Starting /dee2/code/volunteer_pipeline.sh SRR6958453 current disk space = 1547563528192 free memory = 1599929668 SRR6958453 SRAfilesize f039646225d6a31ae92dabef5ccb58f2 SRR6958453.sra SRR6958453.sra file validated SRR6958453 is paired end SRR6958453 is conventional basespace SRR6958453 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958453_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.98125 32.0 25.0 33.0 18.0 33.0 2 25.7185 27.0 18.0 31.0 18.0 33.0 3 29.8835 31.0 29.0 33.0 27.0 33.0 4 31.552 33.0 31.0 33.0 29.0 33.0 5 32.2305 33.0 33.0 33.0 31.0 33.0 6 35.88775 37.0 36.0 38.0 32.0 38.0 7 37.05 38.0 37.0 38.0 36.0 38.0 8 37.40375 38.0 38.0 38.0 36.0 38.0 9 36.833 38.0 38.0 38.0 35.0 38.0 10-14 37.04619999999999 38.0 38.0 38.0 35.4 38.0 15-19 37.4349 38.0 38.0 38.0 37.0 38.0 20-24 37.3403 38.0 38.0 38.0 36.8 38.0 25-29 37.3202 38.0 38.0 38.0 36.8 38.0 30-34 37.439949999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.351350000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.445100000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.368 38.0 38.0 38.0 37.0 38.0 50-54 37.230450000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.9902 38.0 38.0 38.0 35.4 38.0 60-64 37.03705000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.96255 38.0 38.0 38.0 35.2 38.0 70-74 36.68695 38.0 37.6 38.0 34.4 38.0 75-79 36.32895 38.0 37.2 38.0 32.6 38.0 80-84 36.69405 38.0 38.0 38.0 34.4 38.0 85-89 36.621249999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.3808 38.0 37.2 38.0 33.8 38.0 95-99 36.35745000000001 38.0 37.2 38.0 33.6 38.0 100-104 36.037600000000005 38.0 37.0 38.0 32.6 38.0 105-109 35.888600000000004 38.0 36.8 38.0 32.0 38.0 110-114 35.620450000000005 38.0 36.2 38.0 30.6 38.0 115-119 35.321600000000004 38.0 35.4 38.0 29.2 38.0 120-124 35.093849999999996 38.0 35.2 38.0 28.6 38.0 125-129 34.5171 38.0 34.6 38.0 25.2 38.0 130-134 34.3572 38.0 33.8 38.0 25.4 38.0 135-139 34.01535 38.0 33.0 38.0 24.2 38.0 140-144 33.40435 38.0 33.0 38.0 22.0 38.0 145-149 31.836000000000002 37.8 31.8 38.0 11.6 38.0 150-151 25.7025 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 2.0 20 3.0 21 1.0 22 7.0 23 6.0 24 15.0 25 12.0 26 15.0 27 27.0 28 33.0 29 38.0 30 54.0 31 68.0 32 110.0 33 175.0 34 271.0 35 522.0 36 1083.0 37 1555.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.93630573248408 10.012738853503185 9.29936305732484 42.7515923566879 2 21.099999999999998 14.524999999999999 35.85 28.525 3 19.7 15.85 26.1 38.35 4 24.95 23.9 22.35 28.799999999999997 5 26.575 28.449999999999996 23.775 21.2 6 21.95 32.824999999999996 24.349999999999998 20.875 7 17.349999999999998 24.925 39.25 18.475 8 20.375 25.3 30.049999999999997 24.275 9 19.375 24.975 32.324999999999996 23.325000000000003 10-14 22.015 27.275 26.25 24.46 15-19 22.31 25.979999999999997 27.134999999999998 24.575 20-24 22.603390508576286 26.363954593188975 27.139070860629094 23.893584037605642 25-29 22.185 26.840000000000003 26.840000000000003 24.135 30-34 22.54 26.445 26.845000000000002 24.169999999999998 35-39 22.439999999999998 26.795 26.369999999999997 24.395 40-44 22.45 26.13 26.810000000000002 24.610000000000003 