Starting /dee2/code/volunteer_pipeline.sh SRR6958447 current disk space = 1547494223872 free memory = 1598387744 SRR6958447 SRAfilesize 8a3dd2a9ea73e765dbff5797984b7ffc SRR6958447.sra SRR6958447.sra file validated SRR6958447 is paired end SRR6958447 is conventional basespace SRR6958447 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.083 33.0 33.0 34.0 32.0 34.0 2 33.37225 34.0 33.0 34.0 33.0 34.0 3 31.8135 33.0 31.0 33.0 31.0 34.0 4 32.9185 33.0 33.0 34.0 33.0 34.0 5 33.20575 33.0 33.0 34.0 33.0 34.0 6 37.09225 38.0 37.0 38.0 36.0 38.0 7 37.41625 38.0 38.0 38.0 37.0 38.0 8 37.54575 38.0 38.0 38.0 37.0 38.0 9 37.64475 38.0 38.0 38.0 38.0 38.0 10-14 37.651799999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.6114 38.0 38.0 38.0 37.8 38.0 20-24 37.642999999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.63645 38.0 38.0 38.0 38.0 38.0 30-34 37.60425 38.0 38.0 38.0 38.0 38.0 35-39 37.59785 38.0 38.0 38.0 38.0 38.0 40-44 37.60445 38.0 38.0 38.0 38.0 38.0 45-49 37.53865 38.0 38.0 38.0 37.8 38.0 50-54 37.5167 38.0 38.0 38.0 37.6 38.0 55-59 37.38985 38.0 38.0 38.0 37.0 38.0 60-64 37.26675 38.0 38.0 38.0 37.0 38.0 65-69 37.353300000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.2895 38.0 38.0 38.0 36.8 38.0 75-79 37.1678 38.0 38.0 38.0 36.0 38.0 80-84 37.2027 38.0 38.0 38.0 36.0 38.0 85-89 37.05485 38.0 38.0 38.0 35.8 38.0 90-94 36.96345 38.0 38.0 38.0 35.4 38.0 95-99 36.77419999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.50355 38.0 38.0 38.0 33.4 38.0 105-109 36.4046 38.0 38.0 38.0 33.0 38.0 110-114 36.24225 38.0 38.0 38.0 33.0 38.0 115-119 35.876050000000006 38.0 37.2 38.0 31.8 38.0 120-124 35.737649999999995 38.0 37.0 38.0 31.4 38.0 125-129 35.642199999999995 38.0 36.6 38.0 31.0 38.0 130-134 35.280449999999995 38.0 36.0 38.0 29.8 38.0 135-139 34.4103 38.0 34.2 38.0 26.6 38.0 140-144 34.18195 38.0 33.8 38.0 25.8 38.0 145-149 33.56034999999999 38.0 33.2 38.0 22.4 38.0 150-151 26.902 32.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 2.0 19 5.0 20 0.0 21 2.0 22 5.0 23 4.0 24 8.0 25 13.0 26 8.0 27 16.0 28 18.0 29 20.0 30 39.0 31 48.0 32 45.0 33 94.0 34 153.0 35 310.0 36 826.0 37 2378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.050000000000004 10.05 7.55 36.35 2 22.3 10.4 35.075 32.225 3 21.725 14.075 25.275 38.925 4 25.924999999999997 20.0 22.825 31.25 5 28.15 24.575 23.674999999999997 23.599999999999998 6 24.5 29.049999999999997 22.95 23.5 7 19.725 22.875 37.625 19.775000000000002 8 22.05 21.975 28.7 27.275 9 21.224999999999998 22.275 31.6 24.9 10-14 23.84 25.095 25.345000000000002 25.72 15-19 24.309723889555823 23.89455782312925 25.31512605042017 26.480592236894758 20-24 24.6 23.955000000000002 25.080000000000002 26.365 25-29 24.235 24.315 25.185000000000002 26.265 30-34 23.674999999999997 24.395 25.215 26.715 35-39 24.65 24.14 24.585 26.625 40-44 24.445 24.21 24.525 26.82 45-49 23.880000000000003 24.32 25.019999999999996 26.779999999999998 50-54 24.485 23.74 24.79 26.985 55-59 24.26 24.07 25.290000000000003 26.38 60-64 24.623645122440788 24.021477318346047 25.21075873143316 26.144118827780012 65-69 24.865000000000002 23.82 24.435000000000002 26.88 70-74 24.89 23.54 24.495 27.075 75-79 24.68 23.48 24.884999999999998 26.955000000000002 80-84 25.25 23.765 24.515 26.47 85-89 24.59 24.025 24.89 26.495 90-94 25.025 23.72 24.529999999999998 26.724999999999998 95-99 24.884999999999998 23.56 24.635 26.919999999999998 100-104 24.975 23.425 24.884999999999998 26.715 105-109 25.259999999999998 24.035 24.425 26.279999999999998 110-114 24.884999999999998 23.56 25.045 26.51 