Starting /dee2/code/volunteer_pipeline.sh SRR6958445 current disk space = 1547489968128 free memory = 1599825372 SRR6958445 SRAfilesize 8eeef19e6f5860a2294fcdae64d10cc5 SRR6958445.sra SRR6958445.sra file validated SRR6958445 is paired end SRR6958445 is conventional basespace SRR6958445 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.933 18.0 18.0 30.0 18.0 32.0 2 23.7275 25.0 18.0 28.0 18.0 31.0 3 27.53475 27.0 27.0 30.0 25.0 33.0 4 27.737 29.0 27.0 31.0 15.0 33.0 5 30.38125 31.0 29.0 33.0 27.0 33.0 6 36.0605 37.0 36.0 38.0 33.0 38.0 7 36.88025 38.0 37.0 38.0 35.0 38.0 8 37.1625 38.0 38.0 38.0 36.0 38.0 9 37.25075 38.0 38.0 38.0 36.0 38.0 10-14 37.257600000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.32085 38.0 38.0 38.0 36.8 38.0 20-24 37.242399999999996 38.0 38.0 38.0 36.6 38.0 25-29 37.09465 38.0 38.0 38.0 36.0 38.0 30-34 36.939350000000005 38.0 38.0 38.0 35.8 38.0 35-39 36.953250000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.88005 38.0 38.0 38.0 35.0 38.0 45-49 36.739599999999996 38.0 38.0 38.0 34.8 38.0 50-54 36.326800000000006 38.0 37.8 38.0 33.4 38.0 55-59 36.40839999999999 38.0 38.0 38.0 33.6 38.0 60-64 36.6066 38.0 38.0 38.0 34.2 38.0 65-69 36.8349 38.0 38.0 38.0 34.8 38.0 70-74 36.52995 38.0 38.0 38.0 34.0 38.0 75-79 36.02835 38.0 37.0 38.0 32.2 38.0 80-84 35.965999999999994 38.0 37.0 38.0 32.0 38.0 85-89 36.1669 38.0 37.4 38.0 33.0 38.0 90-94 36.050850000000004 38.0 37.0 38.0 32.6 38.0 95-99 35.634249999999994 38.0 36.2 38.0 30.6 38.0 100-104 35.03789999999999 38.0 35.2 38.0 27.6 38.0 105-109 34.575649999999996 38.0 34.6 38.0 24.8 38.0 110-114 34.742650000000005 38.0 34.8 38.0 26.6 38.0 115-119 34.219950000000004 38.0 34.4 38.0 24.2 38.0 120-124 34.0252 38.0 33.8 38.0 21.8 38.0 125-129 34.131600000000006 38.0 34.2 38.0 23.6 38.0 130-134 33.430949999999996 37.8 33.4 38.0 20.6 38.0 135-139 32.78855 37.6 32.0 38.0 18.2 38.0 140-144 31.8204 36.0 31.0 38.0 13.4 38.0 145-149 29.7106 34.8 28.4 38.0 6.4 38.0 150-151 24.10725 32.0 8.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 3.0 16 2.0 17 4.0 18 4.0 19 6.0 20 4.0 21 7.0 22 12.0 23 10.0 24 14.0 25 14.0 26 39.0 27 49.0 28 61.0 29 75.0 30 87.0 31 116.0 32 159.0 33 215.0 34 346.0 35 600.0 36 1128.0 37 1042.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.81182795698925 17.28494623655914 4.89247311827957 43.01075268817204 2 22.075 9.75 31.85 36.325 3 20.625 17.125 24.45 37.8 4 26.625 24.7 19.8 28.875 5 25.224999999999998 26.6 24.099999999999998 24.075 6 23.674999999999997 31.724999999999998 22.375 22.225 7 17.474999999999998 23.849999999999998 38.574999999999996 20.1 8 21.45 24.175 27.250000000000004 27.125 9 19.925 22.3 32.9 24.875 10-14 22.830000000000002 25.745 25.955000000000002 25.47 15-19 23.115 24.759999999999998 26.115 26.009999999999998 20-24 23.31 25.005 26.125 25.56 25-29 23.325000000000003 25.064999999999998 25.1 26.51 30-34 23.61 24.84 26.064999999999998 25.485000000000003 35-39 23.419999999999998 24.785 25.055 26.740000000000002 40-44 23.32 24.905 25.474999999999998 26.3 45-49 23.79 24.740000000000002 25.564999999999998 25.905 