45-49 21.975 26.27 26.8 24.955 50-54 22.575 26.995 26.090000000000003 24.34 55-59 21.825 26.650000000000002 27.145000000000003 24.38 60-64 22.675 25.61 27.029999999999998 24.685000000000002 65-69 21.735 26.26 27.089999999999996 24.915000000000003 70-74 22.475 26.755000000000003 26.369999999999997 24.4 75-79 21.705 26.33 27.095000000000002 24.87 80-84 22.2 26.179999999999996 27.265 24.355 85-89 22.215 26.57 26.695 24.52 90-94 21.9 26.765 27.065 24.27 95-99 22.245 26.555 27.029999999999998 24.169999999999998 100-104 22.57677303190957 26.212863859157746 26.387916374912475 24.822446734020208 105-109 22.31 26.52 26.700000000000003 24.47 110-114 23.062277669221906 26.56445713713112 26.384087379127212 23.989177814519767 115-119 22.66720064076892 26.83219863836604 26.47677212655186 24.023828594313176 120-124 23.024966228048232 26.18702156401661 26.242057337269227 24.545954870665934 125-129 22.695142126635584 25.89863137313882 26.41499974933574 24.991226750889858 130-134 22.97797797797798 25.96096096096096 26.606606606606608 24.454454454454456 135-139 22.275 26.31 26.545 24.87 140-144 22.445 26.284999999999997 26.384999999999998 24.884999999999998 145-149 22.919999999999998 26.575 25.955000000000002 24.55 150-151 23.4375 26.1 25.7375 24.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 3.5 28 5.5 29 5.5 30 9.0 31 11.5 32 13.5 33 20.0 34 31.0 35 41.5 36 59.0 37 84.5 38 94.0 39 121.0 40 160.5 41 179.0 42 205.5 43 237.0 44 239.0 45 227.5 46 246.5 47 253.5 48 212.0 49 179.5 50 160.5 51 137.5 52 127.5 53 116.0 54 104.5 55 103.5 56 90.0 57 67.0 58 60.5 59 62.0 60 56.5 61 46.0 62 41.0 63 38.5 64 30.0 65 22.0 66 18.0 67 15.0 68 12.5 69 9.0 70 10.0 71 11.5 72 6.5 73 3.5 74 3.0 75 2.0 76 1.0 77 1.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.20500000000000002 115-119 0.12 120-124 0.065 125-129 0.265 130-134 0.1 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.8625 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.5374999999999996 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2750000000000004 0.0 0.0 0.0 0.0 132-133 3.525 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.35 0.0 0.0 0.0 0.0 138-139 4.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGAA 10 0.006577216 146.82278 1 TCTGCCA 10 0.006832588 144.9875 7 GACTGCA 10 0.006832588 144.9875 6 >>END_MODULE SRR6958453 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958453_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.694 33.0 33.0 34.0 32.0 34.0 2 32.40025 33.0 33.0 34.0 31.0 34.0 3 32.88775 33.0 33.0 34.0 32.0 34.0 4 32.11675 33.0 33.0 34.0 30.0 34.0 5 32.82275 34.0 33.0 34.0 32.0 34.0 6 37.175 38.0 38.0 38.0 36.0 38.0 7 37.3275 38.0 38.0 38.0 37.0 38.0 8 37.3955 38.0 38.0 38.0 37.0 38.0 9 37.357 38.0 38.0 38.0 37.0 38.0 10-14 37.4277 38.0 38.0 38.0 37.8 38.0 15-19 36.84815 38.0 38.0 38.0 34.8 38.0 20-24 37.3579 38.0 38.0 38.0 37.0 38.0 25-29 37.4238 38.0 38.0 38.0 37.6 38.0 30-34 37.428999999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.327200000000005 38.0 38.0 38.0 37.0 38.0 40-44 36.9222 38.0 38.0 38.0 35.0 38.0 45-49 36.96985 38.0 38.0 38.0 35.6 38.0 50-54 36.724399999999996 38.0 