Starting /dee2/code/volunteer_pipeline.sh SRR6958450 current disk space = 1547594792960 free memory = 1600646876 SRR6958450 SRAfilesize ea474d97f4a9bf129cb0f31a5a937eff SRR6958450.sra SRR6958450.sra file validated SRR6958450 is paired end SRR6958450 is conventional basespace SRR6958450 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958450_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7365 33.0 33.0 34.0 32.0 34.0 2 31.26525 33.0 31.0 33.0 28.0 34.0 3 31.9095 33.0 31.0 33.0 29.0 34.0 4 31.897 33.0 31.0 33.0 29.0 34.0 5 32.89325 33.0 33.0 34.0 32.0 34.0 6 36.22075 38.0 36.0 38.0 33.0 38.0 7 37.03375 38.0 37.0 38.0 35.0 38.0 8 37.4055 38.0 38.0 38.0 37.0 38.0 9 37.539 38.0 38.0 38.0 37.0 38.0 10-14 37.5056 38.0 38.0 38.0 37.2 38.0 15-19 37.51965 38.0 38.0 38.0 38.0 38.0 20-24 37.52325 38.0 38.0 38.0 38.0 38.0 25-29 37.49955 38.0 38.0 38.0 37.8 38.0 30-34 37.4834 38.0 38.0 38.0 37.6 38.0 35-39 37.436099999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.46705 38.0 38.0 38.0 37.0 38.0 45-49 37.41564999999999 38.0 38.0 38.0 37.4 38.0 50-54 37.41295 38.0 38.0 38.0 37.0 38.0 55-59 37.2178 38.0 38.0 38.0 36.8 38.0 60-64 36.9696 38.0 38.0 38.0 36.0 38.0 65-69 37.24635 38.0 38.0 38.0 36.8 38.0 70-74 37.21115 38.0 38.0 38.0 36.4 38.0 75-79 37.13340000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.027750000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.964150000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.88629999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.7731 38.0 38.0 38.0 34.6 38.0 100-104 36.681 38.0 38.0 38.0 34.2 38.0 105-109 36.59465 38.0 38.0 38.0 34.2 38.0 110-114 36.327000000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.17805 38.0 37.4 38.0 33.6 38.0 120-124 35.8587 38.0 37.0 38.0 31.2 38.0 125-129 35.6971 38.0 36.2 38.0 31.0 38.0 130-134 35.30385 38.0 36.0 38.0 29.0 38.0 135-139 34.79125 38.0 35.6 38.0 27.6 38.0 140-144 34.71235 38.0 35.6 38.0 27.6 38.0 145-149 33.795249999999996 38.0 33.8 38.0 23.8 38.0 150-151 27.74 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 5.0 19 1.0 20 2.0 21 1.0 22 3.0 23 6.0 24 8.0 25 12.0 26 12.0 27 6.0 28 27.0 29 28.0 30 28.0 31 55.0 32 64.0 33 103.0 34 151.0 35 290.0 36 758.0 37 2433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.175 9.425 8.85 34.55 2 23.5 10.825 34.150000000000006 31.525 3 21.5 15.275 25.2 38.025 4 27.0 20.575 21.925 30.5 5 27.474999999999998 26.3 23.075000000000003 23.150000000000002 6 25.35 29.025000000000002 23.575 22.05 7 19.975 23.05 36.25 20.724999999999998 8 22.35 22.475 28.275 26.900000000000002 9 20.625 21.275 31.175000000000004 26.924999999999997 10-14 24.25621281064053 25.311265563278162 24.681234061703087 25.751287564378217 15-19 24.490000000000002 23.735 25.380000000000003 26.395000000000003 20-24 24.45 24.195 25.145 26.21 25-29 24.169999999999998 24.075 25.259999999999998 26.495 30-34 24.845 24.465 24.325 26.365 35-39 24.72 24.67 24.445 26.165 40-44 24.66 23.925 24.695 26.72 45-49 24.57 23.91 25.169999999999998 26.35 50-54 24.72 23.755000000000003 24.745 26.779999999999998 55-59 25.092862162433487 23.521734765585784 24.736472241742796 26.648930830237926 60-64 24.639429117041058 23.780089451731243 24.438413990652798 27.142067440574902 65-69 25.0 23.325000000000003 24.805 26.87 70-74 24.995 23.46 24.985 26.56 75-79 25.185000000000002 23.53 24.79 26.495 80-84 25.095 23.53 25.009999999999998 26.365 85-89 24.55 23.76 24.57 27.12 90-94 25.505 23.685000000000002 23.7 27.11 95-99 25.4 23.125 24.425 27.05 100-104 25.535000000000004 23.775 24.335 26.355 105-109 25.509999999999998 23.525 24.08 26.884999999999998 