Starting /dee2/code/volunteer_pipeline.sh SRR6958448 current disk space = 1547490316288 free memory = 1603343268 SRR6958448 SRAfilesize 0f48e251ec3b921922322441a9346767 SRR6958448.sra SRR6958448.sra file validated SRR6958448 is paired end SRR6958448 is conventional basespace SRR6958448 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.61375 18.0 18.0 25.0 18.0 32.0 2 25.64225 27.0 18.0 30.0 18.0 31.0 3 27.816 29.0 27.0 31.0 18.0 33.0 4 30.297 32.0 30.0 33.0 25.0 33.0 5 31.33325 33.0 32.0 33.0 27.0 33.0 6 35.35275 37.0 35.0 38.0 30.0 38.0 7 36.4095 38.0 37.0 38.0 34.0 38.0 8 36.59225 38.0 37.0 38.0 34.0 38.0 9 37.02225 38.0 38.0 38.0 35.0 38.0 10-14 37.180400000000006 38.0 38.0 38.0 36.2 38.0 15-19 37.21935 38.0 38.0 38.0 36.2 38.0 20-24 37.20385 38.0 38.0 38.0 36.2 38.0 25-29 37.05844999999999 38.0 38.0 38.0 35.8 38.0 30-34 36.9686 38.0 38.0 38.0 35.8 38.0 35-39 36.7255 38.0 38.0 38.0 34.4 38.0 40-44 36.6805 38.0 38.0 38.0 34.4 38.0 45-49 36.668150000000004 38.0 38.0 38.0 34.2 38.0 50-54 36.219350000000006 38.0 37.4 38.0 33.2 38.0 55-59 36.14935 38.0 37.0 38.0 32.6 38.0 60-64 36.5591 38.0 38.0 38.0 33.8 38.0 65-69 36.550349999999995 38.0 38.0 38.0 34.0 38.0 70-74 36.3843 38.0 37.8 38.0 33.6 38.0 75-79 35.79200000000001 38.0 36.6 38.0 30.6 38.0 80-84 35.63719999999999 38.0 36.4 38.0 30.6 38.0 85-89 35.8999 38.0 37.0 38.0 31.8 38.0 90-94 35.8246 38.0 36.4 38.0 31.6 38.0 95-99 35.22215 38.0 35.6 38.0 28.6 38.0 100-104 34.481899999999996 38.0 34.4 38.0 25.4 38.0 105-109 34.26610000000001 38.0 34.0 38.0 23.8 38.0 110-114 34.19955 38.0 34.0 38.0 23.6 38.0 115-119 34.09245 38.0 34.0 38.0 23.2 38.0 120-124 33.3382 38.0 32.2 38.0 20.6 38.0 125-129 32.95889999999999 37.6 31.6 38.0 18.6 38.0 130-134 31.6658 36.2 30.4 38.0 13.8 38.0 135-139 30.6399 36.0 28.0 38.0 12.8 38.0 140-144 29.35145 34.0 26.0 38.0 7.8 38.0 145-149 27.2343 33.4 16.8 38.0 2.0 38.0 150-151 20.37475 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 3.0 16 4.0 17 3.0 18 10.0 19 4.0 20 5.0 21 5.0 22 22.0 23 23.0 24 22.0 25 35.0 26 48.0 27 49.0 28 80.0 29 87.0 30 95.0 31 130.0 32 184.0 33 288.0 34 447.0 35 675.0 36 1111.0 37 665.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.37080762006976 19.613630265629194 5.715052320901529 40.30050979339952 2 19.575 12.1 27.35 40.975 3 21.525 15.275 25.924999999999997 37.275000000000006 4 25.650000000000002 20.125 24.25 29.975 5 26.400000000000002 25.874999999999996 21.275 26.450000000000003 6 24.175 30.125 23.799999999999997 21.9 7 17.65 24.099999999999998 38.35 19.900000000000002 8 20.3 24.375 28.7 26.625 9 19.875 22.8 32.074999999999996 25.25 10-14 22.42 26.224999999999998 25.945 25.41 15-19 22.95 24.709999999999997 26.135 26.205000000000002 20-24 22.895 25.31 25.855 25.94 25-29 23.265 25.11 25.895000000000003 25.729999999999997 30-34 23.205000000000002 25.240000000000002 25.7 25.855 35-39 23.294999999999998 25.035 25.36 26.31 40-44 23.119999999999997 25.355 25.790000000000003 25.735000000000003 45-49 22.900000000000002 24.935 26.115 26.05 50-54 