Starting /dee2/code/volunteer_pipeline.sh SRR6958451 current disk space = 1547612147712 free memory = 1598671444 SRR6958451 SRAfilesize b60551036445fbba86c7867e8a692940 SRR6958451.sra SRR6958451.sra file validated SRR6958451 is paired end SRR6958451 is conventional basespace SRR6958451 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958451_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5205 33.0 33.0 34.0 32.0 34.0 2 32.57475 33.0 33.0 34.0 31.0 34.0 3 32.753 33.0 33.0 34.0 31.0 34.0 4 31.79675 33.0 31.0 33.0 29.0 34.0 5 32.24375 33.0 33.0 33.0 31.0 34.0 6 36.15775 38.0 36.0 38.0 33.0 38.0 7 37.07525 38.0 38.0 38.0 35.0 38.0 8 37.1995 38.0 38.0 38.0 36.0 38.0 9 37.443 38.0 38.0 38.0 37.0 38.0 10-14 37.53165 38.0 38.0 38.0 37.4 38.0 15-19 37.5653 38.0 38.0 38.0 38.0 38.0 20-24 37.5432 38.0 38.0 38.0 38.0 38.0 25-29 37.529849999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.47840000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.428250000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.423950000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.4322 38.0 38.0 38.0 37.0 38.0 50-54 37.39065000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.32185 38.0 38.0 38.0 37.0 38.0 60-64 36.890499999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.1273 38.0 38.0 38.0 36.0 38.0 70-74 37.21775 38.0 38.0 38.0 36.4 38.0 75-79 37.1183 38.0 38.0 38.0 36.0 38.0 80-84 37.07905 38.0 38.0 38.0 36.0 38.0 85-89 37.0095 38.0 38.0 38.0 35.8 38.0 90-94 36.97445 38.0 38.0 38.0 35.2 38.0 95-99 36.8834 38.0 38.0 38.0 35.0 38.0 100-104 36.749649999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.5 38.0 38.0 38.0 34.0 38.0 110-114 36.4184 38.0 38.0 38.0 34.0 38.0 115-119 36.418099999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.1798 38.0 37.6 38.0 33.0 38.0 125-129 35.86525 38.0 37.0 38.0 31.6 38.0 130-134 35.28465 38.0 36.0 38.0 31.0 38.0 135-139 35.0239 38.0 36.0 38.0 29.6 38.0 140-144 34.42255 38.0 35.2 38.0 27.0 38.0 145-149 33.9269 38.0 34.4 38.0 25.4 38.0 150-151 29.116124999999997 35.5 18.5 38.0 7.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 1.0 21 3.0 22 6.0 23 7.0 24 8.0 25 10.0 26 15.0 27 22.0 28 23.0 29 25.0 30 39.0 31 59.0 32 67.0 33 86.0 34 143.0 35 232.0 36 675.0 37 2573.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.3 9.65 9.575 36.475 2 23.75 11.200000000000001 34.9 30.15 3 21.275 15.825 26.200000000000003 36.7 4 27.1 23.175 22.5 27.224999999999998 5 27.200000000000003 27.400000000000002 23.05 22.35 6 24.65 29.525000000000002 23.400000000000002 22.425 7 19.125 24.625 36.35 19.900000000000002 8 22.625 23.400000000000002 28.050000000000004 25.924999999999997 9 21.0 21.825 30.925000000000004 26.25 10-14 23.22348352252838 25.978896834525177 25.79886983047457 24.99874981247187 15-19 23.995 24.43 25.72 25.855 20-24 23.72 25.430000000000003 25.330000000000002 25.52 25-29 24.005000000000003 25.085 25.72 25.19 30-34 23.5 24.675 25.61 26.215 35-39 23.330000000000002 25.03 25.41 26.229999999999997 40-44 23.849999999999998 25.135 25.285000000000004 25.729999999999997 45-49 23.465 24.615000000000002 25.564999999999998 26.355 50-54 24.065 24.310000000000002 25.435000000000002 26.19 55-59 24.0886132919938 24.873731059658947 25.143771565734863 25.893884082612388 60-64 23.68354622103297 24.774069773312466 25.60205987782097 25.94032412783359 65-69 24.31566831807036 24.776059650703097 25.14637441825552 25.761897612971023 70-74 24.404999999999998 24.884999999999998 25.365 25.345000000000002 75-79 24.145 25.064999999999998 