Starting /dee2/code/volunteer_pipeline.sh SRR6958452 current disk space = 1547612147712 free memory = 1600641476 SRR6958452 SRAfilesize 82398953a167e253e19fd0f1e85e21eb SRR6958452.sra SRR6958452.sra file validated SRR6958452 is paired end SRR6958452 is conventional basespace SRR6958452 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958452_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.20625 18.0 18.0 31.0 18.0 32.0 2 27.12425 28.0 25.0 31.0 18.0 33.0 3 28.0525 29.0 27.0 31.0 18.0 33.0 4 28.31875 30.0 27.0 33.0 15.0 33.0 5 31.03175 33.0 30.0 33.0 28.0 33.0 6 36.31125 38.0 37.0 38.0 34.0 38.0 7 36.93325 38.0 38.0 38.0 35.0 38.0 8 37.05225 38.0 38.0 38.0 36.0 38.0 9 37.3295 38.0 38.0 38.0 37.0 38.0 10-14 37.299549999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.342349999999996 38.0 38.0 38.0 36.8 38.0 20-24 37.325 38.0 38.0 38.0 36.8 38.0 25-29 37.15990000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.95745 38.0 38.0 38.0 35.6 38.0 35-39 36.9673 38.0 38.0 38.0 35.6 38.0 40-44 36.864 38.0 38.0 38.0 35.2 38.0 45-49 36.80544999999999 38.0 38.0 38.0 35.0 38.0 50-54 36.422700000000006 38.0 37.8 38.0 33.6 38.0 55-59 36.3758 38.0 38.0 38.0 33.6 38.0 60-64 36.6638 38.0 38.0 38.0 34.4 38.0 65-69 36.838550000000005 38.0 38.0 38.0 34.8 38.0 70-74 36.54594999999999 38.0 38.0 38.0 34.0 38.0 75-79 36.07265 38.0 36.8 38.0 32.2 38.0 80-84 35.97925 38.0 37.0 38.0 32.2 38.0 85-89 36.2182 38.0 37.0 38.0 33.0 38.0 90-94 36.17415 38.0 37.0 38.0 33.2 38.0 95-99 35.7677 38.0 36.4 38.0 31.2 38.0 100-104 35.17569999999999 38.0 35.2 38.0 28.4 38.0 105-109 34.63275 38.0 34.6 38.0 25.8 38.0 110-114 34.8604 38.0 35.0 38.0 26.8 38.0 115-119 34.3214 38.0 34.4 38.0 24.4 38.0 120-124 34.20005 38.0 34.0 38.0 23.8 38.0 125-129 34.111000000000004 38.0 34.0 38.0 23.2 38.0 130-134 33.523900000000005 37.8 33.4 38.0 20.2 38.0 135-139 32.9826 37.8 32.0 38.0 18.6 38.0 140-144 31.9241 36.2 31.0 38.0 13.8 38.0 145-149 29.6456 34.4 28.0 38.0 6.4 38.0 150-151 23.934 32.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 2.0 18 4.0 19 5.0 20 3.0 21 2.0 22 6.0 23 14.0 24 20.0 25 25.0 26 25.0 27 43.0 28 56.0 29 56.0 30 104.0 31 132.0 32 166.0 33 201.0 34 345.0 35 562.0 36 1136.0 37 1090.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.751334044823906 17.12913553895411 5.096051227321238 44.02347918890075 2 20.424999999999997 14.45 30.5 34.625 3 22.575 16.025 25.650000000000002 35.75 4 28.375 21.15 21.825 28.65 5 26.55 25.674999999999997 21.675 26.1 6 23.849999999999998 32.800000000000004 23.125 20.225 7 18.5 23.3 38.525 19.675 8 21.475 23.375 27.800000000000004 27.35 9 19.900000000000002 22.75 33.425 23.925 10-14 23.18 25.974999999999998 25.779999999999998 25.064999999999998 15-19 23.24 24.01 26.565 26.185000000000002 20-24 23.665 25.080000000000002 25.64 25.615 25-29 23.794999999999998 24.73 25.665 25.81 30-34 23.66 25.130000000000003 25.575 25.635 35-39 23.405 24.855 25.53 26.21 40-44 23.830000000000002 24.465 25.840000000000003 25.865 45-49 23.84 24.555 25.635 25.97 50-54 23.07 24.845 26.22 25.865 55-59 