23.07 24.79 26.27 25.869999999999997 55-59 23.03 24.755 25.855 26.36 60-64 23.185 25.335 24.955 26.525 65-69 23.990000000000002 25.215 25.045 25.75 70-74 23.605 24.685000000000002 25.205 26.505000000000003 75-79 22.915 24.52 25.974999999999998 26.590000000000003 80-84 24.21 24.560000000000002 25.46 25.77 85-89 23.630000000000003 24.46 26.005 25.905 90-94 23.48 24.92 25.455 26.145000000000003 95-99 24.035 24.37 25.395 26.200000000000003 100-104 23.549999999999997 24.86 25.61 25.979999999999997 105-109 23.865 24.93 25.35 25.855 110-114 23.345 24.01 25.885 26.76 115-119 23.990000000000002 24.39 25.585 26.035000000000004 120-124 23.645 24.490000000000002 25.840000000000003 26.025 125-129 24.135 23.919999999999998 25.41 26.534999999999997 130-134 24.224999999999998 23.68 25.855 26.240000000000002 135-139 23.630000000000003 24.84 25.52 26.009999999999998 140-144 23.87 24.19 25.755 26.185000000000002 145-149 24.39 24.445 25.240000000000002 25.924999999999997 150-151 24.462500000000002 23.5125 26.087500000000002 25.937500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 3.5 28 3.0 29 4.0 30 7.0 31 10.5 32 12.5 33 15.0 34 25.5 35 31.5 36 37.0 37 44.0 38 72.0 39 107.0 40 124.5 41 137.0 42 160.0 43 195.0 44 215.0 45 216.0 46 208.5 47 204.0 48 205.5 49 186.5 50 156.0 51 143.5 52 128.5 53 116.5 54 109.0 55 98.0 56 85.5 57 81.0 58 77.0 59 74.5 60 78.0 61 68.5 62 60.0 63 57.0 64 55.5 65 52.0 66 47.5 67 50.5 68 48.5 69 40.0 70 33.0 71 28.0 72 22.5 73 16.5 74 13.5 75 12.0 76 7.5 77 4.5 78 4.0 79 2.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 2.0875 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 2.95 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGTGT 10 0.0068378756 144.95 3 >>END_MODULE SRR6958448 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44425 33.0 33.0 34.0 32.0 34.0 2 32.303 33.0 33.0 34.0 31.0 34.0 3 32.326 33.0 33.0 34.0 31.0 34.0 4 32.27275 33.0 33.0 34.0 31.0 34.0 5 32.19575 33.0 33.0 34.0 31.0 34.0 6 36.116 38.0 38.0 38.0 33.0 38.0 7 36.06425 38.0 38.0 38.0 33.0 38.0 8 35.95375 38.0 38.0 38.0 31.0 38.0 9 36.07075 38.0 38.0 38.0 33.0 38.0 10-14 35.99265 38.0 37.8 38.0 32.2 38.0 15-19 36.26305 38.0 38.0 38.0 33.6 38.0 20-24 36.4791 38.0 38.0 38.0 34.4 38.0 25-29 36.41885 38.0 38.0 38.0 34.2 38.0 30-34 36.473 38.0 38.0 38.0 34.4 38.0 35-39 36.2705 38.0 38.0 38.0 33.8 38.0 40-44 36.066 38.0 38.0 38.0 33.0 38.0 45-49 36.1171 38.0 38.0 38.0 33.4 38.0 50-54 36.10095 38.0 38.0 38.0 33.0 38.0 55-59 36.05675 38.0 38.0 38.0 33.2 38.0 60-64 35.85855 38.0 37.4 38.0 32.6 38.0 65-69 35.57465 38.0 37.0 38.0 30.2 38.0 70-74 35.324949999999994 38.0 36.8 38.0 29.0 38.0 75-79 35.547700000000006 38.0 37.0 38.0 30.4 38.0 80-84 35.284650000000006 38.0 36.2 38.0 29.0 38.0 85-89 35.13425 38.0 36.2 38.0 28.4 38.0 90-94 34.796949999999995 38.0 35.8 38.0 27.2 38.0 95-99 34.20565 38.0 35.0 38.0 23.4 38.0 100-104 33.59925 38.0 33.8 38.0 19.4 38.0 105-109 33.3044 38.0 33.0 38.0 18.6 38.0 110-114 33.0685 38.0 32.8 38.0 16.2 38.0 115-119 32.4255 38.0 31.2 38.0 14.6 38.0 120-124 31.7928 37.4 30.4 38.0 13.4 38.0 125-129 30.983600000000003 36.6 28.4 38.0 12.6 38.0 130-134 29.662350000000004 35.2 25.4 38.0 11.4 38.0 135-139 29.1918 34.6 25.0 38.0 9.2 38.0 140-144 28.458349999999996 33.8 22.2 38.0 2.0 38.0 145-149 26.32785 33.0 13.2 38.0 2.0 38.0 150-151 19.538625 17.