Starting /dee2/code/volunteer_pipeline.sh SRR6958454 current disk space = 1547581231104 free memory = 1599922412 SRR6958454 SRAfilesize 8500c0d5fbeb35f3faba340fdedb0ca9 SRR6958454.sra SRR6958454.sra file validated SRR6958454 is paired end SRR6958454 is conventional basespace SRR6958454 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.77775 18.0 18.0 30.0 18.0 32.0 2 29.13225 30.0 27.0 33.0 25.0 33.0 3 28.674 31.0 27.0 33.0 18.0 33.0 4 30.19875 31.0 29.0 33.0 27.0 33.0 5 31.8605 33.0 32.0 33.0 30.0 33.0 6 36.26025 38.0 36.0 38.0 33.0 38.0 7 36.5455 38.0 37.0 38.0 34.0 38.0 8 36.7015 38.0 37.0 38.0 34.0 38.0 9 37.13975 38.0 38.0 38.0 36.0 38.0 10-14 37.1823 38.0 38.0 38.0 36.2 38.0 15-19 37.206199999999995 38.0 38.0 38.0 36.4 38.0 20-24 37.184 38.0 38.0 38.0 36.0 38.0 25-29 37.053549999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.968 38.0 38.0 38.0 35.4 38.0 35-39 36.6339 38.0 38.0 38.0 34.2 38.0 40-44 36.7652 38.0 38.0 38.0 35.0 38.0 45-49 36.589150000000004 38.0 38.0 38.0 34.2 38.0 50-54 36.24265 38.0 37.8 38.0 32.8 38.0 55-59 36.19695 38.0 37.2 38.0 32.6 38.0 60-64 36.706900000000005 38.0 38.0 38.0 34.6 38.0 65-69 36.4951 38.0 38.0 38.0 34.0 38.0 70-74 36.0033 38.0 37.4 38.0 31.4 38.0 75-79 35.708800000000004 38.0 36.6 38.0 29.8 38.0 80-84 35.855900000000005 38.0 37.0 38.0 31.4 38.0 85-89 36.08200000000001 38.0 37.0 38.0 32.6 38.0 90-94 35.86265 38.0 36.8 38.0 31.6 38.0 95-99 34.803 38.0 35.2 38.0 26.4 38.0 100-104 34.7136 38.0 35.0 38.0 25.8 38.0 105-109 34.22585 38.0 34.2 38.0 23.4 38.0 110-114 34.388549999999995 38.0 34.8 38.0 23.0 38.0 115-119 33.585449999999994 38.0 33.8 38.0 19.0 38.0 120-124 33.819849999999995 38.0 34.0 38.0 22.2 38.0 125-129 33.525 37.8 33.8 38.0 19.4 38.0 130-134 32.71755 36.8 32.6 38.0 16.4 38.0 135-139 31.91535 36.0 30.6 38.0 14.0 38.0 140-144 30.2952 35.4 27.2 38.0 11.0 38.0 145-149 28.066499999999998 34.2 20.6 38.0 2.0 38.0 150-151 23.7005 32.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 4.0 18 6.0 19 6.0 20 6.0 21 14.0 22 13.0 23 17.0 24 23.0 25 23.0 26 47.0 27 46.0 28 75.0 29 67.0 30 122.0 31 150.0 32 189.0 33 243.0 34 331.0 35 582.0 36 946.0 37 1078.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.92223439211391 16.730558598028477 5.257393209200438 36.089813800657176 2 22.225 12.45 30.475 34.849999999999994 3 22.15 15.950000000000001 24.975 36.925000000000004 4 26.275 22.375 22.825 28.525 5 26.3 28.625 23.175 21.9 6 25.025 30.475 23.724999999999998 20.775 7 17.025000000000002 25.025 36.825 21.125 8 21.125 23.125 29.349999999999998 26.400000000000002 9 21.075 22.45 31.900000000000002 24.575 10-14 23.27 25.825 25.71 25.195 15-19 22.965 25.19 25.990000000000002 25.855 20-24 22.66 25.745 26.05 25.545 25-29 23.13 25.6 25.779999999999998 25.490000000000002 30-34 22.564999999999998 25.0 26.090000000000003 26.345000000000002 35-39 22.765 25.119999999999997 25.759999999999998 26.355 40-44 22.465 25.259999999999998 25.86 26.415 45-49 22.400000000000002 25.285000000000004 25.935000000000002 26.38 50-54 23.285 24.935 25.71 26.07 55-59 23.635 24.165 26.61 25.590000000000003 60-64 23.605 24.85 26.205000000000002 25.34 65-69 23.13 25.074999999999996 25.775 26.02 70-74 23.28 24.755 26.015 25.95 75-79 