Starting /dee2/code/volunteer_pipeline.sh SRR6958446 current disk space = 1547494223872 free memory = 1602378912 SRR6958446 SRAfilesize 0f53abad23481e90a2e98a8148cae5b8 SRR6958446.sra SRR6958446.sra file validated SRR6958446 is paired end SRR6958446 is conventional basespace SRR6958446 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.8515 32.0 25.0 33.0 18.0 34.0 2 31.72225 33.0 31.0 34.0 27.0 34.0 3 32.565 33.0 33.0 34.0 30.0 34.0 4 32.95175 33.0 33.0 34.0 31.0 34.0 5 33.21275 34.0 33.0 34.0 33.0 34.0 6 36.7535 38.0 37.0 38.0 35.0 38.0 7 37.14 38.0 38.0 38.0 36.0 38.0 8 37.46025 38.0 38.0 38.0 37.0 38.0 9 37.204 38.0 38.0 38.0 37.0 38.0 10-14 37.17265 38.0 38.0 38.0 36.2 38.0 15-19 37.591699999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.467999999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.513999999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.52720000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.54135 38.0 38.0 38.0 37.6 38.0 40-44 37.5692 38.0 38.0 38.0 38.0 38.0 45-49 37.50865 38.0 38.0 38.0 37.8 38.0 50-54 37.33555 38.0 38.0 38.0 37.0 38.0 55-59 37.1569 38.0 38.0 38.0 36.2 38.0 60-64 37.29195 38.0 38.0 38.0 37.0 38.0 65-69 37.2555 38.0 38.0 38.0 36.2 38.0 70-74 37.1462 38.0 38.0 38.0 36.2 38.0 75-79 36.96055 38.0 38.0 38.0 35.6 38.0 80-84 37.060050000000004 38.0 38.0 38.0 35.8 38.0 85-89 37.00745 38.0 38.0 38.0 35.6 38.0 90-94 36.7978 38.0 38.0 38.0 34.8 38.0 95-99 36.7512 38.0 38.0 38.0 35.0 38.0 100-104 36.51205 38.0 38.0 38.0 34.0 38.0 105-109 36.35510000000001 38.0 37.6 38.0 34.0 38.0 110-114 36.11525 38.0 37.2 38.0 33.4 38.0 115-119 35.8668 38.0 36.6 38.0 32.2 38.0 120-124 35.750600000000006 38.0 36.6 38.0 31.4 38.0 125-129 35.29725 38.0 35.8 38.0 29.6 38.0 130-134 35.22125 38.0 36.0 38.0 29.6 38.0 135-139 35.03365 38.0 35.2 38.0 29.4 38.0 140-144 34.5431 38.0 34.4 38.0 27.6 38.0 145-149 33.1886 38.0 33.4 38.0 19.8 38.0 150-151 27.334000000000003 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 4.0 20 3.0 21 3.0 22 3.0 23 6.0 24 7.0 25 8.0 26 11.0 27 16.0 28 18.0 29 20.0 30 40.0 31 62.0 32 81.0 33 115.0 34 194.0 35 329.0 36 816.0 37 2261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.01214784181959 11.682605324373222 8.813646937193074 42.49159989661411 2 21.349999999999998 12.8 37.125 28.725 3 18.925 16.5 26.3 38.275 4 24.425 25.124999999999996 22.35 28.1 5 25.650000000000002 29.799999999999997 23.65 20.9 6 22.175 34.225 24.25 19.35 7 17.625 26.400000000000002 37.724999999999994 18.25 8 20.549999999999997 24.425 31.574999999999996 23.45 9 19.15 22.8 34.9 23.150000000000002 10-14 21.975 27.605 26.905 23.515 15-19 21.945 26.529999999999998 27.52 24.005000000000003 20-24 22.36223622362236 27.662766276627664 26.432643264326433 23.54235423542354 25-29 22.220000000000002 27.794999999999998 26.405 23.580000000000002 30-34 22.38 27.150000000000002 26.525 23.945 35-39 22.06 27.455000000000002 26.715 23.77 40-44 21.65 26.900000000000002 27.13 24.32 45-49 21.98 26.405 27.500000000000004 24.115000000000002 50-54 22.0 26.555 27.435 24.01 55-59 22.384999999999998 26.645000000000003 26.915 24.055 60-64 22.165000000000003 26.71 27.134999999999998 23.990000000000002 65-69 22.46 26.575 26.450000000000003 24.515 70-74 22.73 26.924999999999997 26.615 23.73 75-79 22.125 26.369999999999997 27.1 24.404999999999998 80-84 21.790000000000003 26.56 27.029999999999998 24.62 85-89 22.259999999999998 26.52 26.76 24.46 90-94 22.435 26.755000000000003 26.534999999999997 24.275 95-99 22.05 26.44 27.134999999999998 24.375 100-104 22.58290401640574 26.744360526184163 26.534287000450156 24.138448456959935 105-109 22.31 26.76 26.334999999999997 24.595 110-114 22.26396193338342 26.922113698973206 26.646631605309288 24.167292762334082 115-119 22.89747697236684 