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 8.0 4 4.0 5 2.0 6 2.0 7 4.0 8 3.0 9 1.0 10 0.0 11 1.0 12 4.0 13 5.0 14 4.0 15 8.0 16 10.0 17 10.0 18 9.0 19 20.0 20 19.0 21 20.0 22 23.0 23 38.0 24 45.0 25 37.0 26 49.0 27 56.0 28 81.0 29 85.0 30 92.0 31 144.0 32 169.0 33 251.0 34 361.0 35 540.0 36 1013.0 37 859.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 19.825 10.95 30.325000000000003 2 28.4 24.525 25.924999999999997 21.15 3 22.35 27.175 26.6 23.875 4 24.975 32.0 20.474999999999998 22.55 5 27.450000000000003 32.1 18.95 21.5 6 23.1 35.875 21.0 20.025000000000002 7 22.375 20.150000000000002 34.4 23.075000000000003 8 24.275 24.9 21.575 29.25 9 23.799999999999997 24.25 27.175 24.775 10-14 26.22 26.275 23.035 24.47 15-19 26.27 25.480000000000004 24.22 24.03 20-24 26.064999999999998 25.765 23.77 24.4 25-29 25.545 25.669999999999998 24.22 24.565 30-34 25.474999999999998 25.75 24.349999999999998 24.425 35-39 25.775 25.564999999999998 24.0 24.66 40-44 25.955000000000002 25.615 24.095 24.335 45-49 26.195 25.71 23.56 24.535 50-54 25.825 25.36 24.45 24.365000000000002 55-59 26.325 25.115 23.885 24.675 60-64 26.345000000000002 25.180000000000003 24.02 24.455 65-69 25.94 25.385 24.425 24.25 70-74 26.46 25.28 23.905 24.355 75-79 26.584999999999997 25.525 23.880000000000003 24.01 80-84 26.325 25.36 24.27 24.044999999999998 85-89 26.435 25.155 24.14 24.27 90-94 25.985000000000003 25.31 24.654999999999998 24.05 95-99 26.740000000000002 24.83 24.47 23.96 100-104 26.86 25.585 23.880000000000003 23.674999999999997 105-109 26.415 25.374999999999996 24.3 23.91 110-114 26.685 25.419999999999998 24.385 23.51 115-119 26.784999999999997 26.125 23.985 23.105 120-124 26.795 25.979999999999997 24.165 23.06 125-129 26.529999999999998 26.115 23.635 23.72 130-134 26.495 26.02 23.62 23.865 135-139 27.51 25.290000000000003 24.310000000000002 22.89 140-144 27.334999999999997 25.705 23.985 22.975 145-149 27.18 26.215 23.925 22.68 150-151 29.099999999999998 24.125 23.400000000000002 23.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.0 27 1.0 28 2.5 29 4.5 30 5.0 31 3.5 32 7.5 33 12.5 34 18.5 35 27.5 36 37.0 37 49.5 38 64.0 39 90.0 40 120.5 41 150.0 42 170.0 43 183.0 44 189.0 45 191.5 46 183.0 47 175.5 48 184.5 49 168.5 50 149.5 51 154.0 52 148.5 53 118.5 54 102.0 55 97.5 56 95.5 57 97.0 58 90.5 59 98.0 60 97.0 61 72.5 62 62.5 63 70.0 64 73.5 65 73.0 66 56.0 67 44.0 68 48.0 69 44.0 70 36.0 71 30.0 72 26.5 73 23.0 74 19.5 75 10.5 76 7.0 77 6.5 78 2.5 79 1.5 80 1.