40-44 36.61865 38.0 38.0 38.0 35.8 38.0 45-49 36.622949999999996 38.0 38.0 38.0 35.8 38.0 50-54 36.542 38.0 38.0 38.0 35.2 38.0 55-59 36.4947 38.0 38.0 38.0 35.0 38.0 60-64 36.4079 38.0 38.0 38.0 34.6 38.0 65-69 36.35125 38.0 38.0 38.0 34.6 38.0 70-74 36.28830000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.2257 38.0 38.0 38.0 34.0 38.0 80-84 36.1936 38.0 38.0 38.0 34.0 38.0 85-89 36.12155 38.0 38.0 38.0 34.0 38.0 90-94 35.98205 38.0 38.0 38.0 34.0 38.0 95-99 35.84425 38.0 38.0 38.0 33.4 38.0 100-104 35.72409999999999 38.0 38.0 38.0 32.8 38.0 105-109 35.4751 38.0 37.4 38.0 31.4 38.0 110-114 35.21825 38.0 36.6 38.0 30.0 38.0 115-119 35.1006 38.0 36.2 38.0 29.2 38.0 120-124 35.05479999999999 38.0 36.0 38.0 29.4 38.0 125-129 34.88275 38.0 36.0 38.0 28.2 38.0 130-134 34.680099999999996 38.0 35.6 38.0 27.2 38.0 135-139 34.47429999999999 38.0 35.0 38.0 26.8 38.0 140-144 34.074799999999996 38.0 34.6 38.0 24.6 38.0 145-149 33.7142 38.0 33.4 38.0 23.2 38.0 150-151 29.388375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 11.0 4 1.0 5 5.0 6 2.0 7 5.0 8 3.0 9 4.0 10 2.0 11 1.0 12 4.0 13 4.0 14 2.0 15 3.0 16 3.0 17 3.0 18 8.0 19 5.0 20 3.0 21 9.0 22 9.0 23 8.0 24 12.0 25 18.0 26 28.0 27 18.0 28 32.0 29 30.0 30 45.0 31 49.0 32 85.0 33 116.0 34 143.0 35 214.0 36 575.0 37 2515.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.15 18.5 13.05 26.3 2 30.25 23.1 25.324999999999996 21.325 3 25.3 25.3 27.925 21.475 4 26.974999999999998 30.475 19.950000000000003 22.6 5 26.150000000000002 33.95 20.724999999999998 19.175 6 23.724999999999998 33.35 21.224999999999998 21.7 7 23.25 20.674999999999997 32.675 23.400000000000002 8 26.325 23.325000000000003 22.35 28.000000000000004 9 24.8 23.1 25.974999999999998 26.125 10-14 26.33 25.215 23.75 24.705 15-19 26.51 24.97 24.535 23.985 20-24 25.52 25.355 24.525 24.6 25-29 25.615 26.165 23.935000000000002 24.285 30-34 25.635 25.305 24.735 24.325 35-39 25.905 25.555 24.315 24.224999999999998 40-44 26.240000000000002 25.485000000000003 24.38 23.895 45-49 26.47 25.45 23.695 24.385 50-54 26.36 25.36 24.605 23.674999999999997 55-59 26.025 24.884999999999998 24.779999999999998 24.310000000000002 60-64 26.655 24.485 24.415 24.445 65-69 26.5 25.195 23.84 24.465 70-74 26.314999999999998 25.27 24.695 23.72 75-79 26.565 24.62 24.955 23.86 80-84 26.674999999999997 25.624999999999996 24.315 23.385 85-89 26.41 25.025 24.62 23.945 90-94 25.965 25.825 24.745 23.465 95-99 26.69 25.41 24.075 23.825 100-104 26.669999999999998 25.6 24.14 23.59 105-109 25.945 25.324999999999996 25.174999999999997 23.555 110-114 26.865 24.6 24.93 23.605 115-119 26.08 25.669999999999998 24.785 23.465 120-124 26.845000000000002 25.695 24.645 22.814999999999998 125-129 27.01 25.174999999999997 24.65 23.165 130-134 27.525 25.605 24.535 22.335 135-139 27.155 25.64 24.92 22.285 140-144 27.02 25.724999999999998 24.93 22.325 145-149 26.924999999999997 26.045 24.515 22.515 150-151 26.6125 26.025 24.75 22.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 3.0 27 4.0 28 2.5 29 2.5 30 5.5 31 8.0 32 9.0 33 13.5 34 17.0 35 24.0 36 40.5 37 52.5 38 64.0 39 82.5 40 106.0 41 129.5 42 164.0 43 183.0 44 180.5 45 188.5 46 211.0 47 214.5 48 188.0 49 181.0 50 175.0 51 154.0 52 123.5 53 107.5 54 107.0 55 109.5 56 100.0 57 86.5 58 91.5 59 80.5 60 75.0 61 74.0 62 69.0 63 65.5 64 61.5 65 64.0 66 53.0 67 49.5 68 52.5 69 50.5 70 41.5 71 25.0 72 23.0 73 20.5 74 15.0 75 13.5 76 9.0 77 7.0 78 5.0 79 2.5 80 1.5 81 2.5 82 2.