Starting /dee2/code/volunteer_pipeline.sh SRR6958444 current disk space = 1547567878144 free memory = 1599838064 SRR6958444 SRAfilesize 140e469b1e271f9eea59ad1e3f91edea SRR6958444.sra SRR6958444.sra file validated SRR6958444 is paired end SRR6958444 is conventional basespace SRR6958444 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.24 28.0 18.0 33.0 18.0 33.0 2 28.82225 29.0 27.0 33.0 25.0 33.0 3 31.03275 33.0 30.0 33.0 27.0 33.0 4 32.2655 33.0 32.0 33.0 32.0 33.0 5 32.56825 33.0 33.0 33.0 32.0 34.0 6 37.0885 38.0 37.0 38.0 36.0 38.0 7 37.4425 38.0 38.0 38.0 37.0 38.0 8 37.46425 38.0 38.0 38.0 37.0 38.0 9 37.465 38.0 38.0 38.0 37.0 38.0 10-14 36.27 38.0 36.2 38.0 31.6 38.0 15-19 37.478300000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.576350000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.524800000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.18575 38.0 38.0 38.0 36.8 38.0 35-39 37.32475 38.0 38.0 38.0 37.0 38.0 40-44 37.2596 38.0 38.0 38.0 36.8 38.0 45-49 36.779250000000005 38.0 37.6 38.0 34.4 38.0 50-54 37.3403 38.0 38.0 38.0 36.8 38.0 55-59 37.31079999999999 38.0 38.0 38.0 36.8 38.0 60-64 37.30005 38.0 38.0 38.0 36.8 38.0 65-69 37.21705 38.0 38.0 38.0 36.6 38.0 70-74 37.285000000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.2188 38.0 38.0 38.0 36.6 38.0 80-84 37.1873 38.0 38.0 38.0 36.2 38.0 85-89 36.064049999999995 38.0 36.6 38.0 30.0 38.0 90-94 35.0492 38.0 35.0 38.0 25.8 38.0 95-99 36.747499999999995 38.0 37.8 38.0 35.0 38.0 100-104 36.910199999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.84115 38.0 38.0 38.0 34.8 38.0 110-114 36.759699999999995 38.0 38.0 38.0 34.4 38.0 115-119 36.49775 38.0 38.0 38.0 34.2 38.0 120-124 36.2869 38.0 38.0 38.0 34.0 38.0 125-129 36.1553 38.0 37.8 38.0 33.4 38.0 130-134 36.111650000000004 38.0 37.6 38.0 33.0 38.0 135-139 36.014849999999996 38.0 37.2 38.0 32.6 38.0 140-144 35.54905 38.0 36.0 38.0 31.6 38.0 145-149 33.6783 38.0 33.0 38.0 24.4 38.0 150-151 30.982 35.5 30.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 0.0 19 3.0 20 1.0 21 1.0 22 3.0 23 2.0 24 8.0 25 4.0 26 12.0 27 25.0 28 23.0 29 27.0 30 34.0 31 46.0 32 71.0 33 105.0 34 154.0 35 289.0 36 839.0 37 2349.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.71016376397193 9.14998700285937 5.952690408110215 40.18715882505849 2 25.2 12.174999999999999 35.0 27.625 3 20.974999999999998 16.3 23.95 38.775 4 26.05 24.9 20.724999999999998 28.325 5 26.174999999999997 28.15 24.325 21.349999999999998 6 22.15 32.275 23.225 22.35 7 17.224999999999998 23.575 39.825 19.375 8 19.5 23.825 30.275000000000002 26.400000000000002 9 20.1 22.1 33.300000000000004 24.5 10-14 23.095 26.555 26.06 24.29 15-19 22.975 25.44 25.585 26.0 20-24 22.535 25.515 26.375 25.575 25-29 22.830000000000002 25.055 26.005 26.11 30-34 22.795 25.374999999999996 26.5 25.330000000000002 35-39 23.175 25.28 25.705 25.840000000000003 40-44 22.985 25.590000000000003 25.96 25.465 45-49 23.225 25.385 26.075 25.314999999999998 50-54 22.53 25.82 26.135 25.515 55-59 23.075000000000003 25.755 25.69 25.480000000000004 60-64 