50-54 23.294999999999998 24.89 25.724999999999998 26.090000000000003 55-59 23.385 24.955 25.64 26.02 60-64 23.84 24.834999999999997 25.825 25.5 65-69 23.755000000000003 24.615000000000002 25.324999999999996 26.305 70-74 23.435 25.155 25.6 25.81 75-79 23.799999999999997 24.505 25.679999999999996 26.015 80-84 23.765 24.9 25.245 26.090000000000003 85-89 23.400000000000002 23.96 26.07 26.57 90-94 23.974999999999998 24.6 25.240000000000002 26.185000000000002 95-99 24.185000000000002 24.22 25.39 26.205000000000002 100-104 23.54 24.535 25.89 26.035000000000004 105-109 24.435000000000002 24.33 25.424999999999997 25.81 110-114 24.34 23.73 25.490000000000002 26.44 115-119 24.585 24.555 25.240000000000002 25.619999999999997 120-124 24.12 24.255 25.455 26.169999999999998 125-129 24.575 24.485 25.074999999999996 25.865 130-134 24.005000000000003 24.560000000000002 25.369999999999997 26.064999999999998 135-139 24.675 24.45 24.91 25.965 140-144 25.045 24.775 24.86 25.319999999999997 145-149 24.87 24.245 25.419999999999998 25.465 150-151 24.637500000000003 24.6 24.7375 26.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 0.0 28 1.5 29 2.5 30 4.0 31 6.0 32 7.0 33 12.0 34 22.5 35 33.0 36 44.0 37 60.0 38 70.5 39 89.5 40 121.5 41 145.5 42 178.5 43 203.5 44 209.0 45 199.0 46 192.5 47 188.5 48 180.5 49 165.0 50 159.5 51 153.5 52 135.0 53 124.0 54 103.0 55 89.0 56 97.5 57 102.5 58 95.5 59 86.0 60 71.5 61 74.0 62 67.0 63 61.5 64 71.5 65 63.5 66 50.0 67 50.5 68 46.0 69 37.0 70 33.5 71 27.0 72 18.5 73 12.5 74 11.5 75 9.5 76 5.5 77 3.5 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.5796370967741935 1.15 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025201612903225805 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGTTGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.375 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 4.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTATGC 10 0.0068343505 144.975 3 CCCTATG 10 0.0068343505 144.975 2 >>END_MODULE SRR6958445 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958445_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4705 33.0 33.0 34.0 32.0 34.0 2 32.38325 33.0 33.0 34.0 31.0 34.0 3 32.464 33.0 33.0 34.0 31.0 34.0 4 32.3825 33.0 33.0 34.0 31.0 34.0 5 32.403 33.0 33.0 34.0 31.0 34.0 6 36.49975 38.0 38.0 38.0 34.0 38.0 7 36.46475 38.0 38.0 38.0 34.0 38.0 8 36.47475 38.0 38.0 38.0 34.0 38.0 9 36.51725 38.0 38.0 38.0 35.0 38.0 10-14 36.39305 38.0 38.0 38.0 34.0 38.0 15-19 36.59054999999999 38.0 38.0 38.0 34.6 38.0 20-24 36.552499999999995 38.0 38.0 38.0 34.6 38.0 25-29 36.627050000000004 38.0 38.0 38.0 35.0 38.0 30-34 36.5919 38.0 38.0 38.0 35.0 38.0 35-39 36.39065 38.0 38.0 38.0 33.8 38.0 40-44 36.31565 38.0 38.0 38.0 33.8 38.0 45-49 36.33335 38.0 38.0 38.0 34.0 38.0 50-54 36.2396 38.0 38.0 38.0 34.0 38.0 55-59 36.20635 38.0 38.0 38.0 33.6 38.0 60-64 36.037099999999995 38.0 38.0 38.0 33.2 38.0 65-69 35.85935 38.0 37.8 38.0 32.4 38.0 70-74 35.79445 38.0 37.4 38.0 32.6 38.0 75-79 35.6239 38.0 37.0 38.0 31.2 38.0 80-84 35.50185 38.0 36.8 38.0 30.4 38.0 85-89 35.50905 38.0 