23.435 25.055 25.1 26.41 60-64 23.395 24.54 25.605 26.46 65-69 23.855 24.08 25.990000000000002 26.075 70-74 23.96 24.355 25.55 26.135 75-79 23.215 24.16 26.035000000000004 26.590000000000003 80-84 23.94 24.795 24.98 26.284999999999997 85-89 24.535 24.615000000000002 24.94 25.91 90-94 23.235 24.095 25.790000000000003 26.88 95-99 24.2 23.865 26.1 25.835 100-104 24.015 24.37 25.7 25.915 105-109 23.925 24.185000000000002 25.91 25.979999999999997 110-114 23.625 23.919999999999998 26.36 26.095000000000002 115-119 24.25 24.18 25.685000000000002 25.885 120-124 24.065 24.305 25.264999999999997 26.365 125-129 23.74 24.8 25.035 26.424999999999997 130-134 24.505 23.97 25.495 26.029999999999998 135-139 24.240000000000002 24.275 25.169999999999998 26.314999999999998 140-144 24.54 24.45 25.11 25.900000000000002 145-149 24.654999999999998 24.38 25.035 25.929999999999996 150-151 24.099999999999998 23.8125 25.0625 27.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.0 29 3.0 30 4.5 31 4.5 32 7.5 33 16.5 34 26.0 35 30.0 36 37.5 37 53.0 38 56.5 39 75.5 40 102.5 41 136.0 42 156.5 43 167.0 44 203.5 45 211.5 46 210.5 47 211.5 48 198.0 49 197.5 50 189.0 51 156.5 52 140.0 53 124.5 54 113.0 55 107.5 56 95.5 57 95.5 58 96.5 59 83.5 60 72.0 61 72.0 62 70.5 63 66.0 64 64.5 65 58.5 66 43.5 67 38.5 68 38.5 69 39.0 70 36.0 71 23.0 72 20.0 73 15.5 74 9.0 75 7.5 76 3.5 77 3.5 78 2.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1625 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.8625 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCCTT 10 0.0054020355 156.67567 1 >>END_MODULE SRR6958452 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958452_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62475 33.0 33.0 34.0 32.0 34.0 2 32.566 33.0 33.0 34.0 32.0 34.0 3 32.62625 33.0 33.0 34.0 32.0 34.0 4 32.57175 33.0 33.0 34.0 32.0 34.0 5 32.67575 33.0 33.0 34.0 32.0 34.0 6 36.79475 38.0 38.0 38.0 35.0 38.0 7 36.68225 38.0 38.0 38.0 35.0 38.0 8 36.6565 38.0 38.0 38.0 34.0 38.0 9 36.81175 38.0 38.0 38.0 35.0 38.0 10-14 36.70655 38.0 38.0 38.0 34.6 38.0 15-19 36.9097 38.0 38.0 38.0 35.8 38.0 20-24 36.850350000000006 38.0 38.0 38.0 35.4 38.0 25-29 36.90715 38.0 38.0 38.0 35.6 38.0 30-34 36.90785 38.0 38.0 38.0 36.0 38.0 35-39 36.7135 38.0 38.0 38.0 35.0 38.0 40-44 36.621500000000005 38.0 38.0 38.0 34.6 38.0 45-49 36.643899999999995 38.0 38.0 38.0 34.6 38.0 50-54 36.6464 38.0 38.0 38.0 34.6 38.0 55-59 36.61775000000001 38.0 38.0 38.0 34.4 38.0 60-64 36.50965 38.0 38.0 38.0 34.2 38.0 65-69 36.37085 38.0 38.0 38.0 33.8 38.0 70-74 36.289049999999996 38.0 38.0 38.0 33.8 38.0 75-79 36.15769999999999 38.0 38.0 38.0 33.4 38.0 80-84 35.972550000000005 38.0 37.2 38.0 32.6 38.0 85-89 35.968599999999995 38.0 37.0 38.0 33.0 38.0 90-94 35.7835 38.0 37.0 38.0 31.8 38.0 95-99 35.566250000000004 38.0 36.6 38.0 30.2 38.0 100-104 35.236149999999995 38.0 36.0 38.0 28.8 38.0 105-109 34.79485 38.0 35.2 38.0 26.8 38.0 110-114 34.396300000000004 38.0 34.4 38.0 24.6 38.0 115-119 34.17815 38.0 34.2 38.0 24.0 38.0 120-124 33.786350000000006 38.0 33.2 38.0 22.2 38.0 125-129 33.22815 38.0 33.0 38.0 19.8 38.0 130-134 32.0881 37.4 31.0 38.0 13.2 38.0 135-139 31.609949999999998 36.2 30.0 38.0 13.0 38.0 140-144 31.134499999999996 36.0 29.2 38.0 12.4 38.0 145-149 29.62945 36.0 27.4 38.0 3.8 38.0 150-151 23.48925 30.0 10.