23.400000000000002 25.430000000000003 25.39 25.779999999999998 65-69 22.919999999999998 25.900000000000002 25.874999999999996 25.305 70-74 22.935 25.355 26.185000000000002 25.525 75-79 23.294999999999998 25.455 25.555 25.695 80-84 22.67 25.575 26.284999999999997 25.47 85-89 23.085 25.31 26.07 25.535000000000004 90-94 22.82 25.445 25.89 25.845000000000002 95-99 23.665 24.765 26.5 25.069999999999997 100-104 23.535 25.124999999999996 25.924999999999997 25.415 105-109 23.65 25.619999999999997 25.695 25.035 110-114 23.29 24.94 25.374999999999996 26.395000000000003 115-119 23.810000000000002 25.28 25.965 24.945 120-124 22.96 25.96 25.195 25.885 125-129 23.27 25.15 25.5 26.08 130-134 23.990000000000002 25.869999999999997 25.040000000000003 25.1 135-139 23.52 25.7 25.224999999999998 25.555 140-144 23.835 25.39 24.86 25.915 145-149 23.39 25.545 25.555 25.509999999999998 150-151 23.799999999999997 25.4875 25.7375 24.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.5 27 3.0 28 3.0 29 9.0 30 13.0 31 12.5 32 13.5 33 16.0 34 29.0 35 42.0 36 49.0 37 64.0 38 86.0 39 113.0 40 134.0 41 143.5 42 172.5 43 206.0 44 202.0 45 199.5 46 197.0 47 183.5 48 195.5 49 195.0 50 167.5 51 153.5 52 138.0 53 118.5 54 108.5 55 97.0 56 90.5 57 85.0 58 70.5 59 74.0 60 80.0 61 74.0 62 66.5 63 55.5 64 55.0 65 48.5 66 41.5 67 38.5 68 30.0 69 24.5 70 18.0 71 13.5 72 16.5 73 16.0 74 11.5 75 8.5 76 5.5 77 3.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8249999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7999999999999998 0.0 0.0 0.0 0.0 118-119 2.0374999999999996 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.4625 0.0 0.0 0.0 0.0 124-125 2.7750000000000004 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.5875000000000004 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 4.987500000000001 0.0 0.0 0.0 0.0 136-137 5.4375 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGAC 10 0.0063298983 148.6923 1 GGCCTTC 10 0.0063298983 148.6923 1 TTCTTCT 10 0.0068343505 144.975 5 >>END_MODULE SRR6958444 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70225 33.0 33.0 34.0 32.0 34.0 2 33.022 33.0 33.0 34.0 32.0 34.0 3 33.128 34.0 33.0 34.0 32.0 34.0 4 32.664 34.0 33.0 34.0 32.0 34.0 5 33.005 34.0 33.0 34.0 32.0 34.0 6 37.249 38.0 38.0 38.0 37.0 38.0 7 37.35125 38.0 38.0 38.0 37.0 38.0 8 37.24 38.0 38.0 38.0 37.0 38.0 9 37.33525 38.0 38.0 38.0 37.0 38.0 10-14 36.97825 38.0 37.8 38.0 35.4 38.0 15-19 37.276599999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.33305 38.0 38.0 38.0 37.0 38.0 25-29 37.2402 38.0 38.0 38.0 37.0 38.0 30-34 37.30625 38.0 38.0 38.0 37.0 38.0 35-39 36.9282 38.0 38.0 38.0 35.6 38.0 40-44 36.53455 38.0 37.8 38.0 33.8 38.0 45-49 36.9851 38.0 38.0 38.0 36.0 38.0 50-54 36.831450000000004 38.0 38.0 38.0 35.2 38.0 55-59 36.756800000000005 38.0 38.0 38.0 34.4 38.0 60-64 36.774 38.0 38.0 38.0 34.8 38.0 65-69 36.7733 38.0 38.0 38.0 35.0 38.0 70-74 36.46835 38.0 37.6 38.0 33.2 38.0 75-79 36.98725 38.0 38.0 38.0 35.8 38.0 80-84 36.8692 38.0 38.0 38.0 35.8 38.0 85-89 36.807050000000004 38.0 38.0 38.0 35.4 38.0 90-94 