37.8 38.0 34.0 38.0 55-59 37.299800000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.3479 38.0 38.0 38.0 37.0 38.0 65-69 37.20425 38.0 38.0 38.0 36.8 38.0 70-74 34.935950000000005 38.0 35.6 38.0 22.8 38.0 75-79 36.1891 38.0 37.2 38.0 30.0 38.0 80-84 35.36725 38.0 36.4 38.0 25.0 38.0 85-89 36.8801 38.0 38.0 38.0 35.2 38.0 90-94 36.541549999999994 38.0 37.8 38.0 33.6 38.0 95-99 36.813599999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.712199999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.513149999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.4728 38.0 38.0 38.0 34.0 38.0 115-119 36.4123 38.0 38.0 38.0 34.0 38.0 120-124 36.1101 38.0 37.6 38.0 33.0 38.0 125-129 35.7789 38.0 36.8 38.0 31.0 38.0 130-134 35.39565 38.0 36.0 38.0 30.4 38.0 135-139 34.470800000000004 38.0 35.0 38.0 26.0 38.0 140-144 32.05225 37.4 29.2 38.0 18.8 38.0 145-149 30.716299999999997 36.6 28.2 38.0 8.4 38.0 150-151 26.683625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 3.0 15 0.0 16 0.0 17 1.0 18 3.0 19 2.0 20 4.0 21 5.0 22 4.0 23 14.0 24 5.0 25 11.0 26 15.0 27 20.0 28 22.0 29 34.0 30 53.0 31 53.0 32 91.0 33 157.0 34 213.0 35 373.0 36 1097.0 37 1814.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.875 18.85 12.85 34.425 2 28.575 24.375 28.7 18.35 3 22.6 25.8 28.65 22.95 4 24.4 32.800000000000004 21.325 21.475 5 26.775 33.300000000000004 20.875 19.05 6 22.175 37.025000000000006 20.8 20.0 7 21.575 20.525 35.925000000000004 21.975 8 23.599999999999998 23.9 25.525 26.974999999999998 9 23.35 23.625 30.049999999999997 22.975 10-14 24.57 27.500000000000004 24.915000000000003 23.015 15-19 24.490000000000002 27.029999999999998 25.53 22.95 20-24 24.875 26.955000000000002 25.735000000000003 22.435 25-29 25.135 26.375 25.485000000000003 23.005 30-34 24.345 26.63 25.385 23.64 35-39 24.490000000000002 26.72 25.525 23.265 40-44 24.585 26.810000000000002 25.635 22.97 45-49 24.16 26.465 26.235000000000003 23.14 50-54 25.185000000000002 26.32 25.729999999999997 22.765 55-59 24.88 26.919999999999998 25.4 22.8 60-64 24.36 27.13 25.515 22.994999999999997 65-69 24.555 26.26 26.075 23.11 70-74 25.230000000000004 26.810000000000002 25.430000000000003 22.53 75-79 24.52 26.779999999999998 25.624999999999996 23.075000000000003 80-84 24.875 26.745 25.895000000000003 22.485 85-89 24.845 26.75 26.05 22.355 90-94 25.085 27.345000000000002 25.44 22.13 95-99 24.959999999999997 26.68 25.88 22.48 100-104 24.07 27.205000000000002 26.085 22.64 105-109 24.884999999999998 26.369999999999997 26.165 22.58 110-114 25.45 27.26 25.569999999999997 21.72 115-119 25.119999999999997 26.77 26.145000000000003 21.965 120-124 25.7 26.99 25.705 21.605 125-129 24.825 27.105 25.775 22.295 130-134 25.045 27.150000000000002 26.02 21.785 135-139 25.345000000000002 27.42 25.814999999999998 21.42 140-144 25.424999999999997 26.63 26.345000000000002 21.6 145-149 25.264999999999997 27.36 25.88 21.495 150-151 25.85 27.2625 25.7 21.