24.73 26.06 80-84 24.235 24.5 25.374999999999996 25.89 85-89 24.185000000000002 24.545 25.230000000000004 26.040000000000003 90-94 24.59 24.255 25.759999999999998 25.395 95-99 24.099999999999998 24.305 25.369999999999997 26.224999999999998 100-104 24.44 24.275 25.47 25.814999999999998 105-109 24.585 23.830000000000002 25.674999999999997 25.91 110-114 24.815 24.52 25.259999999999998 25.405 115-119 24.845 23.674999999999997 25.7 25.779999999999998 120-124 24.235 24.69 24.595 26.479999999999997 125-129 24.365000000000002 24.455 25.05 26.13 130-134 24.310000000000002 23.655 25.795 26.240000000000002 135-139 23.885 24.805 25.165 26.145000000000003 140-144 24.195 24.560000000000002 25.369999999999997 25.874999999999996 145-149 24.404999999999998 24.145 25.474999999999998 25.974999999999998 150-151 24.675 24.825 24.775 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.0 29 4.5 30 5.0 31 4.0 32 9.5 33 14.0 34 16.5 35 28.5 36 42.5 37 56.0 38 82.5 39 103.5 40 116.5 41 146.0 42 165.0 43 163.5 44 170.5 45 191.0 46 207.5 47 193.5 48 193.5 49 208.0 50 184.0 51 144.5 52 117.5 53 119.0 54 110.5 55 93.5 56 97.0 57 93.0 58 77.5 59 76.5 60 82.0 61 74.0 62 72.0 63 70.5 64 65.0 65 63.0 66 63.5 67 52.5 68 40.0 69 35.5 70 32.0 71 26.0 72 21.0 73 17.5 74 14.0 75 12.0 76 8.5 77 6.0 78 3.0 79 1.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.9650000000000001 65-69 0.08499999999999999 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9125000000000001 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 3.0250000000000004 0.0 0.0 0.0 0.0 138-139 3.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGAA 10 0.006830828 145.0 1 >>END_MODULE SRR6958451 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958451_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75575 33.0 33.0 34.0 32.0 34.0 2 32.8765 34.0 33.0 34.0 32.0 34.0 3 32.877 34.0 33.0 34.0 32.0 34.0 4 32.8525 34.0 33.0 34.0 32.0 34.0 5 32.87575 34.0 33.0 34.0 32.0 34.0 6 37.07575 38.0 38.0 38.0 37.0 38.0 7 37.111 38.0 38.0 38.0 37.0 38.0 8 37.047 38.0 38.0 38.0 37.0 38.0 9 37.11225 38.0 38.0 38.0 37.0 38.0 10-14 37.0839 38.0 38.0 38.0 37.0 38.0 15-19 37.02635 38.0 38.0 38.0 36.8 38.0 20-24 37.0103 38.0 38.0 38.0 36.8 38.0 25-29 36.959500000000006 38.0 38.0 38.0 36.6 38.0 30-34 36.9489 38.0 38.0 38.0 36.2 38.0 35-39 36.91875 38.0 38.0 38.0 36.6 38.0 40-44 36.906349999999996 38.0 38.0 38.0 36.2 38.0 45-49 36.8919 38.0 38.0 38.0 36.0 38.0 50-54 36.80425 38.0 38.0 38.0 36.0 38.0 55-59 36.753150000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.7394 38.0 38.0 38.0 35.8 38.0 65-69 36.6183 38.0 38.0 38.0 35.2 38.0 70-74 36.553250000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.638549999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.5383 38.0 38.0 38.0 34.8 38.0 85-89 36.3915 38.0 38.0 38.0 34.4 38.0 90-94 36.346199999999996 38.0 38.0 38.0 34.2 38.0 95-99 36.157799999999995 38.0 38.0 38.0 33.8 38.0 100-104 36.13415 38.0 38.0 38.0 34.0 38.0 105-109 35.901799999999994 38.0 38.0 38.0 33.0 38.0 110-114 35.757850000000005 38.0 37.4 38.0 32.2 38.0 115-119 35.568200000000004 38.0 37.2 38.0 31.4 38.0 120-124 35.544799999999995 38.0 37.0 38.0 31.8 38.0 125-129 35.4346 38.0 37.0 38.0 31.4 38.0 130-134 35.219550000000005 38.0 36.0 38.0 30.6 38.0 135-139 34.99399999999999 38.0 36.0 38.0 29.8 38.0 140-144 34.62765 38.0 35.8 38.0 27.8 38.0 145-149 33.871500000000005 38.0 34.4 38.0 23.8 38.0 150-151 29.677625 35.5 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 3.0 5 1.0 6 5.0 7 0.0 8 2.0 9 1.0 10 3.0 11 2.0 12 1.0 13 1.0 14 5.0 15 3.0 16 3.0 17 3.0 18 3.0 19 6.0 20 6.0 21 6.0 22 8.0 23 8.0 24 15.0 25 14.0 26 17.0 27 23.0 28 31.0 29 34.0 30 40.0 31 61.0 32 57.0 33 70.0 34 128.0 35 229.0 36 500.0 37 2690.