27.002402883460153 26.191429715658792 23.908690428514216 120-124 22.503502101260757 26.896137682609567 26.510906543926353 24.089453672203323 125-129 22.49461071840377 26.796009424976187 26.710783576477663 23.99859628014238 130-134 22.31785428342674 27.046637309847878 26.29603682946357 24.339471577261808 135-139 22.095000000000002 26.66 26.655 24.59 140-144 22.595000000000002 26.275 26.950000000000003 24.18 145-149 22.48 26.590000000000003 26.085 24.845 150-151 22.3625 25.6 26.400000000000002 25.637500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 2.0 28 3.0 29 7.0 30 12.0 31 14.5 32 23.0 33 28.5 34 37.0 35 49.5 36 64.5 37 89.0 38 112.0 39 130.5 40 155.5 41 191.0 42 226.5 43 237.0 44 236.5 45 245.0 46 235.0 47 221.5 48 204.0 49 169.0 50 158.0 51 164.0 52 135.5 53 108.5 54 92.5 55 82.0 56 75.0 57 62.0 58 58.0 59 59.5 60 60.0 61 50.0 62 38.0 63 32.0 64 30.5 65 26.0 66 18.5 67 12.0 68 7.5 69 5.5 70 7.0 71 4.5 72 3.0 73 6.5 74 5.0 75 1.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.17500000000000002 115-119 0.12 120-124 0.06 125-129 0.265 130-134 0.08 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.675 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGGAA 10 0.0069483654 144.175 4 >>END_MODULE SRR6958446 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958446_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44525 33.0 33.0 34.0 28.0 34.0 2 31.8365 33.0 33.0 34.0 27.0 34.0 3 32.65825 33.0 33.0 34.0 30.0 34.0 4 31.45125 33.0 33.0 34.0 27.0 34.0 5 32.65675 33.0 33.0 34.0 31.0 34.0 6 37.0985 38.0 38.0 38.0 36.0 38.0 7 37.36125 38.0 38.0 38.0 37.0 38.0 8 37.4255 38.0 38.0 38.0 38.0 38.0 9 37.38575 38.0 38.0 38.0 38.0 38.0 10-14 37.4844 38.0 38.0 38.0 38.0 38.0 15-19 37.41175 38.0 38.0 38.0 38.0 38.0 20-24 37.42265 38.0 38.0 38.0 38.0 38.0 25-29 37.479749999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.513200000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.4402 38.0 38.0 38.0 38.0 38.0 40-44 37.3725 38.0 38.0 38.0 37.4 38.0 45-49 36.86065 38.0 37.8 38.0 35.0 38.0 50-54 36.3445 38.0 36.8 38.0 31.4 38.0 55-59 37.2834 38.0 38.0 38.0 37.2 38.0 60-64 37.384 38.0 38.0 38.0 37.8 38.0 65-69 37.31949999999999 38.0 38.0 38.0 37.0 38.0 70-74 36.811 38.0 38.0 38.0 35.4 38.0 75-79 37.143299999999996 38.0 38.0 38.0 36.4 38.0 80-84 35.614549999999994 38.0 36.6 38.0 25.6 38.0 85-89 37.078199999999995 38.0 38.0 38.0 35.8 38.0 90-94 37.105000000000004 38.0 38.0 38.0 36.2 38.0 95-99 36.9875 38.0 38.0 38.0 36.0 38.0 100-104 36.861650000000004 38.0 38.0 38.0 35.4 38.0 105-109 36.67885 38.0 38.0 38.0 34.8 38.0 110-114 36.734249999999996 38.0 38.0 38.0 34.8 38.0 115-119 36.72955 38.0 38.0 38.0 35.2 38.0 120-124 36.4705 38.0 38.0 38.0 33.6 38.0 125-129 36.210300000000004 38.0 38.0 38.0 33.2 38.0 130-134 35.945949999999996 38.0 37.6 38.0 32.0 38.0 135-139 35.06170000000001 38.0 35.6 38.0 28.0 38.0 140-144 33.39790000000001 38.0 32.6 38.0 20.6 38.0 145-149 33.005449999999996 38.0 33.0 38.0 17.6 38.0 150-151 28.235999999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 2.0 17 1.0 18 1.0 19 1.0 20 6.0 21 3.0 22 3.0 23 8.0 24 9.0 25 9.0 26 11.0 27 12.0 28 19.0 29 23.0 30 33.0 31 53.0 32 71.0 33 101.0 34 133.0 35 302.0 36 815.0 37 2376.