110-114 24.915000000000003 23.79 24.465 26.83 115-119 25.080000000000002 23.93 24.38 26.61 120-124 25.814999999999998 24.07 24.15 25.965 125-129 25.474999999999998 23.84 23.855 26.83 130-134 25.19 24.03 23.905 26.875 135-139 25.759999999999998 23.845 23.615 26.779999999999998 140-144 25.240000000000002 24.44 24.015 26.305 145-149 25.66 24.224999999999998 23.57 26.545 150-151 25.5 24.212500000000002 23.6375 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 2.5 29 3.0 30 3.0 31 5.0 32 10.5 33 15.0 34 14.5 35 22.5 36 37.0 37 41.0 38 56.0 39 87.0 40 95.5 41 106.5 42 134.0 43 149.0 44 160.0 45 168.0 46 174.5 47 192.0 48 193.0 49 175.0 50 161.0 51 151.5 52 134.0 53 117.0 54 112.5 55 116.5 56 113.5 57 97.0 58 93.5 59 92.0 60 85.0 61 83.5 62 85.5 63 79.5 64 80.0 65 77.5 66 74.0 67 67.5 68 52.0 69 48.5 70 48.0 71 37.5 72 30.5 73 32.0 74 27.5 75 20.5 76 11.5 77 6.0 78 5.0 79 4.0 80 3.0 81 3.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.38999999999999996 60-64 0.505 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.7625 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.9000000000000004 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.025 114-115 3.625 0.0 0.0 0.0 0.025 116-117 4.1625 0.0 0.0 0.0 0.025 118-119 4.887499999999999 0.0 0.0 0.0 0.025 120-121 5.6125 0.0 0.0 0.0 0.025 122-123 6.2125 0.0 0.0 0.0 0.025 124-125 6.8125 0.0 0.0 0.0 0.025 126-127 7.3125 0.0 0.0 0.0 0.025 128-129 7.7875 0.0 0.0 0.0 0.025 130-131 8.6625 0.0 0.0 0.0 0.025 132-133 9.4875 0.0 0.0 0.0 0.025 134-135 10.3125 0.0 0.0 0.0 0.025 136-137 11.149999999999999 0.0 0.0 0.0 0.025 138-139 12.3375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 25 5.020576E-4 28.957499 140-144 >>END_MODULE SRR6958450 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958450_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.919 33.0 33.0 34.0 32.0 34.0 2 32.97075 33.0 33.0 34.0 32.0 34.0 3 32.99125 34.0 33.0 34.0 32.0 34.0 4 32.99925 34.0 33.0 34.0 33.0 34.0 5 33.0415 34.0 33.0 34.0 33.0 34.0 6 37.18775 38.0 38.0 38.0 37.0 38.0 7 37.15475 38.0 38.0 38.0 37.0 38.0 8 37.26475 38.0 38.0 38.0 37.0 38.0 9 37.17475 38.0 38.0 38.0 37.0 38.0 10-14 37.17925 38.0 38.0 38.0 37.0 38.0 15-19 37.13175 38.0 38.0 38.0 37.0 38.0 20-24 37.075149999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.131299999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.10015 38.0 38.0 38.0 37.0 38.0 35-39 37.05475 38.0 38.0 38.0 37.0 38.0 40-44 37.04935 38.0 38.0 38.0 37.0 38.0 45-49 37.051100000000005 38.0 38.0 38.0 37.0 38.0 50-54 36.97575 38.0 38.0 38.0 36.2 38.0 55-59 36.9187 38.0 38.0 38.0 36.0 38.0 60-64 36.92235000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.832049999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.83945 38.0 38.0 38.0 36.0 38.0 75-79 36.7537 38.0 38.0 38.0 35.2 38.0 80-84 36.74775000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.63805 38.0 38.0 38.0 35.0 38.0 90-94 36.544200000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.419050000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.34465 38.0 38.0 38.0 34.0 38.0 105-109 36.2838 38.0 38.0 38.0 34.0 38.0 110-114 35.946799999999996 38.0 38.0 38.0 33.0 38.0 115-119 35.94564999999999 38.0 38.0 38.0 33.2 38.0 120-124 35.87140000000001 38.0 38.0 38.0 33.0 38.0 125-129 35.69255 38.0 37.0 38.0 32.8 38.0 130-134 35.45530000000001 38.0 36.0 38.0 31.4 38.0 135-139 35.28385 38.0 36.0 38.0 30.6 38.0 140-144 34.7635 38.0 35.8 38.0 28.4 38.0 145-149 33.86235 38.0 34.2 38.0 23.8 38.0 150-151 29.66975 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 2.0 5 1.