115-119 24.81 24.240000000000002 24.515 26.435 120-124 25.645 23.915 23.815 26.625 125-129 25.0 23.97 24.45 26.58 130-134 25.380000000000003 24.349999999999998 24.044999999999998 26.224999999999998 135-139 25.230000000000004 24.47 23.84 26.46 140-144 25.35 24.38 23.810000000000002 26.46 145-149 25.095 24.3 24.23 26.375 150-151 25.0625 25.275 23.35 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.0 28 0.5 29 1.5 30 4.0 31 8.0 32 8.5 33 11.5 34 13.0 35 17.0 36 32.0 37 48.5 38 65.0 39 81.0 40 105.5 41 122.0 42 133.5 43 146.0 44 164.0 45 178.5 46 189.0 47 194.0 48 185.5 49 172.5 50 164.5 51 163.5 52 153.0 53 128.0 54 96.5 55 89.0 56 96.0 57 97.5 58 98.5 59 89.5 60 86.5 61 91.0 62 82.5 63 73.0 64 79.5 65 81.0 66 64.0 67 58.0 68 57.5 69 52.0 70 52.5 71 43.0 72 29.0 73 26.5 74 17.5 75 15.5 76 15.5 77 7.5 78 4.5 79 2.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.04 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.36 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.4625000000000004 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.3625 0.0 0.0 0.0 0.0 120-121 4.9125 0.0 0.0 0.0 0.0 122-123 5.65 0.0 0.0 0.0 0.0 124-125 6.4 0.0 0.0 0.0 0.0 126-127 6.975 0.0 0.0 0.0 0.0 128-129 7.925 0.0 0.0 0.0 0.0 130-131 8.725 0.0 0.0 0.0 0.0 132-133 9.2875 0.0 0.0 0.0 0.0 134-135 10.1125 0.0 0.0 0.0 0.0 136-137 10.8625 0.0 0.0 0.0 0.0 138-139 11.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATGT 10 0.006830828 145.0 8 TCAAGGG 10 0.006830828 145.0 2 >>END_MODULE SRR6958447 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958447_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0355 33.0 33.0 34.0 32.0 34.0 2 33.08025 34.0 33.0 34.0 33.0 34.0 3 33.16075 34.0 33.0 34.0 33.0 34.0 4 33.14275 34.0 33.0 34.0 33.0 34.0 5 33.0965 34.0 33.0 34.0 33.0 34.0 6 37.186 38.0 38.0 38.0 37.0 38.0 7 37.32225 38.0 38.0 38.0 37.0 38.0 8 37.33825 38.0 38.0 38.0 38.0 38.0 9 37.26525 38.0 38.0 38.0 38.0 38.0 10-14 37.279849999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.22425 38.0 38.0 38.0 37.0 38.0 20-24 37.215199999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.11685 38.0 38.0 38.0 37.0 38.0 30-34 37.16845 38.0 38.0 38.0 37.0 38.0 35-39 37.1903 38.0 38.0 38.0 37.0 38.0 40-44 37.15475 38.0 38.0 38.0 37.0 38.0 45-49 37.08265 38.0 38.0 38.0 37.0 38.0 50-54 37.05165 38.0 38.0 38.0 37.0 38.0 55-59 37.039300000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.047650000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.01075 38.0 38.0 38.0 36.6 38.0 70-74 36.9537 38.0 38.0 38.0 36.0 38.0 75-79 36.951899999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.8633 38.0 38.0 38.0 36.0 38.0 85-89 36.7571 38.0 38.0 38.0 35.6 38.0 90-94 36.6695 38.0 38.0 38.0 35.2 38.0 95-99 36.55555 38.0 38.0 38.0 35.0 38.0 100-104 36.5495 38.0 38.0 38.0 34.8 38.0 105-109 36.3375 38.0 38.0 38.0 34.0 38.0 110-114 36.200799999999994 38.0 38.0 38.0 33.8 38.0 115-119 35.9994 38.0 38.0 38.0 33.4 38.0 120-124 35.9926 38.0 38.0 38.0 33.4 38.0 125-129 35.76755 38.0 37.2 38.0 32.8 38.0 130-134 35.6111 38.0 36.8 38.0 32.8 38.0 135-139 35.431799999999996 38.0 36.0 38.0 32.2 38.0 140-144 34.9094 38.0 36.0 38.0 30.4 38.0 145-149 33.9525 38.0 34.2 38.0 25.0 38.0 150-151 29.585375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 2.0 4 3.0 5 1.0 6 1.0 7 2.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 2.0 15 4.0 16 4.0 17 1.0 18 3.0 19 2.0 20 4.0 21 3.0 22 4.0 23 6.0 24 7.0 25 8.0 26 17.0 27 16.0 28 16.0 29 31.0 30 27.0 31 45.0 32 55.0 33 69.0 34 117.0 35 225.0 36 490.0 37 2813.