23.200000000000003 25.259999999999998 25.88 25.66 80-84 23.335 25.72 25.080000000000002 25.865 85-89 23.565 24.36 25.580000000000002 26.495 90-94 23.885 24.315 26.345000000000002 25.455 95-99 23.544999999999998 24.474999999999998 26.075 25.905 100-104 23.44 24.79 25.5 26.27 105-109 23.935000000000002 24.47 25.865 25.729999999999997 110-114 24.15 24.55 25.775 25.525 115-119 23.974999999999998 24.735 25.75 25.540000000000003 120-124 23.825 25.014999999999997 25.35 25.81 125-129 23.830000000000002 24.69 25.15 26.33 130-134 24.295 24.465 25.695 25.545 135-139 24.035 24.665 25.64 25.66 140-144 24.18 24.425 25.53 25.865 145-149 23.84 24.085 25.874999999999996 26.200000000000003 150-151 24.175 25.1875 25.3125 25.324999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 3.0 28 3.5 29 3.0 30 4.0 31 5.0 32 8.5 33 14.0 34 18.0 35 21.5 36 36.5 37 53.5 38 66.5 39 102.5 40 129.5 41 136.0 42 165.0 43 188.5 44 206.0 45 216.5 46 226.5 47 225.0 48 203.5 49 192.0 50 169.5 51 152.5 52 146.5 53 128.0 54 107.5 55 99.0 56 105.5 57 105.5 58 85.0 59 70.5 60 62.5 61 65.0 62 68.0 63 63.5 64 56.0 65 49.0 66 42.5 67 36.5 68 33.5 69 24.5 70 22.0 71 23.5 72 18.0 73 12.0 74 6.5 75 4.0 76 4.0 77 1.5 78 2.0 79 2.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0125 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0125 0.0 0.025 0.0 0.0 84-85 0.025 0.0 0.025 0.0 0.0 86-87 0.075 0.0 0.025 0.0 0.0 88-89 0.075 0.0 0.025 0.0 0.0 90-91 0.1 0.0 0.025 0.0 0.0 92-93 0.1125 0.0 0.025 0.0 0.0 94-95 0.1375 0.0 0.025 0.0 0.0 96-97 0.175 0.0 0.025 0.0 0.0 98-99 0.2875 0.0 0.025 0.0 0.0 100-101 0.3 0.0 0.025 0.0 0.0 102-103 0.3375 0.0 0.025 0.0 0.0 104-105 0.4 0.0 0.025 0.0 0.0 106-107 0.42500000000000004 0.0 0.025 0.0 0.0 108-109 0.5 0.0 0.025 0.0 0.0 110-111 0.6 0.0 0.025 0.0 0.0 112-113 0.7625 0.0 0.025 0.0 0.0 114-115 0.9125000000000001 0.0 0.025 0.0 0.0 116-117 1.05 0.0 0.025 0.0 0.0 118-119 1.2 0.0 0.025 0.0 0.0 120-121 1.35 0.0 0.025 0.0 0.0 122-123 1.5 0.0 0.025 0.0 0.0 124-125 1.5875 0.0 0.025 0.0 0.0 126-127 1.9375 0.0 0.025 0.0 0.0 128-129 2.2375 0.0 0.025 0.0 0.0 130-131 2.525 0.0 0.025 0.0 0.0 132-133 2.7125 0.0 0.025 0.0 0.0 134-135 2.9625000000000004 0.0 0.025 0.0 0.0 136-137 3.1500000000000004 0.0 0.025 0.0 0.0 138-139 3.375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958454 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958454_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19475 33.0 33.0 34.0 31.0 34.0 2 32.13375 33.0 33.0 34.0 30.0 34.0 3 32.287 33.0 33.0 34.0 31.0 34.0 4 32.07225 33.0 33.0 34.0 30.0 34.0 5 32.04725 33.0 33.0 34.0 31.0 34.0 6 35.515 38.0 37.0 38.0 29.0 38.0 7 35.717 38.0 37.0 38.0 31.0 38.0 8 35.7585 38.0 38.0 38.0 31.0 38.0 9 35.9705 38.0 38.0 38.0 33.0 38.0 10-14 35.82895 38.0 38.0 38.0 31.6 38.0 15-19 36.05735 38.0 38.0 38.0 33.2 38.0 20-24 36.223 38.0 38.0 38.0 34.0 38.0 25-29 36.12885 38.0 38.0 38.0 33.8 38.0 30-34 35.9662 38.0 38.0 38.0 33.0 38.0 35-39 35.94525 38.0 38.0 38.0 33.0 38.0 40-44 35.82965 38.0 38.0 38.0 32.6 38.0 45-49 35.74679999999999 38.0 37.8 38.0 31.8 38.0 50-54 35.725699999999996 38.0 37.6 38.0 31.6 38.0 55-59 35.621750000000006 38.0 37.2 38.0 31.8 38.0 60-64 35.343650000000004 38.0 37.0 38.0 29.0 38.0 65-69 35.347 