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 2.0 15 2.0 16 3.0 17 4.0 18 3.0 19 5.0 20 3.0 21 4.0 22 8.0 23 2.0 24 13.0 25 16.0 26 22.0 27 14.0 28 25.0 29 32.0 30 38.0 31 49.0 32 58.0 33 90.0 34 124.0 35 217.0 36 522.0 37 2716.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.925 18.775 10.775 30.525000000000002 2 29.486858573216523 23.204005006257823 25.632040050062578 21.67709637046308 3 24.330413016270338 25.056320400500624 24.25531914893617 26.357947434292868 4 26.74011016524787 30.42063094641963 19.053580370555835 23.785678517776667 5 26.958698372966204 31.439299123904878 19.148936170212767 22.453066332916144 6 24.6558197747184 34.11764705882353 19.94993742177722 21.27659574468085 7 22.62828535669587 19.94993742177722 32.61576971214018 24.80600750938673 8 25.20650813516896 22.478097622027533 21.927409261576972 30.387984981226534 9 24.680851063829788 21.65206508135169 26.408010012515643 27.25907384230288 10-14 26.454099509460406 25.427970767844627 22.05425968565422 26.063670037040744 15-19 26.197747183979974 24.055068836045056 23.714643304130163 26.032540675844807 20-24 26.20907179333133 24.48683288274757 23.115049564433765 26.189045759487335 25-29 26.376927698778292 25.025035049068695 22.58161425996395 26.016422992189064 30-34 26.504757135703557 24.94742113169755 23.01952929394091 25.528292438657985 35-39 26.31394533987386 24.71718890779858 22.94023425768345 26.02863149464411 40-44 26.219084810253328 24.331631120456592 23.23019925903675 26.219084810253328 45-49 26.875156367275455 24.243182386790092 23.117338003502628 25.764323242431825 50-54 26.902486616300596 24.06063941562015 23.46024916195527 25.57662480612398 55-59 26.965617336469645 24.087883489314848 22.961813723036887 25.984685451178617 60-64 26.520194184475255 24.368149742255145 23.237075221460387 25.87458085180922 65-69 26.97332198808749 24.755993793483157 22.56869713198859 25.701987086440763 70-74 26.938285199459433 24.29551028580009 23.384553781470544 25.381650733269932 75-79 26.69336670838548 23.88986232790989 23.60450563204005 25.81226533166458 80-84 26.85745734727573 24.8411467453845 23.21008655626157 25.091309351078202 85-89 26.614315010253588 24.158455459410792 23.478217376081627 25.749012154253986 90-94 27.04163330664532 24.474579663730985 23.578863090472378 24.90492393915132 95-99 27.48698959167334 23.789031224979983 23.398718975180145 25.325260208166533 100-104 27.030272704528397 24.198148611458596 22.842131598699027 25.929447085313985 105-109 27.073951766236366 24.77734414089863 22.951065746022216 25.197638346842787 110-114 27.171737389911932 24.89991993594876 22.693154523618894 25.235188150520415 115-119 27.182619142971564 25.075090108129753 22.722266720064077 25.0200240288346 120-124 27.47786060939611 25.00125081302847 22.764797118126783 24.756091459448644 125-129 27.866473149492016 25.73444772533907 22.371252690055552 24.027826435113358 130-134 28.54927463731866 24.68734367183592 22.846423211605803 23.916958479239618 135-139 28.30122591943958 25.504128096072055 23.2424318238679 22.952214160620464 140-144 29.010307215050535 25.768037626338437 22.385669968978284 22.835985189632744 145-149 29.23692769577183 24.938704028021018 22.852139104328245 22.972229171878908 150-151 28.912798698861504 25.209558363568124 22.95758788940323 22.920055048167146 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 0.0 27 1.5 28 2.5 29 1.5 30 0.5 31 2.0 32 6.5 33 8.5 34 9.5 35 14.0 36 24.0 37 41.0 38 58.0 39 70.5 40 81.5 41 97.0 42 113.5 43 153.5 44 162.5 45 149.5 46 165.0 47 171.0 48 179.0 49 170.0 50 147.5 51 150.5 52 147.0 53 133.5 54 116.0 55 104.5 56 111.5 57 110.0 58 101.0 59 99.5 60 110.0 61 107.5 62 105.5 63 102.0 64 81.0 65 80.0 66 90.0 67 74.0 68 58.0 69 63.5 70 54.5 71 46.0 72 38.5 73 20.0 74 13.5 75 13.0 76 12.5 77 8.0 78 4.0 79 3.0 80 2.