Starting /dee2/code/volunteer_pipeline.sh SRR6958455 current disk space = 1547641896960 free memory = 1600049164 SRR6958455 SRAfilesize 7ce904606c776e231f26bf85120be292 SRR6958455.sra SRR6958455.sra file validated SRR6958455 is paired end SRR6958455 is conventional basespace SRR6958455 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.851 32.0 27.0 33.0 18.0 33.0 2 30.05525 31.0 29.0 33.0 25.0 33.0 3 30.54875 31.0 29.0 33.0 27.0 33.0 4 31.53275 33.0 31.0 33.0 29.0 34.0 5 31.486 33.0 32.0 33.0 28.0 34.0 6 36.5645 38.0 37.0 38.0 34.0 38.0 7 37.112 38.0 38.0 38.0 36.0 38.0 8 37.07925 38.0 38.0 38.0 36.0 38.0 9 37.14175 38.0 38.0 38.0 36.0 38.0 10-14 37.31 38.0 38.0 38.0 36.8 38.0 15-19 37.35515 38.0 38.0 38.0 37.0 38.0 20-24 37.33725 38.0 38.0 38.0 36.8 38.0 25-29 37.061449999999994 38.0 38.0 38.0 36.0 38.0 30-34 37.00705000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.778800000000004 38.0 38.0 38.0 35.0 38.0 40-44 36.9014 38.0 38.0 38.0 35.2 38.0 45-49 36.8906 38.0 38.0 38.0 35.4 38.0 50-54 36.4664 38.0 38.0 38.0 33.8 38.0 55-59 36.484 38.0 38.0 38.0 33.6 38.0 60-64 36.7885 38.0 38.0 38.0 34.6 38.0 65-69 36.775 38.0 38.0 38.0 34.8 38.0 70-74 36.5378 38.0 38.0 38.0 34.0 38.0 75-79 35.876549999999995 38.0 36.8 38.0 31.2 38.0 80-84 35.783699999999996 38.0 37.0 38.0 30.4 38.0 85-89 36.01095 38.0 37.0 38.0 32.4 38.0 90-94 36.068400000000004 38.0 37.0 38.0 33.0 38.0 95-99 35.72915 38.0 36.6 38.0 31.4 38.0 100-104 34.87865 38.0 35.2 38.0 27.0 38.0 105-109 34.5569 38.0 34.6 38.0 25.4 38.0 110-114 34.7171 38.0 34.6 38.0 26.2 38.0 115-119 34.53189999999999 38.0 34.6 38.0 25.0 38.0 120-124 34.419200000000004 38.0 34.2 38.0 24.6 38.0 125-129 34.1977 38.0 34.0 38.0 24.6 38.0 130-134 33.93375 38.0 34.0 38.0 23.2 38.0 135-139 33.07875 37.6 33.4 38.0 17.2 38.0 140-144 32.0594 36.4 31.4 38.0 14.2 38.0 145-149 30.379 35.6 29.6 38.0 8.6 38.0 150-151 25.184874999999998 33.0 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 2.0 16 3.0 17 3.0 18 2.0 19 1.0 20 3.0 21 7.0 22 4.0 23 12.0 24 13.0 25 33.0 26 28.0 27 51.0 28 45.0 29 59.0 30 80.0 31 100.0 32 147.0 33 225.0 34 302.0 35 536.0 36 1029.0 37 1311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.56300703082748 9.085992428339642 9.113034072471606 40.23796646836127 2 23.599999999999998 12.0 32.6 31.8 3 20.849999999999998 17.4 24.474999999999998 37.275000000000006 4 25.324999999999996 24.125 22.425 28.125 5 27.250000000000004 27.975 21.825 22.95 6 23.599999999999998 33.1 23.3 20.0 7 19.125 23.175 38.824999999999996 18.875 8 20.775 22.775000000000002 28.849999999999998 27.6 9 20.45 21.7 33.15 24.7 10-14 23.74 25.755 25.34 25.165 15-19 22.98 25.27 26.075 25.674999999999997 20-24 23.044999999999998 25.480000000000004 25.91 25.564999999999998 25-29 23.235 25.21 25.85 