Starting /dee2/code/volunteer_pipeline.sh SRR6958449 current disk space = 1547589406720 free memory = 1598390648 SRR6958449 SRAfilesize d035129409ca0951527c518f6504f23f SRR6958449.sra SRR6958449.sra file validated SRR6958449 is paired end SRR6958449 is conventional basespace SRR6958449 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958449_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.9075 30.0 18.0 33.0 18.0 34.0 2 30.88475 31.0 30.0 33.0 27.0 34.0 3 32.12675 33.0 31.0 33.0 29.0 34.0 4 32.557 33.0 33.0 33.0 31.0 34.0 5 32.24775 33.0 33.0 33.0 31.0 34.0 6 36.2705 38.0 36.0 38.0 33.0 38.0 7 37.14425 38.0 38.0 38.0 36.0 38.0 8 37.2365 38.0 38.0 38.0 36.0 38.0 9 37.47275 38.0 38.0 38.0 37.0 38.0 10-14 37.46 38.0 38.0 38.0 37.0 38.0 15-19 37.54735 38.0 38.0 38.0 38.0 38.0 20-24 37.57555 38.0 38.0 38.0 38.0 38.0 25-29 37.53355 38.0 38.0 38.0 37.8 38.0 30-34 37.522200000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.48175 38.0 38.0 38.0 37.4 38.0 40-44 37.4594 38.0 38.0 38.0 37.4 38.0 45-49 37.41725 38.0 38.0 38.0 37.0 38.0 50-54 37.31015 38.0 38.0 38.0 36.8 38.0 55-59 36.746900000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.5763 38.0 38.0 38.0 36.0 38.0 65-69 36.947649999999996 38.0 38.0 38.0 35.8 38.0 70-74 37.1411 38.0 38.0 38.0 36.0 38.0 75-79 37.178200000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.029050000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.940999999999995 38.0 38.0 38.0 35.4 38.0 90-94 36.87135 38.0 38.0 38.0 35.0 38.0 95-99 36.7761 38.0 38.0 38.0 35.0 38.0 100-104 36.63775 38.0 38.0 38.0 34.6 38.0 105-109 36.5176 38.0 38.0 38.0 34.0 38.0 110-114 36.47255 38.0 38.0 38.0 34.0 38.0 115-119 36.2913 38.0 38.0 38.0 33.4 38.0 120-124 35.89705 38.0 36.8 38.0 31.8 38.0 125-129 35.4245 38.0 36.0 38.0 31.0 38.0 130-134 35.355599999999995 38.0 36.0 38.0 29.6 38.0 135-139 34.6749 38.0 35.0 38.0 28.0 38.0 140-144 34.2787 38.0 34.6 38.0 26.2 38.0 145-149 33.621950000000005 38.0 33.0 38.0 23.0 38.0 150-151 28.610750000000003 34.5 18.0 38.0 6.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 6.0 21 3.0 22 4.0 23 3.0 24 11.0 25 13.0 26 13.0 27 15.0 28 30.0 29 27.0 30 30.0 31 53.0 32 54.0 33 101.0 34 168.0 35 348.0 36 815.0 37 2297.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.825 13.225000000000001 8.200000000000001 36.75 2 24.062031015507753 11.78089044522261 33.11655827913957 31.040520260130066 3 18.825 17.849999999999998 26.775 36.55 4 24.05 22.875 23.425 29.65 5 25.474999999999998 27.525 23.125 23.875 6 23.925 29.549999999999997 24.2 22.325 7 17.45 24.25 39.050000000000004 19.25 8 20.849999999999998 24.025 28.9 26.224999999999998 9 19.725 20.474999999999998 34.25 25.55 10-14 23.15078769692423 25.571392848212053 25.69142285571393 25.586396599149786 15-19 22.73 25.41 26.075 25.785000000000004 20-24 23.48 25.215 25.465 25.840000000000003 25-29 23.41 24.57 26.325 25.695 30-34 22.99 25.255 25.319999999999997 26.435 35-39 22.96 25.55 25.729999999999997 25.759999999999998 40-44 23.200000000000003 25.535000000000004 25.900000000000002 25.365 45-49 23.22 25.095 25.705 25.979999999999997 50-54 22.855 25.180000000000003 25.240000000000002 26.724999999999998 55-59 23.905553303607622 25.091203891366032 25.324280502634778 25.678962302391568 60-64 23.57106469689251 25.022924095771774 25.568008150789606 25.838003056546103 65-69 23.08078022363737 25.60798275083989 25.482625482625483 25.828611542897256 70-74 23.65 24.575 25.715 26.06 75-79 23.380000000000003 25.36 25.650000000000002 25.61 80-84 23.56 24.65 26.075 25.715 85-89 23.425 24.93 25.27 26.375 90-94 23.565 25.124999999999996 25.369999999999997 25.94 95-99 24.255 24.69 25.025 26.029999999999998 100-104 24.055 24.215 25.874999999999996 25.855 105-109 23.669999999999998 25.165 25.77 25.395 110-114 24.19 24.335 25.72 25.755 115-119 