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.15 5 0.125 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.11 15-19 0.125 20-24 0.13 25-29 0.13999999999999999 30-34 0.15 35-39 0.11 40-44 0.13 45-49 0.075 50-54 0.065 55-59 0.095 60-64 0.095 65-69 0.105 70-74 0.105 75-79 0.125 80-84 0.065 85-89 0.034999999999999996 90-94 0.08 95-99 0.08 100-104 0.075 105-109 0.06999999999999999 110-114 0.08 115-119 0.12 120-124 0.065 125-129 0.095 130-134 0.05 135-139 0.075 140-144 0.06999999999999999 145-149 0.075 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8342625443487 97.5 2 1.0136847440446022 2.0 3 0.12671059300557527 0.375 4 0.0 0.0 5 0.025342118601115054 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 6.1375 0.0 0.0 0.0 0.0 124-125 6.7625 0.0 0.0 0.0 0.0 126-127 7.2625 0.0 0.0 0.0 0.0 128-129 7.762499999999999 0.0 0.0 0.0 0.0 130-131 8.6375 0.0 0.0 0.0 0.0 132-133 9.45 0.0 0.0 0.0 0.0 134-135 10.337499999999999 0.0 0.0 0.0 0.0 136-137 11.225000000000001 0.0 0.0 0.0 0.0 138-139 12.399999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGAGG 20 0.00593511 29.0 100-104 >>END_MODULE Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra Read 1256177 spots for SRR6958450.sra Written 1256177 spots for SRR6958450.sra Read 1256166 spots for SRR6958450.sra Written 1256166 spots for SRR6958450.sra SRR ids: ['SRR6958450.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vh9mpw01 SRR6958450.sra spots: 25123331 blocks: [[1, 1256166], [1256167, 2512332], [2512333, 3768498], [3768499, 5024664], [5024665, 6280830], [6280831, 7536996], [7536997, 8793162], [8793163, 10049328], [10049329, 11305494], [11305495, 12561660], [12561661, 13817826], [13817827, 15073992], [15073993, 16330158], [16330159, 17586324], [17586325, 18842490], [18842491, 20098656], [20098657, 21354822], [21354823, 22610988], [22610989, 23867154], [23867155, 25123331]] SRR6958450 file size 8491772 SRR6958450 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958450 SRR6958450_1.fastq SRR6958450_2.fastq Input file: SRR6958450_1.fastq Paired file: SRR6958450_2.fastq trimmed: SRR6958450-trimmed-pair1.fastq, SRR6958450-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:25:44 2024 >> started Fri Dec 6 23:26:14 2024 >> done (29.332s) 25123331 read pairs processed; of these: 33674 ( 0.13%) short read pairs filtered out after trimming by size control 55387 ( 0.22%) empty read pairs filtered out after trimming by size control 25034270 (99.65%) read pairs available; of these: 12485959 (49.88%) trimmed read pairs available after processing 12548311 (50.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 6 0.00% 21 6 0.00% 22 4 0.00% 23 8 0.00% 24 8 0.00% 25 6 0.00% 26 11 0.00% 27 7 0.00% 28 19 0.00% 29 11 0.00% 30 9 0.00% 31 7 0.00% 32 14 0.00% 33 9 0.00% 34 12 0.00% 35 10 0.00% 36 25 0.00% 37 8 0.00% 38 12 0.00% 39 12 0.00% 40 16 0.00% 41 22 0.00% 42 10 0.00% 43 28 0.00% 44 26 0.00% 45 42 0.00% 46 32 0.00% 47 38 0.00% 48 45 0.00% 49 43 0.00% 50 59 0.00% 51 83 0.00% 52 85 0.00% 53 72 0.00% 54 94 0.00% 55 116 0.00% 56 138 0.00% 57 132 0.00% 58 149 0.00% 59 234 0.00% 60 267 0.00% 61 279 0.00% 62 328 0.00% 63 358 0.00% 64 463 0.00% 65 466 0.00% 66 566 0.00% 67 618 0.00% 68 761 0.00% 69 804 0.00% 70 999 0.00% 71 1144 0.00% 72 1379 0.01% 73 1650 0.01% 74 1802 0.01% 75 2003 0.01% 76 2367 0.01% 77 2697 0.01% 78 2990 0.01% 79 3499 0.01% 80 4152 0.02% 81 4641 0.02% 82 5289 0.02% 83 6111 0.02% 84 8168 0.03% 85 9096 0.04% 86 9894 0.04% 87 10995 