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 2.0 25 2.0 26 1.5 27 2.5 28 4.5 29 5.5 30 8.5 31 8.0 32 11.5 33 19.5 34 25.0 35 40.0 36 52.5 37 64.0 38 89.5 39 122.5 40 152.0 41 176.5 42 194.5 43 227.0 44 248.0 45 231.0 46 220.5 47 213.0 48 192.0 49 176.0 50 161.5 51 156.5 52 138.5 53 121.0 54 114.0 55 101.0 56 92.5 57 88.0 58 77.5 59 66.0 60 54.0 61 40.5 62 42.0 63 41.5 64 41.0 65 37.5 66 25.5 67 22.5 68 25.5 69 18.5 70 11.5 71 10.5 72 7.5 73 3.5 74 3.5 75 2.0 76 2.0 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5794910556815319 1.15 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 2.025 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.175 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCGTC 10 0.006830828 145.0 8 TGTCTGT 10 0.006830828 145.0 3 AAAAAAA 25 4.977651E-4 29.0 70-74 >>END_MODULE Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633671 spots for SRR6958453.sra Written 633671 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra Read 633652 spots for SRR6958453.sra Written 633652 spots for SRR6958453.sra SRR ids: ['SRR6958453.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5tqzd3xs SRR6958453.sra spots: 12673059 blocks: [[1, 633652], [633653, 1267304], [1267305, 1900956], [1900957, 2534608], [2534609, 3168260], [3168261, 3801912], [3801913, 4435564], [4435565, 5069216], [5069217, 5702868], [5702869, 6336520], [6336521, 6970172], [6970173, 7603824], [7603825, 8237476], [8237477, 8871128], [8871129, 9504780], [9504781, 10138432], [10138433, 10772084], [10772085, 11405736], [11405737, 12039388], [12039389, 12673059]] SRR6958453 file size 4272783 SRR6958453 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958453 SRR6958453_1.fastq SRR6958453_2.fastq Input file: SRR6958453_1.fastq Paired file: SRR6958453_2.fastq trimmed: SRR6958453-trimmed-pair1.fastq, SRR6958453-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:27:24 2024 >> started Fri Dec 6 23:27:39 2024 >> done (15.739s) 12673059 read pairs processed; of these: 7148 ( 0.06%) short read pairs filtered out after trimming by size control 6792 ( 0.05%) empty read pairs filtered out after trimming by size control 12659119 (99.89%) read pairs available; of these: 5984967 (47.28%) trimmed read pairs available after processing 6674152 (52.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 0 0.00% 21 1 0.00% 22 4 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 2 0.00% 31 3 0.00% 32 3 0.00% 33 6 0.00% 34 2 0.00% 35 3 0.00% 36 4 0.00% 37 4 0.00% 38 6 0.00% 39 6 0.00% 40 3 0.00% 41 2 0.00% 42 7 0.00% 43 6 0.00% 44 7 0.00% 45 8 0.00% 46 13 0.00% 47 15 0.00% 48 12 0.00% 49 13 0.00% 50 14 0.00% 51 18 0.00% 52 15 0.00% 53 20 0.00% 54 27 0.00% 55 29 0.00% 56 30 0.00% 57 33 0.00% 58 40 0.00% 59 49 0.00% 60 44 0.00% 61 54 0.00% 62 60 0.00% 63 72 0.00% 64 77 0.00% 65 100 0.00% 66 69 0.00% 67 81 0.00% 68 88 0.00% 69 138 0.00% 70 134 0.00% 71 150 0.00% 72 218 0.00% 73 231 0.00% 74 243 0.00% 75 281 0.00% 76 331 0.00% 77 345 0.00% 78 444 0.00% 79 448 0.00% 80 472 0.00% 81 560 0.00% 82 699 0.01% 83 745 0.01% 84 1073 0.01% 85 1245 0.01% 86 1326 0.01% 87 1466 0.01% 88 1725 0.01% 89 1705 0.01% 90 1882 0.01% 91 1945 0.02% 92 2228 0.02% 93 2418 0.02% 94 2614 0.02% 95 2928 0.02% 96 3037 0.02% 97 3280 0.03% 98 3557 0.03% 99 3982 0.03% 100 4290 0.03% 101 4494 0.04% 102 4894 0.04% 103 5321 0.04% 104 5645 