34.70145 37.8 34.6 38.0 26.2 38.0 95-99 36.31595 38.0 37.8 38.0 33.4 38.0 100-104 36.534600000000005 38.0 38.0 38.0 34.4 38.0 105-109 35.785399999999996 38.0 36.8 38.0 29.2 38.0 110-114 36.34009999999999 38.0 38.0 38.0 33.8 38.0 115-119 36.302350000000004 38.0 38.0 38.0 33.8 38.0 120-124 35.97435 38.0 37.4 38.0 32.8 38.0 125-129 35.61945 38.0 37.0 38.0 31.0 38.0 130-134 35.4994 38.0 36.0 38.0 31.0 38.0 135-139 35.244949999999996 38.0 36.2 38.0 31.0 38.0 140-144 34.80925 38.0 36.0 38.0 29.8 38.0 145-149 32.6945 37.6 32.8 38.0 18.6 38.0 150-151 27.434625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 3.0 13 1.0 14 2.0 15 1.0 16 0.0 17 4.0 18 3.0 19 2.0 20 3.0 21 3.0 22 7.0 23 14.0 24 12.0 25 14.0 26 21.0 27 26.0 28 35.0 29 28.0 30 50.0 31 62.0 32 95.0 33 121.0 34 168.0 35 302.0 36 690.0 37 2328.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 19.55 9.625 32.824999999999996 2 29.775000000000002 23.75 29.075 17.4 3 22.15 26.424999999999997 27.375 24.05 4 25.575 31.7 20.175 22.55 5 27.1 33.925 19.375 19.6 6 23.125 36.175000000000004 19.675 21.025 7 22.95 19.725 34.1 23.225 8 23.974999999999998 23.425 24.325 28.275 9 23.425 22.0 29.375 25.2 10-14 26.240000000000002 25.919999999999998 23.52 24.32 15-19 25.515 25.765 24.654999999999998 24.065 20-24 25.745 26.090000000000003 24.305 23.86 25-29 25.295 25.27 24.959999999999997 24.474999999999998 30-34 25.240000000000002 26.33 24.245 24.185000000000002 35-39 25.82 25.765 24.404999999999998 24.01 40-44 25.3 25.69 24.525 24.485 45-49 25.275 25.66 25.025 24.04 50-54 25.69 25.374999999999996 25.064999999999998 23.87 55-59 26.19 25.665 24.625 23.52 60-64 25.515 25.215 25.215 24.055 65-69 25.09 26.35 24.34 24.22 70-74 26.205000000000002 25.205 25.155 23.435 75-79 25.495 25.405 25.055 24.044999999999998 80-84 25.515 25.665 24.595 24.224999999999998 85-89 26.06 25.53 24.59 23.82 90-94 25.545 26.090000000000003 24.865000000000002 23.5 95-99 25.650000000000002 25.7 24.759999999999998 23.89 100-104 25.935000000000002 25.290000000000003 24.9 23.875 105-109 25.285000000000004 25.540000000000003 25.085 24.09 110-114 25.97 26.235000000000003 24.855 22.939999999999998 115-119 26.465 25.8 24.535 23.200000000000003 120-124 26.355 25.95 24.610000000000003 23.085 125-129 26.395000000000003 25.715 24.315 23.575 130-134 26.87 25.735000000000003 24.834999999999997 22.56 135-139 25.924999999999997 25.855 24.884999999999998 23.335 140-144 26.795 26.145000000000003 24.86 22.2 145-149 26.61 25.83 24.795 22.765 150-151 27.825 26.087500000000002 24.05 22.037499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 3.0 29 6.5 30 6.5 31 7.5 32 10.5 33 20.0 34 29.0 35 34.0 36 50.0 37 56.0 38 69.0 39 101.0 40 125.5 41 149.0 42 178.5 43 188.0 44 189.5 45 193.5 46 190.5 47 186.5 48 180.5 49 171.5 50 165.0 51 144.0 52 110.5 53 98.0 54 113.5 55 114.0 56 99.5 57 98.0 58 89.5 59 88.5 60 90.0 61 84.0 62 73.0 63 68.0 64 64.0 65 54.0 66 50.0 67 45.0 68 41.5 69 38.0 70 31.5 71 31.0 72 25.5 73 14.0 74 8.0 75 5.0 76 3.0 77 2.