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.85 17.974999999999998 10.299999999999999 31.874999999999996 2 28.67886688393081 22.963148658811733 26.62321383805465 21.73477061920281 3 23.263975933818 24.968663825520178 26.021559288042116 25.745800952619703 4 27.14966156931562 29.631486588117323 18.47580847330158 24.74304336926548 5 27.24993732765104 31.81248433191276 19.227876660817248 21.709701679618952 6 24.01002506265664 33.959899749373434 20.37593984962406 21.654135338345863 7 24.285714285714285 19.097744360902254 31.528822055137844 25.087719298245613 8 24.029065397143572 23.352543222250063 22.95164119268354 29.666750187922826 9 24.260651629072683 22.832080200501252 25.48872180451128 27.418546365914786 10-14 26.616865536949764 25.83475383535546 21.914168254286572 25.6342123734082 15-19 26.353790613718413 25.27075812274368 22.78880866425993 25.586642599277976 20-24 26.422662321383804 24.74304336926548 23.21383805465029 25.620456254700425 25-29 26.351148099869647 25.03258798756643 23.097362879775392 25.518901032788527 30-34 26.142742582197275 24.87469927826784 23.70689655172414 25.275661587810745 35-39 26.4337276919992 25.060156406657306 23.02486464808502 25.481251253258474 40-44 26.954299458809384 24.859691320905995 22.56464221286831 25.621367007416318 45-49 26.634928589325984 24.961162615885744 22.63091956903032 25.772989225757954 50-54 26.619209945859236 24.83958291558051 23.481050731902947 25.060156406657306 55-59 27.913387800110268 24.25943561726229 22.530198987519423 25.296977595108018 60-64 27.036238785023308 24.70051626484888 23.272016440278684 24.99122850984913 65-69 26.432115471357694 24.718087505638252 23.00405953991881 25.84573748308525 70-74 26.656973829339215 24.4460042113707 23.56863531535145 25.328386643938632 75-79 27.055463700586202 24.59041034119946 23.002154416553935 25.351971541660408 80-84 26.706082773825035 24.391221565287104 23.198717306343323 25.703978354544542 85-89 26.823034130205986 24.51260462085902 23.269683756828545 25.39467749210645 90-94 26.4571743597454 24.302109958402244 23.931238410264122 25.309477271588232 95-99 26.516290726817044 24.295739348370926 23.62406015037594 25.563909774436087 100-104 27.61957284668605 24.125137872255088 23.583675924997493 24.671613356061368 105-109 27.42945922918859 24.888487946674687 23.129353981857363 24.552698842279355 110-114 27.158327484207362 25.022560914469068 22.651158126942743 25.167953474380827 115-119 26.80066162097138 25.031326750538817 23.26199188010626 24.90601974838354 120-124 27.589491627393965 24.82201945252181 22.72636117517297 24.862127744911263 125-129 27.39664244550238 25.07642194938612 23.041844149336004 24.485091455775496 130-134 28.146143437077132 24.953641056482734 23.064200872049316 23.836014634390818 135-139 28.310113260499147 25.57883131201764 22.897664628645884 23.213390798837324 140-144 29.09419018497168 25.13910471702842 22.92846759236052 22.83823750563938 145-149 29.19235975334637 25.297037148443373 23.031032235423872 22.47957086278638 150-151 29.101391151773402 26.28148890838451 22.4213560596566 22.19576388018549 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 4.0 2 2.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 3.0 30 4.5 31 3.5 32 4.5 33 9.0 34 13.5 35 19.5 36 25.0 37 31.5 38 47.5 39 63.0 40 86.5 41 123.0 42 158.5 43 169.0 44 161.5 45 172.0 46 183.5 47 176.0 48 162.0 49 148.0 50 151.0 51 150.0 52 134.5 53 113.0 54 96.5 55 103.0 56 100.0 57 89.0 58 103.0 59 116.0 60 111.0 61 105.5 62 94.0 63 84.5 64 87.5 65 85.0 66 81.5 67 76.5 68 63.5 69 54.0 70 49.0 71 43.5 72 32.5 73 26.5 74 22.5 75 15.5 76 12.0 77 9.0 78 4.5 79 4.5 80 3.