0.04% 105 6123 0.05% 106 6686 0.05% 107 7117 0.06% 108 7513 0.06% 109 8010 0.06% 110 8402 0.07% 111 9046 0.07% 112 9417 0.07% 113 10005 0.08% 114 10739 0.08% 115 11626 0.09% 116 12215 0.10% 117 12883 0.10% 118 13447 0.11% 119 14052 0.11% 120 14895 0.12% 121 15956 0.13% 122 17018 0.13% 123 18019 0.14% 124 18926 0.15% 125 20562 0.16% 126 21088 0.17% 127 22702 0.18% 128 23739 0.19% 129 25418 0.20% 130 27890 0.22% 131 28570 0.23% 132 30272 0.24% 133 32710 0.26% 134 34920 0.28% 135 37714 0.30% 136 40948 0.32% 137 44395 0.35% 138 47366 0.37% 139 51692 0.41% 140 57228 0.45% 141 63940 0.51% 142 72438 0.57% 143 82713 0.65% 144 98911 0.78% 145 122006 0.96% 146 155177 1.23% 147 214547 1.69% 148 335241 2.65% 149 677104 5.35% 150 3316020 26.19% 151 6674152 52.72% 12659119 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=37.48 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=19 prefix-density=0.46 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=78.72 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958453 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:28:22 Started mapping on | Dec 06 23:28:22 Finished on | Dec 06 23:29:54 Mapping speed, Million of reads per hour | 495.36 Number of input reads | 12659119 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12213357 Uniquely mapped reads % | 96.48% Average mapped length | 296.72 Number of splices: Total | 14453311 Number of splices: Annotated (sjdb) | 13611504 Number of splices: GT/AG | 14264932 Number of splices: GC/AG | 165805 Number of splices: AT/AC | 5372 Number of splices: Non-canonical | 17202 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186274 % of reads mapped to multiple loci | 1.47% Number of reads mapped to too many loci | 24667 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 1.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 262806 262806 262806 N_multimapping 186274 186274 186274 N_noFeature 483726 11866130 594463 N_ambiguous 285246 1719 49392 UnstrandedReadsAssigned:11444385 PositiveStrandReadsAssigned:345508 NegativeStrandReadsAssigned:11569502 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958453 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958453-trimmed-pair1.fastq SRR6958453-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,659,119 reads, 11,605,428 reads pseudoaligned [quant] estimated average fragment length: 232.76 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR6958453.ke.tsv 35125 SRR6958453.se.tsv 88098 total ==> SRR6958453.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.611 0.000566305 0.000104887 PNS24247 1044 812.24 30.6276 4.92093 PNS24249 1928 1696.24 24.309 1.87024 PNS24246 1044 812.24 30.6276 4.92093 PNS24248 1044 812.24 30.6276 4.92093 PNS24244 1471 1239.24 22.8077 2.40184 PNS24243 293 86.4033 0 0 KQK14069 1603 1371.24 5033.99 479.091 KQK14071 474 245.679 60.8757 32.3366 ==> SRR6958453.se.tsv <== BRADI_1g14170v3 5599 BRADI_1g53295v3 85 BRADI_1g59795v3 124 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 125 BRADI_1g74790v3 59 BRADI_1g09890v3 0 BRADI_1g77505v3 125 BRADI_1g48960v3 0 SRR6958453 completed mapping pipeline successfully