38.0 37.0 38.0 29.0 38.0 70-74 35.136849999999995 38.0 36.6 38.0 28.8 38.0 75-79 35.058749999999996 38.0 36.4 38.0 28.2 38.0 80-84 34.83175 38.0 36.0 38.0 27.6 38.0 85-89 34.75885 38.0 36.0 38.0 27.2 38.0 90-94 34.643899999999995 38.0 35.6 38.0 26.6 38.0 95-99 34.25855 38.0 35.0 38.0 24.2 38.0 100-104 33.62845 38.0 34.0 38.0 17.8 38.0 105-109 33.548849999999995 38.0 34.0 38.0 16.6 38.0 110-114 33.2719 38.0 34.0 38.0 16.2 38.0 115-119 32.68215 38.0 32.6 38.0 15.0 38.0 120-124 32.473 37.6 32.6 38.0 15.0 38.0 125-129 32.076049999999995 37.2 31.6 38.0 14.4 38.0 130-134 31.58025 36.4 30.8 38.0 13.8 38.0 135-139 30.68505 36.0 28.8 38.0 12.8 38.0 140-144 30.063499999999998 35.2 28.0 38.0 10.8 38.0 145-149 28.096899999999998 33.6 21.0 38.0 2.0 38.0 150-151 22.46425 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 18.0 4 5.0 5 3.0 6 2.0 7 4.0 8 7.0 9 5.0 10 3.0 11 3.0 12 3.0 13 3.0 14 3.0 15 5.0 16 9.0 17 9.0 18 11.0 19 15.0 20 17.0 21 19.0 22 16.0 23 18.0 24 25.0 25 37.0 26 38.0 27 52.0 28 74.0 29 68.0 30 111.0 31 122.0 32 177.0 33 246.0 34 295.0 35 464.0 36 892.0 37 1186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.892892892892895 18.743743743743742 11.461461461461461 26.901901901901905 2 28.075 25.124999999999996 25.05 21.75 3 24.55 25.85 26.825 22.775000000000002 4 28.050000000000004 29.275000000000002 19.85 22.825 5 27.575 32.75 19.55 20.125 6 24.224999999999998 34.599999999999994 19.425 21.75 7 24.875 19.85 31.65 23.625 8 24.3 23.625 24.349999999999998 27.725 9 23.425 23.849999999999998 26.55 26.174999999999997 10-14 26.1 26.185000000000002 23.3 24.415 15-19 26.305 25.535000000000004 24.005000000000003 24.154999999999998 20-24 25.715 25.740000000000002 24.474999999999998 24.07 25-29 25.490000000000002 25.45 24.39 24.67 30-34 26.05 25.31 24.21 24.43 35-39 25.34 25.465 24.325 24.87 40-44 25.97 25.495 24.085 24.45 45-49 25.89 25.4 24.75 23.96 50-54 25.71 25.595000000000002 24.26 24.435000000000002 55-59 26.455000000000002 25.285000000000004 23.799999999999997 24.46 60-64 26.06 25.485000000000003 24.635 23.82 65-69 25.775 25.430000000000003 24.474999999999998 24.32 70-74 25.924999999999997 25.22 24.22 24.635 75-79 25.755 24.59 24.915000000000003 24.740000000000002 80-84 26.06 25.195 24.555 24.19 85-89 26.14 24.88 24.3 24.68 90-94 26.38 25.5 24.185000000000002 23.935000000000002 95-99 25.69 24.855 25.165 24.29 100-104 26.490000000000002 25.240000000000002 23.955000000000002 24.315 105-109 26.26 24.995 24.27 24.474999999999998 110-114 26.57 25.580000000000002 24.315 23.535 115-119 25.95 25.295 24.705 24.05 120-124 26.575 25.895000000000003 24.375 23.155 125-129 26.61 25.825 24.15 23.415 130-134 26.6 25.575 24.455 23.369999999999997 135-139 26.685 25.790000000000003 24.46 23.064999999999998 140-144 26.119999999999997 25.740000000000002 24.785 23.355 145-149 26.375 25.715 24.41 23.5 150-151 27.3375 25.9625 23.9875 22.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 2.0 27 1.0 28 2.5 29 3.0 30 3.0 31 6.0 32 7.5 33 7.0 34 10.5 35 20.0 36 34.5 37 47.5 38 61.5 39 84.5 40 118.5 41 140.0 42 145.5 43 171.5 44 203.5 45 219.5 46 201.5 47 183.5 48 200.0 49 197.5 50 164.0 51 145.0 52 134.0 53 113.5 54 112.5 55 115.0 56 100.0 57 96.5 58 90.5 59 80.0 60 74.0 61 67.0 62 72.5 63 69.5 64 64.0 65 64.5 66 66.5 67 60.5 68 49.5 69 43.5 70 39.5 71 31.5 72 18.0 73 12.0 74 10.5 75 7.5 76 5.5 77 6.0 78 5.0 79 2.