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34376577486118 98.4 2 0.5047955577990914 1.0 3 0.025239777889954566 0.075 4 0.10095911155981827 0.4 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7999999999999998 0.0 0.0 0.0 0.0 118-119 2.0374999999999996 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.4625 0.0 0.0 0.0 0.0 124-125 2.7750000000000004 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 5.012499999999999 0.0 0.0 0.0 0.0 136-137 5.45 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTCTA 10 0.006830828 145.0 9 >>END_MODULE Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066606 spots for SRR6958444.sra Written 1066606 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra Read 1066605 spots for SRR6958444.sra Written 1066605 spots for SRR6958444.sra SRR ids: ['SRR6958444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_20vnqtx1 SRR6958444.sra spots: 21332101 blocks: [[1, 1066605], [1066606, 2133210], [2133211, 3199815], [3199816, 4266420], [4266421, 5333025], [5333026, 6399630], [6399631, 7466235], [7466236, 8532840], [8532841, 9599445], [9599446, 10666050], [10666051, 11732655], [11732656, 12799260], [12799261, 13865865], [13865866, 14932470], [14932471, 15999075], [15999076, 17065680], [17065681, 18132285], [18132286, 19198890], [19198891, 20265495], [20265496, 21332101]] SRR6958444 file size 7207048 SRR6958444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958444 SRR6958444_1.fastq SRR6958444_2.fastq Input file: SRR6958444_1.fastq Paired file: SRR6958444_2.fastq trimmed: SRR6958444-trimmed-pair1.fastq, SRR6958444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:12:08 2024 >> started Fri Dec 6 23:12:30 2024 >> done (22.174s) 21332101 read pairs processed; of these: 11488 ( 0.05%) short read pairs filtered out after trimming by size control 9638 ( 0.05%) empty read pairs filtered out after trimming by size control 21310975 (99.90%) read pairs available; of these: 7847751 (36.82%) trimmed read pairs available after processing 13463224 (63.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 4 0.00% 21 5 0.00% 22 10 0.00% 23 8 0.00% 24 10 0.00% 25 9 0.00% 26 11 0.00% 27 10 0.00% 28 10 0.00% 29 12 0.00% 30 11 0.00% 31 11 0.00% 32 21 0.00% 33 15 0.00% 34 18 0.00% 35 10 0.00% 36 20 0.00% 37 19 0.00% 38 33 0.00% 39 23 0.00% 40 31 0.00% 41 18 0.00% 42 29 0.00% 43 25 0.00% 44 32 0.00% 45 38 0.00% 46 37 0.00% 47 36 0.00% 48 43 0.00% 49 56 0.00% 50 62 0.00% 51 57 0.00% 52 87 0.00% 53 87 0.00% 54 74 0.00% 55 107 0.00% 56 103 0.00% 57 107 0.00% 58 138 0.00% 59 190 0.00% 60 200 0.00% 61 233 0.00% 62 260 0.00% 63 287 0.00% 64 305 0.00% 65 367 0.00% 66 395 0.00% 67 421 0.00% 68 504 0.00% 69 513 0.00% 70 580 0.00% 71 674 0.00% 72 782 0.00% 73 944 0.00% 74 1024 0.00% 75 1130 0.01% 76 1263 0.01% 77 1457 0.01% 78 1513 0.01% 79 1850 0.01% 80 1940 0.01% 81 2315 0.01% 82 2555 0.01% 83 2936 0.01% 84 3705 0.02% 85 4415 0.02% 86 4619 0.02% 87 5031 0.02% 88 5635 0.03% 89 5996 0.03% 90 6479 0.03% 91 7224 0.03% 92 7496 0.04% 93 8247 0.04% 94 9050 0.04% 95 9653 0.05% 96 10617 0.05% 97 11117 0.05% 98 11781 0.06% 99 12758 0.06% 100 13755 0.06% 101 14592 0.07% 102 15578 0.07% 103 