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.1375000000000002 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.5375 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 2.9749999999999996 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTCT 10 0.006830828 145.0 5 ATTTCTG 10 0.006830828 145.0 6 >>END_MODULE Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168407 spots for SRR6958443.sra Written 1168407 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra Read 1168396 spots for SRR6958443.sra Written 1168396 spots for SRR6958443.sra SRR ids: ['SRR6958443.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ai_nusbt SRR6958443.sra spots: 23367931 blocks: [[1, 1168396], [1168397, 2336792], [2336793, 3505188], [3505189, 4673584], [4673585, 5841980], [5841981, 7010376], [7010377, 8178772], [8178773, 9347168], [9347169, 10515564], [10515565, 11683960], [11683961, 12852356], [12852357, 14020752], [14020753, 15189148], [15189149, 16357544], [16357545, 17525940], [17525941, 18694336], [18694337, 19862732], [19862733, 21031128], [21031129, 22199524], [22199525, 23367931]] SRR6958443 file size 7896924 SRR6958443 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958443 SRR6958443_1.fastq SRR6958443_2.fastq Input file: SRR6958443_1.fastq Paired file: SRR6958443_2.fastq trimmed: SRR6958443-trimmed-pair1.fastq, SRR6958443-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:12:36 2024 >> started Fri Dec 6 23:13:07 2024 >> done (31.429s) 23367931 read pairs processed; of these: 76873 ( 0.33%) short read pairs filtered out after trimming by size control 80178 ( 0.34%) empty read pairs filtered out after trimming by size control 23210880 (99.33%) read pairs available; of these: 9141444 (39.38%) trimmed read pairs available after processing 14069436 (60.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 8 0.00% 21 5 0.00% 22 4 0.00% 23 14 0.00% 24 7 0.00% 25 9 0.00% 26 7 0.00% 27 10 0.00% 28 8 0.00% 29 10 0.00% 30 14 0.00% 31 11 0.00% 32 7 0.00% 33 10 0.00% 34 6 0.00% 35 12 0.00% 36 16 0.00% 37 6 0.00% 38 21 0.00% 39 12 0.00% 40 8 0.00% 41 26 0.00% 42 13 0.00% 43 19 0.00% 44 16 0.00% 45 21 0.00% 46 28 0.00% 47 30 0.00% 48 28 0.00% 49 44 0.00% 50 46 0.00% 51 59 0.00% 52 60 0.00% 53 47 0.00% 54 54 0.00% 55 69 0.00% 56 70 0.00% 57 77 0.00% 58 104 0.00% 59 89 0.00% 60 109 0.00% 61 155 0.00% 62 141 0.00% 63 169 0.00% 64 174 0.00% 65 206 0.00% 66 221 0.00% 67 243 0.00% 68 272 0.00% 69 368 0.00% 70 379 0.00% 71 418 0.00% 72 464 0.00% 73 544 0.00% 74 595 0.00% 75 682 0.00% 76 829 0.00% 77 868 0.00% 78 1005 0.00% 79 1105 0.00% 80 1277 0.01% 81 1464 0.01% 82 1734 0.01% 83 2121 0.01% 84 4702 0.02% 85 6092 0.03% 86 6354 0.03% 87 6633 0.03% 88 6672 0.03% 89 6544 0.03% 90 6719 0.03% 91 6931 0.03% 92 7376 0.03% 93 7722 0.03% 94 7801 0.03% 95 8063 0.03% 96 8420 0.04% 97 8870 0.04% 98 9368 0.04% 99 9889 0.04% 100 10525 0.05% 101 11094 0.05% 102 11994 0.05% 103 12491 0.05% 104 13352 0.06% 105 14514 0.06% 106 15154 0.07% 107 15635 0.07% 108 16547 0.07% 109 17186 0.07% 110 17984 0.08% 111 19400 0.08% 112 20713 0.09% 113 22021 0.09% 114 23085 