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.4749498997996 19.288577154308616 12.725450901803606 30.511022044088175 2 28.879418400601654 23.31411381298571 26.021559288042116 21.78490849837052 3 23.909774436090224 24.486215538847116 27.694235588972433 23.909774436090224 4 26.534703081934353 30.368328739664246 18.792282635930842 24.30468554247056 5 25.833124530192936 34.101728890002505 18.61688799799549 21.44825858180907 6 22.516887665749312 34.92619464598449 21.240930698023515 21.31598699024268 7 23.13656828414207 19.23461730865433 32.84142071035518 24.787393696848426 8 23.549999999999997 23.150000000000002 23.724999999999998 29.575000000000003 9 24.0 23.075000000000003 26.224999999999998 26.700000000000003 10-14 25.697848924462228 25.87793896948474 22.706353176588294 25.717858929464732 15-19 25.679259444583437 25.459094320740554 24.008006004503375 24.85364023017263 20-24 25.692846423211606 25.34267133566783 23.66183091545773 25.302651325662833 25-29 26.167008555561118 25.961875218892278 22.829839395607145 25.041276829939463 30-34 26.327632763276327 25.477547754775475 23.412341234123414 24.782478247824784 35-39 26.13045218087235 25.0 23.664465786314526 25.205082032813124 40-44 26.182854856456938 25.042512753826145 23.627088126437933 25.14754426327898 45-49 26.22286686005802 25.13253976192858 24.27228168450535 24.372311693508053 50-54 25.99799899949975 25.047523761880942 24.047023511755878 24.907453726863434 55-59 26.21810905452726 24.972486243121562 23.446723361680842 25.362681340670335 60-64 26.083041520760382 25.222611305652826 23.66183091545773 25.032516258129068 65-69 26.005201040208043 25.12002400480096 23.96479295859172 24.90998199639928 70-74 26.218352846992893 24.767337135995195 23.70659461623136 25.307715400780545 75-79 26.465 24.5 23.880000000000003 25.155 80-84 26.145000000000003 25.369999999999997 24.005000000000003 24.48 85-89 26.347634763476346 25.24252425242524 23.562356235623565 24.847484748474848 90-94 26.595000000000002 25.295 23.59 24.52 95-99 26.677340271176263 25.17636463701406 23.66037924651023 24.485915845299445 100-104 26.09565739443666 24.85491294776866 23.934360616369823 25.115069041424853 105-109 25.95946960220165 25.484113084813607 24.13309982486865 24.423317488116087 110-114 26.00580464371497 25.39031224979984 24.404523618895116 24.199359487590073 115-119 26.502226447190676 24.560964627007557 24.22074348326412 24.716065442537648 120-124 25.870696557245797 25.17514011208967 24.339471577261808 24.614691753402724 125-129 25.895537322393437 25.55033019811887 23.879327596557935 24.674804882929756 130-134 26.868434217108554 25.2576288144072 23.301650825412707 24.572286143071537 135-139 26.55062024809924 25.735294117647058 23.634453781512605 24.079631852741095 140-144 26.37027405481096 25.570114022804564 23.909781956391278 24.1498299659932 145-149 26.488244122061033 25.6128064032016 23.90695347673837 23.991995997999 150-151 27.11588948618577 25.778222277784725 23.627953494186773 23.47793474184273 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.0 29 4.0 30 7.5 31 6.5 32 7.5 33 13.0 34 21.0 35 27.5 36 35.0 37 50.5 38 66.5 39 87.5 40 101.0 41 124.5 42 155.0 43 156.0 44 154.5 45 177.5 46 203.5 47 188.5 48 154.5 49 167.5 50 170.0 51 138.5 52 132.0 53 133.0 54 123.0 55 105.0 56 84.5 57 87.5 58 97.5 59 99.0 60 98.5 61 80.5 62 76.0 63 78.5 64 67.0 65 65.0 66 69.0 67 71.5 68 66.5 69 56.0 70 48.0 71 33.0 72 25.5 73 24.0 74 19.0 75 15.5 76 9.0 77 4.0 78 3.5 79 3.0 80 1.