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.45294413688978363 0.8999999999999999 3 0.10065425264217413 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.8250000000000002 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.95 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.725 0.0 0.0 0.0 0.0 136-137 4.175000000000001 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997776 spots for SRR6958448.sra Written 997776 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra Read 997774 spots for SRR6958448.sra Written 997774 spots for SRR6958448.sra SRR ids: ['SRR6958448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hr9fg46i SRR6958448.sra spots: 19955482 blocks: [[1, 997774], [997775, 1995548], [1995549, 2993322], [2993323, 3991096], [3991097, 4988870], [4988871, 5986644], [5986645, 6984418], [6984419, 7982192], [7982193, 8979966], [8979967, 9977740], [9977741, 10975514], [10975515, 11973288], [11973289, 12971062], [12971063, 13968836], [13968837, 14966610], [14966611, 15964384], [15964385, 16962158], [16962159, 17959932], [17959933, 18957706], [18957707, 19955482]] SRR6958448 file size 6740557 SRR6958448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958448 SRR6958448_1.fastq SRR6958448_2.fastq Input file: SRR6958448_1.fastq Paired file: SRR6958448_2.fastq trimmed: SRR6958448-trimmed-pair1.fastq, SRR6958448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:20:12 2024 >> started Fri Dec 6 23:20:32 2024 >> done (20.088s) 19955482 read pairs processed; of these: 34778 ( 0.17%) short read pairs filtered out after trimming by size control 31176 ( 0.16%) empty read pairs filtered out after trimming by size control 19889528 (99.67%) read pairs available; of these: 10793824 (54.27%) trimmed read pairs available after processing 9095704 (45.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 0 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 7 0.00% 26 6 0.00% 27 7 0.00% 28 9 0.00% 29 6 0.00% 30 8 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 15 0.00% 35 10 0.00% 36 16 0.00% 37 7 0.00% 38 19 0.00% 39 25 0.00% 40 18 0.00% 41 23 0.00% 42 24 0.00% 43 17 0.00% 44 25 0.00% 45 29 0.00% 46 36 0.00% 47 31 0.00% 48 34 0.00% 49 45 0.00% 50 44 0.00% 51 62 0.00% 52 51 0.00% 53 76 0.00% 54 80 0.00% 55 89 0.00% 56 89 0.00% 57 127 0.00% 58 100 0.00% 59 120 0.00% 60 129 0.00% 61 159 0.00% 62 197 0.00% 63 202 0.00% 64 194 0.00% 65 217 0.00% 66 260 0.00% 67 294 0.00% 68 350 0.00% 69 355 0.00% 70 408 0.00% 71 495 0.00% 72 531 0.00% 73 595 0.00% 74 695 0.00% 75 740 0.00% 76 859 0.00% 77 968 0.00% 78 972 0.00% 79 1211 0.01% 80 1321 0.01% 81 1527 0.01% 82 1836 0.01% 83 2168 0.01% 84 3449 0.02% 85 4399 0.02% 86 4406 0.02% 87 4584 0.02% 88 4510 0.02% 89 4890 0.02% 90 5095 0.03% 91 5606 0.03% 92 5899 0.03% 93 6210 0.03% 94 6653 0.03% 95 7266 0.04% 96 7739 0.04% 97 8256 0.04% 98 8698 0.04% 99 9240 0.05% 100 10247 0.05% 101 10563 0.05% 102 11625 0.06% 103 12415 0.06% 104 13096 0.07% 105 14024 0.07% 106 15024 0.08% 107 16045 0.08% 108 16516 0.08% 109 17713 0.09% 110 18850 0.09% 111 20032 0.10% 112 21183 0.11% 113 22315 0.11% 114 24221 0.12% 115 25729 0.13% 116 27320 0.14% 117 28672 0.14% 118 30246 0.15% 119 31468 0.16% 120 33035 0.17% 121 34506 0.17% 122 