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 0.0 5 0.0 6 2.0 7 2.0 8 0.0 9 2.0 10 2.0 11 1.0 12 3.0 13 1.0 14 3.0 15 2.0 16 9.0 17 3.0 18 4.0 19 8.0 20 12.0 21 23.0 22 16.0 23 24.0 24 18.0 25 28.0 26 28.0 27 39.0 28 39.0 29 66.0 30 77.0 31 104.0 32 148.0 33 191.0 34 281.0 35 433.0 36 956.0 37 1466.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 18.625 12.275 31.724999999999998 2 28.325 23.375 27.250000000000004 21.05 3 22.45 24.875 27.6 25.074999999999996 4 27.3 29.849999999999998 19.3 23.549999999999997 5 27.800000000000004 31.05 18.9 22.25 6 23.1 34.775 20.375 21.75 7 23.0 19.775000000000002 32.375 24.85 8 24.6 23.5 23.175 28.725 9 23.775 23.375 26.625 26.224999999999998 10-14 25.974999999999998 25.595000000000002 22.564999999999998 25.865 15-19 25.845000000000002 25.124999999999996 24.275 24.755 20-24 25.52 26.009999999999998 24.22 24.25 25-29 26.465 25.06 23.755000000000003 24.72 30-34 26.25 25.06 24.27 24.42 35-39 25.685000000000002 25.515 23.965 24.834999999999997 40-44 25.979999999999997 25.095 23.625 25.3 45-49 25.97 25.019999999999996 23.74 25.27 50-54 26.3 25.580000000000002 23.5 24.62 55-59 26.36 25.34 23.345 24.955 60-64 25.985000000000003 25.335 24.25 24.43 65-69 25.835 25.324999999999996 24.224999999999998 24.615000000000002 70-74 26.83 24.955 23.669999999999998 24.545 75-79 26.619999999999997 24.945 23.52 24.915000000000003 80-84 26.565 24.825 23.855 24.755 85-89 26.384999999999998 24.84 23.645 25.130000000000003 90-94 26.145000000000003 25.735000000000003 24.29 23.830000000000002 95-99 26.43 25.105 24.39 24.075 100-104 26.284999999999997 25.865 23.62 24.23 105-109 26.51 25.15 24.48 23.86 110-114 26.75 25.935000000000002 23.65 23.665 115-119 26.33 25.95 23.34 24.38 120-124 26.14 25.14 24.195 24.525 125-129 26.715 25.380000000000003 23.655 24.25 130-134 26.035000000000004 25.724999999999998 24.165 24.075 135-139 26.71 25.345000000000002 24.26 23.685000000000002 140-144 27.115000000000002 25.695 23.98 23.21 145-149 26.669999999999998 25.900000000000002 23.865 23.565 150-151 27.9375 25.474999999999998 23.8875 22.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.0 28 1.0 29 2.5 30 1.5 31 3.5 32 8.0 33 8.0 34 14.0 35 25.0 36 29.5 37 39.5 38 62.5 39 77.5 40 83.0 41 119.0 42 161.5 43 168.0 44 177.0 45 187.5 46 184.0 47 191.0 48 200.5 49 199.0 50 172.5 51 147.0 52 144.5 53 122.5 54 104.5 55 111.5 56 107.5 57 105.5 58 110.5 59 108.5 60 90.5 61 78.5 62 76.0 63 69.5 64 67.0 65 67.0 66 64.0 67 62.0 68 53.0 69 42.0 70 35.5 71 30.5 72 28.0 73 19.0 74 14.5 75 10.0 76 5.5 77 4.