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.25 7 0.25 8 0.22499999999999998 9 0.25 10-14 0.27 15-19 0.27999999999999997 20-24 0.27499999999999997 25-29 0.27 30-34 0.24 35-39 0.26 40-44 0.22 45-49 0.22499999999999998 50-54 0.26 55-59 0.245 60-64 0.245 65-69 0.23500000000000001 70-74 0.27 75-79 0.20500000000000002 80-84 0.21 85-89 0.23500000000000001 90-94 0.23500000000000001 95-99 0.25 100-104 0.27 105-109 0.23500000000000001 110-114 0.27 115-119 0.245 120-124 0.27 125-129 0.22499999999999998 130-134 0.23500000000000001 135-139 0.22999999999999998 140-144 0.255 145-149 0.265 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06376518218623 97.875 2 0.7338056680161943 1.4500000000000002 3 0.1771255060728745 0.525 4 0.0 0.0 5 0.0 0.0 6 0.025303643724696356 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.4124999999999996 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.8375 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 6.300000000000001 0.0 0.0 0.0 0.0 126-127 6.8875 0.0 0.0 0.0 0.0 128-129 7.8625 0.0 0.0 0.0 0.0 130-131 8.65 0.0 0.0 0.0 0.0 132-133 9.2375 0.0 0.0 0.0 0.0 134-135 10.075 0.0 0.0 0.0 0.0 136-137 10.8625 0.0 0.0 0.0 0.0 138-139 11.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGCCAT 10 0.006830828 145.0 1 >>END_MODULE Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299033 spots for SRR6958447.sra Written 1299033 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra Read 1299014 spots for SRR6958447.sra Written 1299014 spots for SRR6958447.sra SRR ids: ['SRR6958447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6fli8ais SRR6958447.sra spots: 25980299 blocks: [[1, 1299014], [1299015, 2598028], [2598029, 3897042], [3897043, 5196056], [5196057, 6495070], [6495071, 7794084], [7794085, 9093098], [9093099, 10392112], [10392113, 11691126], [11691127, 12990140], [12990141, 14289154], [14289155, 15588168], [15588169, 16887182], [16887183, 18186196], [18186197, 19485210], [19485211, 20784224], [20784225, 22083238], [22083239, 23382252], [23382253, 24681266], [24681267, 25980299]] SRR6958447 file size 8782170 SRR6958447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958447 SRR6958447_1.fastq SRR6958447_2.fastq Input file: SRR6958447_1.fastq Paired file: SRR6958447_2.fastq trimmed: SRR6958447-trimmed-pair1.fastq, SRR6958447-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:20:39 2024 >> started Fri Dec 6 23:21:08 2024 >> done (29.237s) 25980299 read pairs processed; of these: 29650 ( 0.11%) short read pairs filtered out after trimming by size control 83479 ( 0.32%) empty read pairs filtered out after trimming by size control 25867170 (99.56%) read pairs available; of these: 13310281 (51.46%) trimmed read pairs available after processing 12556889 (48.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 6 0.00% 21 4 0.00% 22 9 0.00% 23 7 0.00% 24 10 0.00% 25 7 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 11 0.00% 30 9 0.00% 31 10 0.00% 32 5 0.00% 33 17 0.00% 34 11 0.00% 35 10 0.00% 36 9 0.00% 37 12 0.00% 38 13 0.00% 39 22 0.00% 40 16 0.00% 41 20 0.00% 42 27 0.00% 43 21 0.00% 44 22 0.00% 45 28 0.00% 46 27 0.00% 47 33 0.00% 48 32 0.00% 49 51 0.00% 50 71 0.00% 51 82 0.00% 52 93 0.00% 53 95 0.00% 54 93 0.00% 55 129 0.00% 56 116 0.00% 57 153 0.00% 58 170 0.00% 59 181 0.00% 60 252 0.00% 61 278 0.00% 62 329 0.00% 63 342 0.00% 64 411 0.00% 65 473 0.00% 66 508 0.00% 67 591 0.00% 68 670 0.00% 69 802 0.00% 70 957 0.00% 71 1168 0.00% 72 1224 0.00% 73 1570 0.01% 74 1697 0.01% 75 1932 0.01% 76 2353 0.01% 77 2566 0.01% 78 2951 0.01% 79 3358 0.01% 80 3936 