37028 0.19% 123 39133 0.20% 124 42643 0.21% 125 44624 0.22% 126 46954 0.24% 127 49982 0.25% 128 53000 0.27% 129 55405 0.28% 130 58555 0.29% 131 62265 0.31% 132 66909 0.34% 133 72072 0.36% 134 76453 0.38% 135 82871 0.42% 136 88023 0.44% 137 94886 0.48% 138 102065 0.51% 139 111490 0.56% 140 121823 0.61% 141 134301 0.68% 142 151823 0.76% 143 173280 0.87% 144 202661 1.02% 145 243650 1.23% 146 309434 1.56% 147 423999 2.13% 148 656504 3.30% 149 1325005 6.66% 150 5297262 26.63% 151 9095704 45.73% 19889528 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=15 prefix-density=0.60 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=46.90 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.2 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=14 prefix-density=0.41 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=68.24 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=13.1 sequence=GCCGCCGCCGCC SRR6958448 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:21:25 Started mapping on | Dec 06 23:21:25 Finished on | Dec 06 23:22:41 Mapping speed, Million of reads per hour | 942.14 Number of input reads | 19889528 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19538905 Uniquely mapped reads % | 98.24% Average mapped length | 294.98 Number of splices: Total | 22026647 Number of splices: Annotated (sjdb) | 20666189 Number of splices: GT/AG | 21740306 Number of splices: GC/AG | 260180 Number of splices: AT/AC | 10634 Number of splices: Non-canonical | 15527 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 131709 % of reads mapped to multiple loci | 0.66% Number of reads mapped to too many loci | 8869 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.79% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 238916 238916 238916 N_multimapping 131709 131709 131709 N_noFeature 636035 19019426 771200 N_ambiguous 455424 2698 71372 UnstrandedReadsAssigned:18447446 PositiveStrandReadsAssigned:516781 NegativeStrandReadsAssigned:18696333 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6958448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958448-trimmed-pair1.fastq SRR6958448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,889,528 reads, 18,730,622 reads pseudoaligned [quant] estimated average fragment length: 251.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6958448.ke.tsv 35125 SRR6958448.se.tsv 88098 total ==> SRR6958448.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.829 0 0 PNS24247 1044 793.281 65.399 6.42554 PNS24249 1928 1677.28 42.7448 1.98629 PNS24246 1044 793.281 65.399 6.42554 PNS24248 1044 793.281 65.399 6.42554 PNS24244 1471 1220.28 48.0582 3.06954 PNS24243 293 87.6862 0 0 KQK14069 1603 1352.28 4363.43 251.493 KQK14071 474 234.552 134.718 44.7665 ==> SRR6958448.se.tsv <== BRADI_1g14170v3 5046 BRADI_1g53295v3 360 BRADI_1g59795v3 352 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 467 BRADI_1g74790v3 140 BRADI_1g09890v3 0 BRADI_1g77505v3 330 BRADI_1g48960v3 0 SRR6958448 completed mapping pipeline successfully