0.04% 88 12057 0.05% 89 12929 0.05% 90 14465 0.06% 91 15841 0.06% 92 17457 0.07% 93 19167 0.08% 94 20979 0.08% 95 22812 0.09% 96 24513 0.10% 97 26415 0.11% 98 28368 0.11% 99 30170 0.12% 100 32856 0.13% 101 34843 0.14% 102 37726 0.15% 103 40637 0.16% 104 43599 0.17% 105 46062 0.18% 106 48902 0.20% 107 51064 0.20% 108 53291 0.21% 109 55902 0.22% 110 58640 0.23% 111 61358 0.25% 112 65489 0.26% 113 68614 0.27% 114 72931 0.29% 115 76690 0.31% 116 79402 0.32% 117 81207 0.32% 118 84402 0.34% 119 85684 0.34% 120 88489 0.35% 121 91110 0.36% 122 94175 0.38% 123 98233 0.39% 124 103102 0.41% 125 106371 0.42% 126 108988 0.44% 127 111609 0.45% 128 113281 0.45% 129 115392 0.46% 130 118006 0.47% 131 120107 0.48% 132 124218 0.50% 133 127822 0.51% 134 132304 0.53% 135 136902 0.55% 136 140062 0.56% 137 142219 0.57% 138 146017 0.58% 139 150593 0.60% 140 154590 0.62% 141 159513 0.64% 142 169502 0.68% 143 178688 0.71% 144 194918 0.78% 145 216809 0.87% 146 246546 0.98% 147 306231 1.22% 148 432704 1.73% 149 844383 3.37% 150 5703140 22.78% 151 12548311 50.12% 25034270 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=20 prefix-density=0.87 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.25 sequence-density-rank=11 fanout-score=34.05 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=9.1 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=17 prefix-density=0.55 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.17 sequence-density-rank=19 fanout-score=66.64 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=12.4 sequence=GCCGCCGCCGCC SRR6958450 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:27:11 Started mapping on | Dec 06 23:27:12 Finished on | Dec 06 23:28:54 Mapping speed, Million of reads per hour | 883.56 Number of input reads | 25034270 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 24443261 Uniquely mapped reads % | 97.64% Average mapped length | 290.91 Number of splices: Total | 26165364 Number of splices: Annotated (sjdb) | 24536791 Number of splices: GT/AG | 25821668 Number of splices: GC/AG | 312816 Number of splices: AT/AC | 9397 Number of splices: Non-canonical | 21483 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 149926 % of reads mapped to multiple loci | 0.60% Number of reads mapped to too many loci | 19222 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 456021 456021 456021 N_multimapping 149926 149926 149926 N_noFeature 639119 23777332 822477 N_ambiguous 569238 2765 87774 UnstrandedReadsAssigned:23234904 PositiveStrandReadsAssigned:663164 NegativeStrandReadsAssigned:23533010 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR6958450 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958450-trimmed-pair1.fastq SRR6958450-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,034,270 reads, 23,551,730 reads pseudoaligned [quant] estimated average fragment length: 223.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR6958450.ke.tsv 35125 SRR6958450.se.tsv 88098 total ==> SRR6958450.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.584 0 0 PNS24247 1044 821.181 75.4023 5.65928 PNS24249 1928 1705.18 110.494 3.99378 PNS24246 1044 821.181 75.4023 5.65928 PNS24248 1044 821.181 75.4023 5.65928 PNS24244 1471 1248.18 44.2992 2.18743 PNS24243 293 107.149 0 0 KQK14069 1603 1380.18 10994.4 490.968 KQK14071 474 260.655 201.63 47.6768 ==> SRR6958450.se.tsv <== BRADI_1g14170v3 12035 BRADI_1g53295v3 267 BRADI_1g59795v3 216 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 315 BRADI_1g74790v3 184 BRADI_1g09890v3 0 BRADI_1g77505v3 272 BRADI_1g48960v3 0 SRR6958450 completed mapping pipeline successfully