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.825 17.45 14.424999999999999 34.300000000000004 2 28.999999999999996 23.225 28.95 18.825 3 21.575 26.724999999999998 28.375 23.325000000000003 4 25.15 31.35 21.875 21.625 5 27.1 34.150000000000006 21.099999999999998 17.65 6 22.35 37.8 21.725 18.125 7 21.375 20.150000000000002 37.35 21.125 8 24.125 23.849999999999998 26.174999999999997 25.85 9 22.575 22.225 29.725 25.474999999999998 10-14 24.94 26.605 24.705 23.75 15-19 24.255 26.58 25.895000000000003 23.27 20-24 24.995 26.805 25.629999999999995 22.57 25-29 24.77 26.400000000000002 25.759999999999998 23.07 30-34 25.11 26.674999999999997 25.8 22.415 35-39 24.735 27.125 25.665 22.475 40-44 24.97 26.41 25.605 23.015 45-49 24.77 26.82 26.19 22.220000000000002 50-54 24.665 27.015 25.56 22.759999999999998 55-59 24.825 26.75 25.85 22.575 60-64 24.39 26.69 26.009999999999998 22.91 65-69 25.025 26.6 25.590000000000003 22.785 70-74 24.375 27.01 25.995 22.62 75-79 24.224999999999998 26.505000000000003 26.735 22.535 80-84 24.715 26.805 26.340000000000003 22.14 85-89 24.51 26.63 26.305 22.555 90-94 24.48 27.01 26.229999999999997 22.28 95-99 24.345 26.465 26.605 22.585 100-104 24.535 26.810000000000002 26.27 22.384999999999998 105-109 24.265 27.355 26.215 22.165000000000003 110-114 24.7 27.150000000000002 26.325 21.825 115-119 24.945 26.76 26.355 21.94 120-124 24.654999999999998 26.625 26.435 22.285 125-129 24.165 26.96 26.505000000000003 22.37 130-134 25.080000000000002 26.779999999999998 26.52 21.62 135-139 24.575 26.935 26.584999999999997 21.905 140-144 25.545 26.995 26.015 21.445 145-149 25.09 26.97 25.619999999999997 22.32 150-151 25.387500000000003 26.724999999999998 26.237500000000004 21.65 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 1.5 25 0.5 26 1.5 27 3.5 28 6.0 29 6.0 30 8.0 31 18.5 32 26.0 33 26.0 34 26.0 35 32.5 36 46.5 37 67.5 38 106.0 39 138.5 40 151.0 41 171.5 42 206.5 43 216.0 44 216.0 45 229.0 46 226.5 47 217.5 48 202.5 49 189.0 50 167.5 51 141.0 52 126.5 53 116.5 54 98.0 55 87.0 56 84.0 57 73.5 58 73.0 59 69.5 60 61.5 61 60.5 62 57.0 63 42.0 64 33.5 65 32.0 66 27.5 67 25.5 68 20.5 69 19.0 70 14.5 71 8.5 72 7.5 73 3.5 74 2.0 75 1.5 76 1.0 77 1.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.5999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACCTT 10 0.006830828 145.0 8 >>END_MODULE Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863098 spots for SRR6958446.sra Written 863098 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra Read 863097 spots for SRR6958446.sra Written 863097 spots for SRR6958446.sra SRR ids: ['SRR6958446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_skurhf_u SRR6958446.sra spots: 17261941 blocks: [[1, 863097], [863098, 1726194], [1726195, 2589291], [2589292, 3452388], [3452389, 4315485], [4315486, 5178582], [5178583, 6041679], [6041680, 6904776], [6904777, 7767873], [7767874, 8630970], [8630971, 9494067], [9494068, 10357164], [10357165, 11220261], [11220262, 12083358], [12083359, 12946455], [12946456, 13809552], [13809553, 14672649], [14672650, 15535746], [15535747, 16398843], [16398844, 17261941]] SRR6958446 file size 5827805 SRR6958446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958446 SRR6958446_1.fastq SRR6958446_2.fastq Input file: SRR6958446_1.fastq Paired file: SRR6958446_2.fastq trimmed: SRR6958446-trimmed-pair1.fastq, SRR6958446-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:20:09 2024 >> started Fri Dec 6 23:20:28 2024 >> done (18.626s) 17261941 read pairs processed; of these: 8163 ( 0.05%) short read pairs filtered out after trimming by size control 8647 ( 0.05%) empty read pairs filtered out after trimming by size control 17245131 (99.90%) read pairs available; of these: 7264085 (42.12%) trimmed read pairs available after processing 9981046 (57.