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.27499999999999997 3 0.25 4 0.22499999999999998 5 0.22499999999999998 6 0.075 7 0.05 8 0.0 9 0.0 10-14 0.05 15-19 0.075 20-24 0.05 25-29 0.065 30-34 0.01 35-39 0.04 40-44 0.03 45-49 0.03 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.02 70-74 0.06999999999999999 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.065 100-104 0.06 105-109 0.075 110-114 0.08 115-119 0.065 120-124 0.08 125-129 0.06 130-134 0.05 135-139 0.04 140-144 0.02 145-149 0.05 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2938209331652 98.425 2 0.605296343001261 1.2 3 0.05044136191677175 0.15 4 0.025220680958385876 0.1 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.05 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.825 0.0 0.0 0.0 0.0 136-137 3.1500000000000004 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCACA 10 0.0067884917 145.27847 4 TCAAACT 10 0.0067884917 145.27847 2 CCACAGT 10 0.0067884917 145.27847 6 TCCACAG 10 0.0067884917 145.27847 5 TCTCCAC 10 0.0067884917 145.27847 3 >>END_MODULE Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221117 spots for SRR6958451.sra Written 1221117 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra Read 1221111 spots for SRR6958451.sra Written 1221111 spots for SRR6958451.sra SRR ids: ['SRR6958451.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_28ra85uy SRR6958451.sra spots: 24422226 blocks: [[1, 1221111], [1221112, 2442222], [2442223, 3663333], [3663334, 4884444], [4884445, 6105555], [6105556, 7326666], [7326667, 8547777], [8547778, 9768888], [9768889, 10989999], [10990000, 12211110], [12211111, 13432221], [13432222, 14653332], [14653333, 15874443], [15874444, 17095554], [17095555, 18316665], [18316666, 19537776], [19537777, 20758887], [20758888, 21979998], [21979999, 23201109], [23201110, 24422226]] SRR6958451 file size 8254190 SRR6958451 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958451 SRR6958451_1.fastq SRR6958451_2.fastq Input file: SRR6958451_1.fastq Paired file: SRR6958451_2.fastq trimmed: SRR6958451-trimmed-pair1.fastq, SRR6958451-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:25:48 2024 >> started Fri Dec 6 23:26:15 2024 >> done (26.519s) 24422226 read pairs processed; of these: 36930 ( 0.15%) short read pairs filtered out after trimming by size control 53860 ( 0.22%) empty read pairs filtered out after trimming by size control 24331436 (99.63%) read pairs available; of these: 8855054 (36.39%) trimmed read pairs available after processing 15476382 (63.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 5 0.00% 22 9 0.00% 23 5 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 2 0.00% 28 7 0.00% 29 3 0.00% 30 8 0.00% 31 7 0.00% 32 11 0.00% 33 8 0.00% 34 3 0.00% 35 8 0.00% 36 8 0.00% 37 4 0.00% 38 6 0.00% 39 10 0.00% 40 14 0.00% 41 12 0.00% 42 17 0.00% 43 12 0.00% 44 20 0.00% 45 21 0.00% 46 16 0.00% 47 24 0.00% 48 21 0.00% 49 38 0.00% 50 33 0.00% 51 28 0.00% 52 38 0.00% 53 34 0.00% 54 50 0.00% 55 54 0.00% 56 52 0.00% 57 43 0.00% 58 70 0.00% 59 87 0.00% 60 82 0.00% 61 99 0.00% 62 123 0.00% 63 119 0.00% 64 139 0.00% 65 158 0.00% 66 161 0.00% 67 197 0.00% 68 223 0.00% 69 241 0.00% 70 277 0.00% 71 335 0.00% 72 384 0.00% 73 454 0.00% 74 447 0.00% 75 507 0.00% 76 617 0.00% 77 746 0.00% 78 766 0.00% 79 865 0.00% 80 915 0.00% 81 1132 0.00% 82 1301 0.01% 83 1566 0.01% 84 3043 0.01% 85 3908 