0.02% 81 4537 0.02% 82 5159 0.02% 83 6057 0.02% 84 7902 0.03% 85 9041 0.03% 86 9954 0.04% 87 10918 0.04% 88 11677 0.05% 89 12769 0.05% 90 13881 0.05% 91 15477 0.06% 92 16925 0.07% 93 18619 0.07% 94 20567 0.08% 95 22209 0.09% 96 23864 0.09% 97 25906 0.10% 98 27319 0.11% 99 29192 0.11% 100 31227 0.12% 101 33896 0.13% 102 36923 0.14% 103 39399 0.15% 104 42342 0.16% 105 44731 0.17% 106 47512 0.18% 107 49613 0.19% 108 51720 0.20% 109 54502 0.21% 110 56346 0.22% 111 58914 0.23% 112 63082 0.24% 113 65868 0.25% 114 69215 0.27% 115 73428 0.28% 116 75958 0.29% 117 77991 0.30% 118 80380 0.31% 119 82217 0.32% 120 85285 0.33% 121 87507 0.34% 122 90905 0.35% 123 94452 0.37% 124 98242 0.38% 125 102129 0.39% 126 104611 0.40% 127 107855 0.42% 128 109266 0.42% 129 111761 0.43% 130 114122 0.44% 131 116410 0.45% 132 120615 0.47% 133 125446 0.48% 134 128173 0.50% 135 132703 0.51% 136 135398 0.52% 137 138899 0.54% 138 142104 0.55% 139 147337 0.57% 140 152584 0.59% 141 157590 0.61% 142 167000 0.65% 143 175852 0.68% 144 192388 0.74% 145 215644 0.83% 146 248176 0.96% 147 312152 1.21% 148 442627 1.71% 149 892120 3.45% 150 6603663 25.53% 151 12556889 48.54% 25867170 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=15 prefix-density=0.88 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=70.30 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.5 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=12 prefix-density=0.65 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=47.19 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958447 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:21:49 Started mapping on | Dec 06 23:21:50 Finished on | Dec 06 23:23:21 Mapping speed, Million of reads per hour | 1023.32 Number of input reads | 25867170 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 25171922 Uniquely mapped reads % | 97.31% Average mapped length | 291.54 Number of splices: Total | 26844799 Number of splices: Annotated (sjdb) | 25240823 Number of splices: GT/AG | 26500298 Number of splices: GC/AG | 307941 Number of splices: AT/AC | 12360 Number of splices: Non-canonical | 24200 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 208823 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 42292 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502303 502303 502303 N_multimapping 208823 208823 208823 N_noFeature 745624 24510678 945441 N_ambiguous 542591 3205 81884 UnstrandedReadsAssigned:23883707 PositiveStrandReadsAssigned:658039 NegativeStrandReadsAssigned:24144597 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6958447 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958447-trimmed-pair1.fastq SRR6958447-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,867,170 reads, 24,201,520 reads pseudoaligned [quant] estimated average fragment length: 226.41 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR6958447.ke.tsv 35125 SRR6958447.se.tsv 88098 total ==> SRR6958447.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.05 20.9037 1.71976 PNS24247 1044 818.59 86.3147 6.16825 PNS24249 1928 1702.59 104.223 3.58096 PNS24246 1044 818.59 86.3147 6.16825 PNS24248 1044 818.59 86.3147 6.16825 PNS24244 1471 1245.59 51.9287 2.4388 PNS24243 293 105.363 0 0 KQK14069 1603 1377.59 2413.88 102.504 KQK14071 474 258.072 47.7267 10.8184 ==> SRR6958447.se.tsv <== BRADI_1g14170v3 2676 BRADI_1g53295v3 301 BRADI_1g59795v3 300 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 606 BRADI_1g74790v3 455 BRADI_1g09890v3 0 BRADI_1g77505v3 339 BRADI_1g48960v3 0 SRR6958447 completed mapping pipeline successfully