23.849999999999998 25.195 25.45 25.505 120-124 24.224999999999998 24.605 25.645 25.525 125-129 24.2 25.230000000000004 24.560000000000002 26.009999999999998 130-134 24.255 24.165 25.580000000000002 26.0 135-139 24.0 24.57 25.629999999999995 25.8 140-144 23.96 24.575 25.27 26.195 145-149 23.965 24.82 25.365 25.85 150-151 24.725 24.9875 24.6125 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 3.0 28 2.5 29 2.5 30 5.5 31 6.0 32 9.0 33 19.5 34 23.5 35 29.5 36 45.0 37 59.5 38 69.0 39 86.0 40 120.0 41 158.0 42 184.5 43 197.0 44 218.0 45 221.0 46 203.5 47 198.0 48 190.0 49 177.0 50 175.5 51 159.5 52 131.0 53 110.5 54 94.0 55 85.5 56 89.0 57 86.5 58 77.5 59 88.5 60 86.0 61 71.0 62 63.0 63 58.5 64 54.5 65 54.5 66 55.0 67 46.5 68 37.0 69 28.0 70 24.0 71 22.5 72 20.0 73 15.0 74 12.0 75 9.5 76 5.5 77 3.5 78 4.0 79 3.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 1.32 60-64 1.8499999999999999 65-69 0.28500000000000003 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.7375 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.225 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958449 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958449_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.925 33.0 33.0 34.0 32.0 34.0 2 33.04175 34.0 33.0 34.0 32.0 34.0 3 33.04025 34.0 33.0 34.0 32.0 34.0 4 33.06 34.0 33.0 34.0 32.0 34.0 5 33.03375 34.0 33.0 34.0 32.0 34.0 6 37.175 38.0 38.0 38.0 37.0 38.0 7 37.2815 38.0 38.0 38.0 37.0 38.0 8 37.27 38.0 38.0 38.0 37.0 38.0 9 37.191 38.0 38.0 38.0 37.0 38.0 10-14 37.2433 38.0 38.0 38.0 37.0 38.0 15-19 37.18855 38.0 38.0 38.0 37.0 38.0 20-24 37.16675 38.0 38.0 38.0 36.8 38.0 25-29 37.19095 38.0 38.0 38.0 37.0 38.0 30-34 37.15964999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.09695 38.0 38.0 38.0 36.8 38.0 40-44 37.0866 38.0 38.0 38.0 36.4 38.0 45-49 37.124199999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.0712 38.0 38.0 38.0 36.2 38.0 55-59 36.93345000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.89175 38.0 38.0 38.0 36.0 38.0 65-69 36.8712 38.0 38.0 38.0 35.8 38.0 70-74 36.83335 38.0 38.0 38.0 35.8 38.0 75-79 36.78510000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.821600000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.655449999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.526250000000005 38.0 38.0 38.0 34.8 38.0 95-99 36.49114999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.37585 38.0 38.0 38.0 34.0 38.0 105-109 36.096 38.0 38.0 38.0 33.6 38.0 110-114 36.017399999999995 38.0 37.8 38.0 33.2 38.0 115-119 35.77655 38.0 37.4 38.0 32.6 38.0 120-124 35.67165000000001 38.0 37.0 38.0 31.6 38.0 125-129 35.5249 38.0 36.2 38.0 31.2 38.0 130-134 35.4293 38.0 36.0 38.0 30.6 38.0 135-139 35.19355 38.0 36.0 38.0 29.4 38.0 140-144 34.807300000000005 38.0 36.0 38.0 28.8 38.0 145-149 34.3579 38.0 35.2 38.0 27.6 38.0 150-151 30.1205 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 4.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 5.0 15 2.0 16 1.0 17 2.0 18 4.0 19 4.0 20 5.0 21 6.0 22 6.0 23 10.0 24 10.0 25 12.0 26 16.0 27 18.0 28 23.0 29 40.0 30 40.0 31 40.0 32 60.0 33 70.0 34 129.0 35 253.0 36 586.0 37 2637.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0 19.55 10.274999999999999 29.175 2 30.675 23.849999999999998 24.625 20.849999999999998 3 22.95 25.8 27.150000000000002 24.099999999999998 4 26.1 31.2 20.0 22.7 5 26.5 32.300000000000004 19.775000000000002 21.425 6 23.05 33.175 21.15 22.625 7 22.25 20.05 34.449999999999996 23.25 8 24.625 23.325000000000003 23.674999999999997 28.375 9 23.150000000000002 22.375 27.425 27.05 10-14 26.200000000000003 26.025 23.01 24.765 15-19 25.629999999999995 25.5 23.835 25.035 20-24 25.779999999999998 25.805 23.830000000000002 24.585 25-29 25.650000000000002 25.635 23.925 24.79 30-34 25.7 25.415 24.81 