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72838250254323 97.05 2 0.9918616480162767 1.95 3 0.1780264496439471 0.525 4 0.025432349949135298 0.1 5 0.0762970498474059 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTT 5 0.125 No Hit CGAGACTCCAACCCCTACCGAGCGGAGGAGCAGGAGGAGGCCGCCCACCA 5 0.125 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1625 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.175 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.15 0.0 0.0 0.0 0.0 138-139 2.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGTC 10 0.006830828 145.0 3 GTTGGTT 10 0.006830828 145.0 2 >>END_MODULE Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894239 spots for SRR6958452.sra Written 894239 spots for SRR6958452.sra Read 894251 spots for SRR6958452.sra Written 894251 spots for SRR6958452.sra SRR ids: ['SRR6958452.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ul1_i4rd SRR6958452.sra spots: 17884792 blocks: [[1, 894239], [894240, 1788478], [1788479, 2682717], [2682718, 3576956], [3576957, 4471195], [4471196, 5365434], [5365435, 6259673], [6259674, 7153912], [7153913, 8048151], [8048152, 8942390], [8942391, 9836629], [9836630, 10730868], [10730869, 11625107], [11625108, 12519346], [12519347, 13413585], [13413586, 14307824], [14307825, 15202063], [15202064, 16096302], [16096303, 16990541], [16990542, 17884792]] SRR6958452 file size 6038868 SRR6958452 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958452 SRR6958452_1.fastq SRR6958452_2.fastq Input file: SRR6958452_1.fastq Paired file: SRR6958452_2.fastq trimmed: SRR6958452-trimmed-pair1.fastq, SRR6958452-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:24:43 2024 >> started Fri Dec 6 23:25:01 2024 >> done (18.666s) 17884792 read pairs processed; of these: 20192 ( 0.11%) short read pairs filtered out after trimming by size control 14870 ( 0.08%) empty read pairs filtered out after trimming by size control 17849730 (99.80%) read pairs available; of these: 7957350 (44.58%) trimmed read pairs available after processing 9892380 (55.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 7 0.00% 27 1 0.00% 28 5 0.00% 29 3 0.00% 30 6 0.00% 31 1 0.00% 32 4 0.00% 33 9 0.00% 34 6 0.00% 35 11 0.00% 36 6 0.00% 37 8 0.00% 38 6 0.00% 39 16 0.00% 40 6 0.00% 41 8 0.00% 42 16 0.00% 43 13 0.00% 44 18 0.00% 45 26 0.00% 46 15 0.00% 47 24 0.00% 48 22 0.00% 49 28 0.00% 50 26 0.00% 51 37 0.00% 52 35 0.00% 53 44 0.00% 54 44 0.00% 55 56 0.00% 56 64 0.00% 57 60 0.00% 58 78 0.00% 59 66 0.00% 60 92 0.00% 61 108 0.00% 62 118 0.00% 63 121 0.00% 64 131 0.00% 65 138 0.00% 66 166 0.00% 67 181 0.00% 68 172 0.00% 69 219 0.00% 70 214 0.00% 71 280 0.00% 72 301 0.00% 73 323 0.00% 74 384 0.00% 75 432 0.00% 76 481 0.00% 77 543 0.00% 78 557 0.00% 79 654 0.00% 80 720 0.00% 81 800 0.00% 82 943 0.01% 83 1142 0.01% 84 1961 0.01% 85 2540 0.01% 86 2619 0.01% 87 2772 0.02% 88 2722 0.02% 89 2896 0.02% 90 3072 0.02% 91 3144 0.02% 92 3269 0.02% 93 3615 0.02% 94 3810 0.02% 95 4035 0.02% 96 4354 0.02% 97 4619 0.03% 98 4869 0.03% 99 5121 0.03% 100 5476 0.03% 101 6054 0.03% 102 6440 0.04% 103 6837 0.04% 104 7252 0.04% 105 7717 0.04% 106 8324 0.05% 107 8812 0.05% 108 9296 0.05% 109 9884 0.06% 110 10514 0.06% 111 11182 0.06% 112 11907 0.07% 113 12577 0.07% 114 13248 0.07% 115 14490 0.08% 