37.0 38.0 30.4 38.0 90-94 35.24465 38.0 36.4 38.0 29.4 38.0 95-99 34.91780000000001 38.0 35.8 38.0 28.0 38.0 100-104 34.643600000000006 38.0 35.0 38.0 26.6 38.0 105-109 34.26375 38.0 34.8 38.0 24.2 38.0 110-114 33.783849999999994 38.0 34.4 38.0 20.6 38.0 115-119 33.6254 38.0 33.6 38.0 19.8 38.0 120-124 33.3385 38.0 33.2 38.0 19.8 38.0 125-129 32.492900000000006 38.0 31.4 38.0 14.6 38.0 130-134 31.357550000000003 36.0 30.0 38.0 13.0 38.0 135-139 31.087400000000002 36.0 29.8 38.0 12.8 38.0 140-144 30.575599999999998 36.0 28.2 38.0 11.4 38.0 145-149 28.758500000000005 35.4 24.6 38.0 2.0 38.0 150-151 22.373 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 7.0 4 2.0 5 2.0 6 3.0 7 3.0 8 2.0 9 7.0 10 1.0 11 5.0 12 5.0 13 4.0 14 6.0 15 4.0 16 5.0 17 9.0 18 8.0 19 8.0 20 9.0 21 12.0 22 20.0 23 24.0 24 21.0 25 30.0 26 36.0 27 49.0 28 51.0 29 69.0 30 82.0 31 128.0 32 140.0 33 207.0 34 288.0 35 485.0 36 936.0 37 1313.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.5 19.2 11.924999999999999 29.375 2 28.849999999999998 24.099999999999998 26.75 20.3 3 23.625 25.15 28.675 22.55 4 25.974999999999998 31.3 20.424999999999997 22.3 5 27.275 31.8 18.9 22.025 6 23.525 34.775 21.025 20.674999999999997 7 22.2 20.424999999999997 32.7 24.675 8 24.525 22.6 23.95 28.925 9 24.85 22.475 27.025 25.650000000000002 10-14 26.345000000000002 25.290000000000003 22.96 25.405 15-19 25.924999999999997 24.215 24.775 25.085 20-24 26.555 25.365 23.41 24.67 25-29 26.71 25.36 23.73 24.2 30-34 25.575 25.22 24.205 25.0 35-39 26.19 25.395 23.77 24.645 40-44 26.179999999999996 25.405 23.630000000000003 24.785 45-49 26.119999999999997 25.44 23.86 24.58 50-54 26.61 25.25 24.04 24.099999999999998 55-59 26.974999999999998 25.095 23.405 24.525 60-64 26.915 24.865000000000002 23.89 24.33 65-69 26.484999999999996 24.69 24.42 24.404999999999998 70-74 27.169999999999998 24.66 24.154999999999998 24.015 75-79 26.76 25.374999999999996 23.669999999999998 24.195 80-84 26.235000000000003 25.21 23.880000000000003 24.675 85-89 26.35 24.83 24.465 24.355 90-94 26.195 25.195 24.315 24.295 95-99 26.575 25.3 24.224999999999998 23.9 100-104 26.484999999999996 24.48 24.42 24.615000000000002 105-109 26.650000000000002 24.825 24.125 24.4 110-114 26.275 25.27 24.235 24.22 115-119 26.424999999999997 25.330000000000002 24.135 24.11 120-124 27.245 25.47 23.505000000000003 23.78 125-129 26.995 25.295 24.035 23.674999999999997 130-134 26.935 25.424999999999997 23.82 23.82 135-139 26.43 25.290000000000003 24.365000000000002 23.915 140-144 26.91 25.885 23.849999999999998 23.355 145-149 27.505000000000003 25.805 23.49 23.200000000000003 150-151 27.575 26.3125 23.025000000000002 23.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 1.0 26 1.0 27 0.5 28 2.0 29 3.5 30 3.5 31 4.0 32 6.0 33 6.5 34 16.5 35 27.0 36 31.5 37 40.0 38 59.5 39 93.0 40 108.0 41 129.0 42 163.5 43 169.5 44 174.5 45 182.5 46 180.0 47 179.5 48 174.5 49 175.5 50 161.5 51 154.0 52 147.5 53 122.5 54 113.5 55 108.0 56 98.0 57 91.0 58 98.0 59 96.0 60 94.0 61 88.5 62 77.5 63 78.0 64 71.0 65 69.5 66 62.0 67 56.5 68 55.5 69 43.0 70 42.5 71 38.5 72 25.5 73 26.0 74 19.0 75 7.5 76 6.5 77 4.5 78 3.0 79 1.