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2412746585736 98.1 2 0.5058168942842691 1.0 3 0.12645422357106728 0.375 4 0.10116337885685382 0.4 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2374999999999998 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.2125000000000004 0.0 0.0 0.0 0.0 130-131 2.475 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.1625 0.0 0.0 0.0 0.0 138-139 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGCT 10 0.006830828 145.0 145 TACCCCA 10 0.006830828 145.0 5 >>END_MODULE Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120627 spots for SRR6958454.sra Written 1120627 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra Read 1120616 spots for SRR6958454.sra Written 1120616 spots for SRR6958454.sra SRR ids: ['SRR6958454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l3abvcz1 SRR6958454.sra spots: 22412331 blocks: [[1, 1120616], [1120617, 2241232], [2241233, 3361848], [3361849, 4482464], [4482465, 5603080], [5603081, 6723696], [6723697, 7844312], [7844313, 8964928], [8964929, 10085544], [10085545, 11206160], [11206161, 12326776], [12326777, 13447392], [13447393, 14568008], [14568009, 15688624], [15688625, 16809240], [16809241, 17929856], [17929857, 19050472], [19050473, 20171088], [20171089, 21291704], [21291705, 22412331]] SRR6958454 file size 7573103 SRR6958454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958454 SRR6958454_1.fastq SRR6958454_2.fastq Input file: SRR6958454_1.fastq Paired file: SRR6958454_2.fastq trimmed: SRR6958454-trimmed-pair1.fastq, SRR6958454-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:28:16 2024 >> started Fri Dec 6 23:28:42 2024 >> done (25.687s) 22412331 read pairs processed; of these: 75667 ( 0.34%) short read pairs filtered out after trimming by size control 67878 ( 0.30%) empty read pairs filtered out after trimming by size control 22268786 (99.36%) read pairs available; of these: 10469659 (47.01%) trimmed read pairs available after processing 11799127 (52.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 8 0.00% 21 7 0.00% 22 4 0.00% 23 6 0.00% 24 9 0.00% 25 10 0.00% 26 11 0.00% 27 9 0.00% 28 3 0.00% 29 11 0.00% 30 15 0.00% 31 17 0.00% 32 13 0.00% 33 9 0.00% 34 24 0.00% 35 13 0.00% 36 19 0.00% 37 13 0.00% 38 15 0.00% 39 22 0.00% 40 25 0.00% 41 26 0.00% 42 40 0.00% 43 29 0.00% 44 35 0.00% 45 36 0.00% 46 46 0.00% 47 39 0.00% 48 67 0.00% 49 62 0.00% 50 82 0.00% 51 77 0.00% 52 92 0.00% 53 115 0.00% 54 115 0.00% 55 119 0.00% 56 146 0.00% 57 144 0.00% 58 169 0.00% 59 172 0.00% 60 197 0.00% 61 221 0.00% 62 270 0.00% 63 302 0.00% 64 331 0.00% 65 343 0.00% 66 444 0.00% 67 405 0.00% 68 479 0.00% 69 533 0.00% 70 605 0.00% 71 688 0.00% 72 765 0.00% 73 846 0.00% 74 962 0.00% 75 1101 0.00% 76 1168 0.01% 77 1316 0.01% 78 1392 0.01% 79 1666 0.01% 80 1726 0.01% 81 2051 0.01% 82 2487 0.01% 83 2971 0.01% 84 5573 0.03% 85 7245 0.03% 86 7120 0.03% 87 7061 0.03% 88 7066 0.03% 89 7290 0.03% 90 7216 0.03% 91 7633 0.03% 92 7728 0.03% 93 8216 0.04% 94 8746 0.04% 95 9006 0.04% 96 9455 0.04% 97 9807 0.04% 98 10097 0.05% 99 