16608 0.08% 104 17989 0.08% 105 18817 0.09% 106 20021 0.09% 107 20658 0.10% 108 21931 0.10% 109 22985 0.11% 110 24187 0.11% 111 25340 0.12% 112 27131 0.13% 113 28540 0.13% 114 29286 0.14% 115 31083 0.15% 116 32667 0.15% 117 33534 0.16% 118 35057 0.16% 119 36314 0.17% 120 37488 0.18% 121 39283 0.18% 122 40112 0.19% 123 42243 0.20% 124 44209 0.21% 125 45274 0.21% 126 47230 0.22% 127 49363 0.23% 128 50497 0.24% 129 52196 0.24% 130 53562 0.25% 131 55835 0.26% 132 58146 0.27% 133 60648 0.28% 134 62646 0.29% 135 65389 0.31% 136 68585 0.32% 137 71193 0.33% 138 73662 0.35% 139 78453 0.37% 140 82861 0.39% 141 88403 0.41% 142 95924 0.45% 143 104830 0.49% 144 117056 0.55% 145 136239 0.64% 146 164284 0.77% 147 214648 1.01% 148 312523 1.47% 149 604843 2.84% 150 4194139 19.68% 151 13463224 63.18% 21310975 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=23 prefix-density=0.69 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=37.77 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=50.77 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.0 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958444 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:14:03 Started mapping on | Dec 06 23:14:04 Finished on | Dec 06 23:16:15 Mapping speed, Million of reads per hour | 585.65 Number of input reads | 21310975 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20726891 Uniquely mapped reads % | 97.26% Average mapped length | 295.34 Number of splices: Total | 23788103 Number of splices: Annotated (sjdb) | 22328017 Number of splices: GT/AG | 23453075 Number of splices: GC/AG | 275982 Number of splices: AT/AC | 9506 Number of splices: Non-canonical | 49540 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245437 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 9059 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 347084 347084 347084 N_multimapping 245437 245437 245437 N_noFeature 863519 20108682 1052037 N_ambiguous 506977 2780 77912 UnstrandedReadsAssigned:19356395 PositiveStrandReadsAssigned:615429 NegativeStrandReadsAssigned:19596942 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958444-trimmed-pair1.fastq SRR6958444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,310,975 reads, 19,579,931 reads pseudoaligned [quant] estimated average fragment length: 264.217 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958444.ke.tsv 35125 SRR6958444.se.tsv 88098 total ==> SRR6958444.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.384 0 0 PNS24247 1044 780.783 41.6689 4.10852 PNS24249 1928 1664.78 49.7162 2.29902 PNS24246 1044 780.783 41.6689 4.10852 PNS24248 1044 780.783 41.6689 4.10852 PNS24244 1471 1207.78 32.277 2.05735 PNS24243 293 91.2891 0 0 KQK14069 1603 1339.78 4714.31 270.886 KQK14071 474 230.692 115.864 38.6651 ==> SRR6958444.se.tsv <== BRADI_1g14170v3 5748 BRADI_1g53295v3 1491 BRADI_1g59795v3 128 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 414 BRADI_1g74790v3 132 BRADI_1g09890v3 1 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR6958444 completed mapping pipeline successfully