0.02% 86 3948 0.02% 87 3985 0.02% 88 4259 0.02% 89 4398 0.02% 90 4682 0.02% 91 4678 0.02% 92 5261 0.02% 93 5390 0.02% 94 5923 0.02% 95 6226 0.03% 96 6687 0.03% 97 7019 0.03% 98 7195 0.03% 99 7995 0.03% 100 8662 0.04% 101 9410 0.04% 102 9879 0.04% 103 10555 0.04% 104 11537 0.05% 105 12065 0.05% 106 12961 0.05% 107 13757 0.06% 108 14575 0.06% 109 15340 0.06% 110 16301 0.07% 111 17393 0.07% 112 18721 0.08% 113 19856 0.08% 114 20990 0.09% 115 22396 0.09% 116 23757 0.10% 117 24815 0.10% 118 25945 0.11% 119 26793 0.11% 120 28250 0.12% 121 29802 0.12% 122 31581 0.13% 123 32780 0.13% 124 34472 0.14% 125 36301 0.15% 126 38134 0.16% 127 39562 0.16% 128 40829 0.17% 129 43065 0.18% 130 44841 0.18% 131 46843 0.19% 132 49493 0.20% 133 52939 0.22% 134 54818 0.23% 135 58491 0.24% 136 61410 0.25% 137 65073 0.27% 138 68466 0.28% 139 73108 0.30% 140 78048 0.32% 141 84352 0.35% 142 92998 0.38% 143 103263 0.42% 144 118231 0.49% 145 140227 0.58% 146 173922 0.71% 147 226950 0.93% 148 342633 1.41% 149 721797 2.97% 150 5409409 22.23% 151 15476382 63.61% 24331436 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=25 prefix-density=0.55 prefix-fanout=3.3 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=59.33 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=24 prefix-density=0.44 prefix-fanout=3.0 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=97.38 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958451 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:27:27 Started mapping on | Dec 06 23:27:27 Finished on | Dec 06 23:29:19 Mapping speed, Million of reads per hour | 782.08 Number of input reads | 24331436 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 23818150 Uniquely mapped reads % | 97.89% Average mapped length | 297.50 Number of splices: Total | 27204614 Number of splices: Annotated (sjdb) | 25562846 Number of splices: GT/AG | 26849800 Number of splices: GC/AG | 321529 Number of splices: AT/AC | 12088 Number of splices: Non-canonical | 21197 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 162521 % of reads mapped to multiple loci | 0.67% Number of reads mapped to too many loci | 12736 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.08% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 371701 371701 371701 N_multimapping 162521 162521 162521 N_noFeature 717560 23192285 871585 N_ambiguous 557159 3371 85824 UnstrandedReadsAssigned:22543431 PositiveStrandReadsAssigned:622494 NegativeStrandReadsAssigned:22860741 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958451 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958451-trimmed-pair1.fastq SRR6958451-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,331,436 reads, 22,879,679 reads pseudoaligned [quant] estimated average fragment length: 268.319 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958451.ke.tsv 35125 SRR6958451.se.tsv 88098 total ==> SRR6958451.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.171 0 0 PNS24247 1044 776.681 80.6344 6.70777 PNS24249 1928 1660.68 63.087 2.45445 PNS24246 1044 776.681 80.6344 6.70777 PNS24248 1044 776.681 80.6344 6.70777 PNS24244 1471 1203.68 38.0097 2.04025 PNS24243 293 83.4527 0 0 KQK14069 1603 1335.68 3123.61 151.096 KQK14071 474 223.225 42.4433 12.2847 ==> SRR6958451.se.tsv <== BRADI_1g14170v3 3378 BRADI_1g53295v3 309 BRADI_1g59795v3 317 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 821 BRADI_1g74790v3 98 BRADI_1g09890v3 1 BRADI_1g77505v3 336 BRADI_1g48960v3 0 SRR6958451 completed mapping pipeline successfully