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03724347605777 97.725 2 0.6840638459589561 1.35 3 0.2280212819863187 0.675 4 0.0 0.0 5 0.05067139599695972 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.375 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 4.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCCTT 10 0.006830828 145.0 7 TCTTTCC 10 0.006830828 145.0 3 >>END_MODULE Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080386 spots for SRR6958445.sra Written 1080386 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra Read 1080377 spots for SRR6958445.sra Written 1080377 spots for SRR6958445.sra SRR ids: ['SRR6958445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vj024q56 SRR6958445.sra spots: 21607549 blocks: [[1, 1080377], [1080378, 2160754], [2160755, 3241131], [3241132, 4321508], [4321509, 5401885], [5401886, 6482262], [6482263, 7562639], [7562640, 8643016], [8643017, 9723393], [9723394, 10803770], [10803771, 11884147], [11884148, 12964524], [12964525, 14044901], [14044902, 15125278], [15125279, 16205655], [16205656, 17286032], [17286033, 18366409], [18366410, 19446786], [19446787, 20527163], [20527164, 21607549]] SRR6958445 file size 7300388 SRR6958445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958445 SRR6958445_1.fastq SRR6958445_2.fastq Input file: SRR6958445_1.fastq Paired file: SRR6958445_2.fastq trimmed: SRR6958445-trimmed-pair1.fastq, SRR6958445-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:12:17 2024 >> started Fri Dec 6 23:12:42 2024 >> done (24.572s) 21607549 read pairs processed; of these: 33074 ( 0.15%) short read pairs filtered out after trimming by size control 54088 ( 0.25%) empty read pairs filtered out after trimming by size control 21520387 (99.60%) read pairs available; of these: 10050993 (46.70%) trimmed read pairs available after processing 11469394 (53.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 4 0.00% 27 6 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 11 0.00% 32 3 0.00% 33 6 0.00% 34 9 0.00% 35 11 0.00% 36 10 0.00% 37 12 0.00% 38 12 0.00% 39 13 0.00% 40 19 0.00% 41 17 0.00% 42 17 0.00% 43 22 0.00% 44 16 0.00% 45 23 0.00% 46 30 0.00% 47 34 0.00% 48 37 0.00% 49 36 0.00% 50 69 0.00% 51 51 0.00% 52 66 0.00% 53 74 0.00% 54 59 0.00% 55 78 0.00% 56 96 0.00% 57 115 0.00% 58 115 0.00% 59 155 0.00% 60 157 0.00% 61 200 0.00% 62 182 0.00% 63 228 0.00% 64 232 0.00% 65 283 0.00% 66 264 0.00% 67 308 0.00% 68 342 0.00% 69 414 0.00% 70 480 0.00% 71 488 0.00% 72 583 0.00% 73 655 0.00% 74 786 0.00% 75 828 0.00% 76 958 0.00% 77 1108 0.01% 78 1123 0.01% 79 1280 0.01% 80 1512 0.01% 81 1709 0.01% 82 2075 0.01% 83 2316 0.01% 84 3846 0.02% 85 4671 0.02% 86 4684 0.02% 87 4726 0.02% 88 4997 0.02% 89 5358 0.02% 90 5653 0.03% 91 6024 0.03% 92 6456 0.03% 93 7125 0.03% 94 7595 0.04% 95 8196 0.04% 96 8601 0.04% 97 9293 0.04% 98 9501 0.04% 99 10376 0.05% 100 11123 0.05% 101 11881 0.06% 102 12827 0.06% 103 14046 0.07% 104 14686 0.07% 105 15664 0.07% 106 16419 0.08% 107 17497 0.08% 108 18305 0.09% 