116 15226 0.09% 117 16104 0.09% 118 16923 0.09% 119 17717 0.10% 120 18407 0.10% 121 19559 0.11% 122 20817 0.12% 123 22056 0.12% 124 23884 0.13% 125 25057 0.14% 126 26451 0.15% 127 27989 0.16% 128 29529 0.17% 129 31656 0.18% 130 32946 0.18% 131 35785 0.20% 132 37646 0.21% 133 40682 0.23% 134 43649 0.24% 135 46989 0.26% 136 49915 0.28% 137 53992 0.30% 138 58220 0.33% 139 63122 0.35% 140 69330 0.39% 141 78224 0.44% 142 88190 0.49% 143 101816 0.57% 144 121127 0.68% 145 148481 0.83% 146 192337 1.08% 147 270521 1.52% 148 427874 2.40% 149 881976 4.94% 150 4587707 25.70% 151 9892380 55.42% 17849730 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=18 prefix-density=0.91 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=154.01 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.7 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=17 prefix-density=0.62 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=59.36 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958452 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:26:09 Started mapping on | Dec 06 23:26:10 Finished on | Dec 06 23:27:56 Mapping speed, Million of reads per hour | 606.22 Number of input reads | 17849730 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16520945 Uniquely mapped reads % | 92.56% Average mapped length | 292.79 Number of splices: Total | 19176222 Number of splices: Annotated (sjdb) | 18095857 Number of splices: GT/AG | 18914161 Number of splices: GC/AG | 222526 Number of splices: AT/AC | 6513 Number of splices: Non-canonical | 33022 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 199604 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 21906 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.63% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1142995 1142995 1142995 N_multimapping 199604 199604 199604 N_noFeature 444246 16038308 546592 N_ambiguous 449680 2161 70656 UnstrandedReadsAssigned:15627019 PositiveStrandReadsAssigned:480476 NegativeStrandReadsAssigned:15903697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958452 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958452-trimmed-pair1.fastq SRR6958452-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,849,730 reads, 16,431,332 reads pseudoaligned [quant] estimated average fragment length: 262.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6958452.ke.tsv 35125 SRR6958452.se.tsv 88098 total ==> SRR6958452.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.195 0 0 PNS24247 1044 782.786 37.9279 4.20756 PNS24249 1928 1666.79 37.6653 1.96235 PNS24246 1044 782.786 37.9279 4.20756 PNS24248 1044 782.786 37.9279 4.20756 PNS24244 1471 1209.79 17.5511 1.25982 PNS24243 293 81.6713 0 0 KQK14069 1603 1341.79 4611 298.419 KQK14071 474 224.484 67.6113 26.1547 ==> SRR6958452.se.tsv <== BRADI_1g14170v3 4701 BRADI_1g53295v3 737 BRADI_1g59795v3 49 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 362 BRADI_1g74790v3 88 BRADI_1g09890v3 0 BRADI_1g77505v3 224 BRADI_1g48960v3 0 SRR6958452 completed mapping pipeline successfully