10792 0.05% 100 11429 0.05% 101 11997 0.05% 102 12632 0.06% 103 13528 0.06% 104 13981 0.06% 105 14991 0.07% 106 15572 0.07% 107 16264 0.07% 108 17055 0.08% 109 17879 0.08% 110 18848 0.08% 111 20084 0.09% 112 21200 0.10% 113 22210 0.10% 114 23663 0.11% 115 24627 0.11% 116 25961 0.12% 117 27266 0.12% 118 28491 0.13% 119 29892 0.13% 120 30716 0.14% 121 31789 0.14% 122 34158 0.15% 123 35973 0.16% 124 37797 0.17% 125 40405 0.18% 126 42184 0.19% 127 45022 0.20% 128 46667 0.21% 129 49720 0.22% 130 52125 0.23% 131 54811 0.25% 132 57883 0.26% 133 61910 0.28% 134 66078 0.30% 135 70794 0.32% 136 75523 0.34% 137 79489 0.36% 138 86389 0.39% 139 93122 0.42% 140 101574 0.46% 141 111788 0.50% 142 126386 0.57% 143 145316 0.65% 144 170694 0.77% 145 208708 0.94% 146 263524 1.18% 147 362103 1.63% 148 562981 2.53% 149 1135296 5.10% 150 5645964 25.35% 151 11799127 52.99% 22268786 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=63.28 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.8 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=46.24 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958454 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:29:23 Started mapping on | Dec 06 23:29:23 Finished on | Dec 06 23:30:52 Mapping speed, Million of reads per hour | 900.76 Number of input reads | 22268786 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21768412 Uniquely mapped reads % | 97.75% Average mapped length | 295.82 Number of splices: Total | 25058953 Number of splices: Annotated (sjdb) | 23590053 Number of splices: GT/AG | 24734498 Number of splices: GC/AG | 296773 Number of splices: AT/AC | 9931 Number of splices: Non-canonical | 17751 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 154243 % of reads mapped to multiple loci | 0.69% Number of reads mapped to too many loci | 7372 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.30% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 386843 386843 386843 N_multimapping 154243 154243 154243 N_noFeature 669361 21178938 820691 N_ambiguous 523344 2928 86558 UnstrandedReadsAssigned:20575707 PositiveStrandReadsAssigned:586546 NegativeStrandReadsAssigned:20861163 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958454 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958454-trimmed-pair1.fastq SRR6958454-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,268,786 reads, 20,909,027 reads pseudoaligned [quant] estimated average fragment length: 260.543 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52973 SRR6958454.ke.tsv 35125 SRR6958454.se.tsv 88098 total ==> SRR6958454.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.811 0 0 PNS24247 1044 784.457 82.8163 7.29426 PNS24249 1928 1668.46 54.1042 2.24053 PNS24246 1044 784.457 82.8163 7.29426 PNS24248 1044 784.457 82.8163 7.29426 PNS24244 1471 1211.46 42.4469 2.42088 PNS24243 293 82.0062 0 0 KQK14069 1603 1343.46 3399.92 174.855 KQK14071 474 225.565 74.8428 22.9252 ==> SRR6958454.se.tsv <== BRADI_1g14170v3 4007 BRADI_1g53295v3 359 BRADI_1g59795v3 413 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 323 BRADI_1g74790v3 160 BRADI_1g09890v3 1 BRADI_1g77505v3 362 BRADI_1g48960v3 0 SRR6958454 completed mapping pipeline successfully