24.075 35-39 26.41 25.66 24.185000000000002 23.745 40-44 26.119999999999997 25.27 23.810000000000002 24.8 45-49 25.674999999999997 25.259999999999998 24.745 24.32 50-54 26.075 26.075 23.544999999999998 24.305 55-59 26.009999999999998 24.87 24.215 24.905 60-64 25.91 25.324999999999996 24.89 23.875 65-69 25.86 25.15 24.21 24.779999999999998 70-74 26.784999999999997 24.365000000000002 24.47 24.38 75-79 26.395000000000003 24.92 24.2 24.485 80-84 25.385 25.22 24.765 24.63 85-89 26.279999999999998 25.174999999999997 24.3 24.245 90-94 25.995 25.369999999999997 24.845 23.79 95-99 26.325 24.9 24.44 24.335 100-104 26.169999999999998 24.81 24.5 24.52 105-109 26.334999999999997 25.369999999999997 24.05 24.245 110-114 26.090000000000003 25.52 24.51 23.880000000000003 115-119 26.11 25.665 24.145 24.08 120-124 26.1 25.655 24.41 23.835 125-129 26.179999999999996 25.564999999999998 24.63 23.625 130-134 26.779999999999998 25.319999999999997 24.205 23.695 135-139 26.415 25.83 24.335 23.419999999999998 140-144 27.42 25.235000000000003 24.385 22.96 145-149 26.290000000000003 26.355 24.529999999999998 22.825 150-151 26.5625 26.5 24.1625 22.775000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.0 28 1.5 29 1.5 30 4.0 31 6.0 32 9.0 33 15.0 34 20.0 35 25.5 36 37.5 37 51.5 38 64.5 39 83.0 40 107.0 41 133.5 42 157.5 43 179.5 44 184.0 45 194.0 46 209.5 47 200.0 48 182.5 49 167.0 50 165.0 51 148.5 52 137.5 53 140.0 54 121.0 55 95.5 56 80.5 57 85.0 58 85.0 59 82.5 60 82.0 61 75.5 62 71.5 63 72.0 64 71.0 65 66.5 66 61.0 67 49.5 68 44.5 69 50.0 70 44.5 71 34.5 72 30.0 73 23.5 74 16.5 75 12.0 76 7.5 77 5.0 78 2.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.2750000000000004 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.5875000000000004 0.0 0.0 0.0 0.0 136-137 3.8375 0.0 0.0 0.0 0.0 138-139 4.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGCTC 10 0.006830828 145.0 5 >>END_MODULE Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273789 spots for SRR6958449.sra Written 1273789 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra Read 1273782 spots for SRR6958449.sra Written 1273782 spots for SRR6958449.sra SRR ids: ['SRR6958449.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8tm96y_y SRR6958449.sra spots: 25475647 blocks: [[1, 1273782], [1273783, 2547564], [2547565, 3821346], [3821347, 5095128], [5095129, 6368910], [6368911, 7642692], [7642693, 8916474], [8916475, 10190256], [10190257, 11464038], [11464039, 12737820], [12737821, 14011602], [14011603, 15285384], [15285385, 16559166], [16559167, 17832948], [17832949, 19106730], [19106731, 20380512], [20380513, 21654294], [21654295, 22928076], [22928077, 24201858], [24201859, 25475647]] SRR6958449 file size 8611160 SRR6958449 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958449 SRR6958449_1.fastq SRR6958449_2.fastq Input file: SRR6958449_1.fastq Paired file: SRR6958449_2.fastq trimmed: SRR6958449-trimmed-pair1.fastq, SRR6958449-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:21:25 2024 >> started Fri Dec 6 23:21:51 2024 >> done (26.286s) 25475647 read pairs processed; of these: 29655 ( 0.12%) short read pairs filtered out after trimming by size control 35712 ( 0.14%) empty read pairs filtered out after trimming by size control 25410280 (99.74%) read pairs available; of these: 9929131 (39.08%) trimmed read pairs available after processing 15481149 (60.