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 6 0.00% 25 2 0.00% 26 3 0.00% 27 1 0.00% 28 9 0.00% 29 6 0.00% 30 3 0.00% 31 3 0.00% 32 3 0.00% 33 5 0.00% 34 6 0.00% 35 4 0.00% 36 3 0.00% 37 7 0.00% 38 4 0.00% 39 7 0.00% 40 3 0.00% 41 4 0.00% 42 7 0.00% 43 8 0.00% 44 13 0.00% 45 10 0.00% 46 6 0.00% 47 16 0.00% 48 11 0.00% 49 23 0.00% 50 22 0.00% 51 21 0.00% 52 23 0.00% 53 16 0.00% 54 28 0.00% 55 27 0.00% 56 29 0.00% 57 47 0.00% 58 40 0.00% 59 45 0.00% 60 47 0.00% 61 75 0.00% 62 63 0.00% 63 71 0.00% 64 93 0.00% 65 106 0.00% 66 95 0.00% 67 112 0.00% 68 131 0.00% 69 159 0.00% 70 182 0.00% 71 220 0.00% 72 244 0.00% 73 281 0.00% 74 342 0.00% 75 356 0.00% 76 399 0.00% 77 479 0.00% 78 489 0.00% 79 576 0.00% 80 699 0.00% 81 682 0.00% 82 865 0.01% 83 1042 0.01% 84 1281 0.01% 85 1547 0.01% 86 1640 0.01% 87 1926 0.01% 88 2126 0.01% 89 2253 0.01% 90 2486 0.01% 91 2574 0.01% 92 2878 0.02% 93 3092 0.02% 94 3330 0.02% 95 3613 0.02% 96 3884 0.02% 97 4236 0.02% 98 4472 0.03% 99 4980 0.03% 100 5074 0.03% 101 5567 0.03% 102 6133 0.04% 103 6364 0.04% 104 6846 0.04% 105 7241 0.04% 106 8011 0.05% 107 8428 0.05% 108 8952 0.05% 109 9604 0.06% 110 10042 0.06% 111 10622 0.06% 112 11253 0.07% 113 11753 0.07% 114 12873 0.07% 115 13549 0.08% 116 14253 0.08% 117 14867 0.09% 118 15629 0.09% 119 16637 0.10% 120 17120 0.10% 121 18114 0.11% 122 19054 0.11% 123 20038 0.12% 124 21651 0.13% 125 22262 0.13% 126 23598 0.14% 127 24804 0.14% 128 26186 0.15% 129 27812 0.16% 130 30644 0.18% 131 31166 0.18% 132 33382 0.19% 133 35571 0.21% 134 37721 0.22% 135 40625 0.24% 136 43647 0.25% 137 47213 0.27% 138 50236 0.29% 139 55009 0.32% 140 61037 0.35% 141 67168 0.39% 142 76001 0.44% 143 85994 0.50% 144 101711 0.59% 145 126259 0.73% 146 159681 0.93% 147 221099 1.28% 148 349907 2.03% 149 734732 4.26% 150 4396330 25.49% 151 9981046 57.88% 17245131 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=17 prefix-density=0.91 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=61.60 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.5 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=18 prefix-density=0.70 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=477.81 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=16.4 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958446 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:21:34 Started mapping on | Dec 06 23:21:35 Finished on | Dec 06 23:23:24 Mapping speed, Million of reads per hour | 569.56 Number of input reads | 17245131 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16881109 Uniquely mapped reads % | 97.89% Average mapped length | 297.51 Number of splices: Total | 20027445 Number of splices: Annotated (sjdb) | 18885184 Number of splices: GT/AG | 19765677 Number of splices: GC/AG | 231301 Number of splices: AT/AC | 7283 Number of splices: Non-canonical | 23184 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128290 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 6445 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 239135 239135 239135 N_multimapping 128290 128290 128290 N_noFeature 647985 16391690 798826 N_ambiguous 406867 2318 69384 UnstrandedReadsAssigned:15826257 PositiveStrandReadsAssigned:487101 NegativeStrandReadsAssigned:16012899 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958446 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958446-trimmed-pair1.fastq SRR6958446-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,245,131 reads, 16,007,014 reads pseudoaligned [quant] estimated average fragment length: 246.612 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR6958446.ke.tsv 35125 SRR6958446.se.tsv 88098 total ==> SRR6958446.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.75 0 0 PNS24247 1044 798.388 41.1304 5.04429 PNS24249 1928 1682.39 30.2896 1.76286 PNS24246 1044 798.388 41.1304 5.04429 PNS24248 1044 798.388 41.1304 5.04429 PNS24244 1471 1225.39 29.3193 2.34278 PNS24243 293 81.5726 0 0 KQK14069 1603 1357.39 3545.1 255.727 KQK14071 474 233.642 49.6034 20.788 ==> SRR6958446.se.tsv <== BRADI_1g14170v3 4082 BRADI_1g53295v3 278 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 198 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 193 BRADI_1g48960v3 0 SRR6958446 completed mapping pipeline successfully