109 19233 0.09% 110 20261 0.09% 111 21521 0.10% 112 22934 0.11% 113 24570 0.11% 114 25892 0.12% 115 27339 0.13% 116 28744 0.13% 117 29928 0.14% 118 31383 0.15% 119 32337 0.15% 120 34523 0.16% 121 35488 0.16% 122 37197 0.17% 123 39805 0.18% 124 42480 0.20% 125 44327 0.21% 126 46229 0.21% 127 48994 0.23% 128 50327 0.23% 129 52923 0.25% 130 55173 0.26% 131 58110 0.27% 132 61786 0.29% 133 65547 0.30% 134 69396 0.32% 135 73529 0.34% 136 77820 0.36% 137 82771 0.38% 138 87771 0.41% 139 94259 0.44% 140 101143 0.47% 141 112017 0.52% 142 124971 0.58% 143 141409 0.66% 144 163553 0.76% 145 195943 0.91% 146 246484 1.15% 147 337792 1.57% 148 518670 2.41% 149 1046627 4.86% 150 5360456 24.91% 151 11469394 53.30% 21520387 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=22 prefix-density=0.80 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=51.43 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=23 prefix-density=0.61 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=68.05 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958445 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:14:14 Started mapping on | Dec 06 23:14:14 Finished on | Dec 06 23:15:44 Mapping speed, Million of reads per hour | 860.82 Number of input reads | 21520387 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20989101 Uniquely mapped reads % | 97.53% Average mapped length | 295.69 Number of splices: Total | 24075406 Number of splices: Annotated (sjdb) | 22657718 Number of splices: GT/AG | 23766075 Number of splices: GC/AG | 283260 Number of splices: AT/AC | 8784 Number of splices: Non-canonical | 17287 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 144985 % of reads mapped to multiple loci | 0.67% Number of reads mapped to too many loci | 18550 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 405776 405776 405776 N_multimapping 144985 144985 144985 N_noFeature 595506 20424618 741828 N_ambiguous 495029 2705 77865 UnstrandedReadsAssigned:19898566 PositiveStrandReadsAssigned:561778 NegativeStrandReadsAssigned:20169408 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958445 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958445-trimmed-pair1.fastq SRR6958445-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,520,387 reads, 20,192,100 reads pseudoaligned [quant] estimated average fragment length: 259.35 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6958445.ke.tsv 35125 SRR6958445.se.tsv 88098 total ==> SRR6958445.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.103 0 0 PNS24247 1044 785.65 59.6641 5.55705 PNS24249 1928 1669.65 53.8252 2.35896 PNS24246 1044 785.65 59.6641 5.55705 PNS24248 1044 785.65 59.6641 5.55705 PNS24244 1471 1212.65 42.1825 2.54541 PNS24243 293 87.543 0 0 KQK14069 1603 1344.65 5143.68 279.914 KQK14071 474 229.156 46.2891 14.7811 ==> SRR6958445.se.tsv <== BRADI_1g14170v3 5467 BRADI_1g53295v3 210 BRADI_1g59795v3 221 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 318 BRADI_1g74790v3 112 BRADI_1g09890v3 0 BRADI_1g77505v3 230 BRADI_1g48960v3 0 SRR6958445 completed mapping pipeline successfully