0.10% 115 24596 0.11% 116 26179 0.11% 117 26664 0.11% 118 27863 0.12% 119 29002 0.12% 120 29848 0.13% 121 31750 0.14% 122 33501 0.14% 123 34990 0.15% 124 36848 0.16% 125 38360 0.17% 126 39987 0.17% 127 41559 0.18% 128 43316 0.19% 129 44614 0.19% 130 46436 0.20% 131 48851 0.21% 132 51585 0.22% 133 54523 0.23% 134 57152 0.25% 135 60524 0.26% 136 64589 0.28% 137 68549 0.30% 138 72755 0.31% 139 77503 0.33% 140 83078 0.36% 141 88960 0.38% 142 97972 0.42% 143 108776 0.47% 144 125883 0.54% 145 146674 0.63% 146 181052 0.78% 147 252622 1.09% 148 371420 1.60% 149 753088 3.24% 150 5443869 23.45% 151 14069436 60.62% 23210880 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=38 prefix-density=0.60 prefix-fanout=2.4 sequence=GAGCTGGAGCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=332.68 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=31.8 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=16.16 fanout-score-rank=8 prefix-density=1.29 prefix-fanout=4.5 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=162.75 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=25.7 sequence=CGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR6958443 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:13:52 Started mapping on | Dec 06 23:13:52 Finished on | Dec 06 23:16:08 Mapping speed, Million of reads per hour | 614.41 Number of input reads | 23210880 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21934193 Uniquely mapped reads % | 94.50% Average mapped length | 296.43 Number of splices: Total | 20388635 Number of splices: Annotated (sjdb) | 18872945 Number of splices: GT/AG | 20118179 Number of splices: GC/AG | 209107 Number of splices: AT/AC | 9546 Number of splices: Non-canonical | 51803 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193766 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 48205 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 1.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1126191 1126191 1126191 N_multimapping 193766 193766 193766 N_noFeature 1197097 21143988 1549101 N_ambiguous 527296 4818 90039 UnstrandedReadsAssigned:20209800 PositiveStrandReadsAssigned:785387 NegativeStrandReadsAssigned:20295053 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958443 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958443-trimmed-pair1.fastq SRR6958443-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,210,880 reads, 20,277,400 reads pseudoaligned [quant] estimated average fragment length: 266.64 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,269 rounds 52973 SRR6958443.ke.tsv 35125 SRR6958443.se.tsv 88098 total ==> SRR6958443.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.819 233.093 23.8678 PNS24247 1044 778.36 83.5009 7.36882 PNS24249 1928 1662.36 251.473 10.3909 PNS24246 1044 778.36 83.5009 7.36882 PNS24248 1044 778.36 83.5009 7.36882 PNS24244 1471 1205.36 133.931 7.63224 PNS24243 293 84.1927 0 0 KQK14069 1603 1337.36 253.063 12.9977 KQK14071 474 224.041 4.6253 1.41807 ==> SRR6958443.se.tsv <== BRADI_1g14170v3 281 BRADI_1g53295v3 595 BRADI_1g59795v3 132 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 853 BRADI_1g74790v3 1397 BRADI_1g09890v3 0 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR6958443 completed mapping pipeline successfully