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 5 0.00% 21 8 0.00% 22 13 0.00% 23 7 0.00% 24 14 0.00% 25 6 0.00% 26 12 0.00% 27 10 0.00% 28 11 0.00% 29 7 0.00% 30 7 0.00% 31 10 0.00% 32 14 0.00% 33 17 0.00% 34 6 0.00% 35 9 0.00% 36 5 0.00% 37 9 0.00% 38 17 0.00% 39 11 0.00% 40 14 0.00% 41 17 0.00% 42 26 0.00% 43 15 0.00% 44 20 0.00% 45 23 0.00% 46 31 0.00% 47 31 0.00% 48 33 0.00% 49 35 0.00% 50 41 0.00% 51 46 0.00% 52 47 0.00% 53 54 0.00% 54 50 0.00% 55 67 0.00% 56 82 0.00% 57 83 0.00% 58 102 0.00% 59 134 0.00% 60 143 0.00% 61 145 0.00% 62 178 0.00% 63 187 0.00% 64 222 0.00% 65 238 0.00% 66 234 0.00% 67 334 0.00% 68 341 0.00% 69 356 0.00% 70 444 0.00% 71 481 0.00% 72 577 0.00% 73 671 0.00% 74 781 0.00% 75 979 0.00% 76 1000 0.00% 77 1050 0.00% 78 1226 0.00% 79 1393 0.01% 80 1559 0.01% 81 1775 0.01% 82 2097 0.01% 83 2360 0.01% 84 3455 0.01% 85 4330 0.02% 86 4495 0.02% 87 4854 0.02% 88 5180 0.02% 89 5329 0.02% 90 5686 0.02% 91 6235 0.02% 92 6614 0.03% 93 7010 0.03% 94 7832 0.03% 95 8140 0.03% 96 8748 0.03% 97 9370 0.04% 98 9682 0.04% 99 10452 0.04% 100 11233 0.04% 101 11822 0.05% 102 12735 0.05% 103 13910 0.05% 104 14362 0.06% 105 15805 0.06% 106 16661 0.07% 107 17087 0.07% 108 17874 0.07% 109 18930 0.07% 110 19964 0.08% 111 21312 0.08% 112 22264 0.09% 113 23737 0.09% 114 25447 0.10% 115 26974 0.11% 116 28223 0.11% 117 29393 0.12% 118 30088 0.12% 119 31352 0.12% 120 32397 0.13% 121 33804 0.13% 122 35943 0.14% 123 37549 0.15% 124 39831 0.16% 125 41103 0.16% 126 42925 0.17% 127 44988 0.18% 128 46322 0.18% 129 47619 0.19% 130 49505 0.19% 131 51643 0.20% 132 55135 0.22% 133 58073 0.23% 134 60579 0.24% 135 65078 0.26% 136 68662 0.27% 137 72003 0.28% 138 76115 0.30% 139 81715 0.32% 140 86556 0.34% 141 93965 0.37% 142 103201 0.41% 143 114711 0.45% 144 130971 0.52% 145 153184 0.60% 146 190328 0.75% 147 268450 1.06% 148 399924 1.57% 149 825208 3.25% 150 5985121 23.55% 151 15481149 60.92% 25410280 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=256.09 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=10.0 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=13 fanout-score=104.60 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=16.5 sequence=GCCGCCGCCGCC SRR6958449 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:22:35 Started mapping on | Dec 06 23:22:35 Finished on | Dec 06 23:24:44 Mapping speed, Million of reads per hour | 709.12 Number of input reads | 25410280 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24676431 Uniquely mapped reads % | 97.11% Average mapped length | 296.81 Number of splices: Total | 28435643 Number of splices: Annotated (sjdb) | 26743065 Number of splices: GT/AG | 28055475 Number of splices: GC/AG | 329955 Number of splices: AT/AC | 14187 Number of splices: Non-canonical | 36026 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240836 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 16666 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 507553 507553 507553 N_multimapping 240836 240836 240836 N_noFeature 711677 24037886 893995 N_ambiguous 549108 3584 94796 UnstrandedReadsAssigned:23415646 PositiveStrandReadsAssigned:634961 NegativeStrandReadsAssigned:23687640 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958449 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958449-trimmed-pair1.fastq SRR6958449-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,410,280 reads, 23,715,664 reads pseudoaligned [quant] estimated average fragment length: 265.146 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR6958449.ke.tsv 35125 SRR6958449.se.tsv 88098 total ==> SRR6958449.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.388 94.1182 8.70995 PNS24247 1044 779.854 55.11 4.39723 PNS24249 1928 1663.85 89.8128 3.35881 PNS24246 1044 779.854 55.11 4.39723 PNS24248 1044 779.854 55.11 4.39723 PNS24244 1471 1206.85 46.7391 2.40984 PNS24243 293 83.8991 0 0 KQK14069 1603 1338.85 3257.74 151.407 KQK14071 474 224.818 48.5217 13.4297 ==> SRR6958449.se.tsv <== BRADI_1g14170v3 3714 BRADI_1g53295v3 299 BRADI_1g59795v3 340 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 900 BRADI_1g74790v3 423 BRADI_1g09890v3 0 BRADI_1g77505v3 358 BRADI_1g48960v3 0 SRR6958449 completed mapping pipeline successfully