25.705 30-34 23.09 24.8 26.465 25.645 35-39 23.46 24.95 25.66 25.929999999999996 40-44 23.3 25.155 25.91 25.635 45-49 23.525 25.590000000000003 25.040000000000003 25.845000000000002 50-54 23.91 24.845 25.724999999999998 25.52 55-59 23.685000000000002 24.8 25.995 25.52 60-64 23.95 24.85 25.88 25.319999999999997 65-69 23.91 24.9 25.755 25.435000000000002 70-74 23.66 25.240000000000002 25.1 26.0 75-79 23.225 25.074999999999996 25.369999999999997 26.33 80-84 23.59 24.8 25.865 25.745 85-89 23.885 24.985 25.145 25.985000000000003 90-94 23.69 24.665 25.619999999999997 26.025 95-99 23.34 24.86 25.915 25.885 100-104 24.08 24.97 25.955000000000002 24.995 105-109 24.205 25.080000000000002 24.91 25.805 110-114 24.310000000000002 25.014999999999997 25.174999999999997 25.5 115-119 24.02 24.8 25.855 25.324999999999996 120-124 24.23 25.069999999999997 24.94 25.759999999999998 125-129 23.615 24.7 25.419999999999998 26.265 130-134 23.855 25.275 24.795 26.075 135-139 23.745 24.79 25.580000000000002 25.885 140-144 23.97 24.77 25.28 25.979999999999997 145-149 23.87 24.779999999999998 25.369999999999997 25.979999999999997 150-151 23.8625 23.962500000000002 26.75 25.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.0 27 1.5 28 2.0 29 2.5 30 2.5 31 4.5 32 11.0 33 17.0 34 20.5 35 29.0 36 38.5 37 57.5 38 85.0 39 100.0 40 114.5 41 157.5 42 198.0 43 186.5 44 189.5 45 209.0 46 213.5 47 208.0 48 190.5 49 174.0 50 147.5 51 146.5 52 142.0 53 114.5 54 110.5 55 105.0 56 93.5 57 83.0 58 82.0 59 88.0 60 75.0 61 67.0 62 68.0 63 64.5 64 68.5 65 53.0 66 39.0 67 50.0 68 42.0 69 30.5 70 26.0 71 21.0 72 20.5 73 16.5 74 9.0 75 8.0 76 7.0 77 2.5 78 1.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.025 0.0 0.0 108-109 0.525 0.0 0.025 0.0 0.0 110-111 0.5625 0.0 0.025 0.0 0.0 112-113 0.7 0.0 0.025 0.0 0.0 114-115 0.8 0.0 0.025 0.0 0.0 116-117 0.875 0.0 0.025 0.0 0.0 118-119 1.0375 0.0 0.025 0.0 0.0 120-121 1.175 0.0 0.025 0.0 0.0 122-123 1.3375 0.0 0.025 0.0 0.0 124-125 1.5750000000000002 0.0 0.025 0.0 0.0 126-127 1.725 0.0 0.025 0.0 0.0 128-129 1.8875 0.0 0.025 0.0 0.0 130-131 2.0999999999999996 0.0 0.025 0.0 0.0 132-133 2.45 0.0 0.025 0.0 0.0 134-135 2.7125 0.0 0.025 0.0 0.0 136-137 2.9625 0.0 0.025 0.0 0.0 138-139 3.0625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTTT 10 0.006841402 144.925 7 >>END_MODULE SRR6958455 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.579 33.0 33.0 34.0 32.0 34.0 2 32.59575 33.0 33.0 34.0 32.0 34.0 3 32.44075 33.0 33.0 34.0 31.0 34.0 4 32.3705 33.0 33.0 34.0 31.0 34.0 5 32.29975 33.0 33.0 34.0 31.0 34.0 6 36.097 38.0 38.0 38.0 33.0 38.0 7 36.3185 38.0 38.0 38.0 33.0 38.0 8 36.3115 38.0 38.0 38.0 34.0 38.0 9 36.3335 38.0 38.0 38.0 34.0 38.0 10-14 36.32645 38.0 38.0 38.0 33.6 38.0 15-19 36.574200000000005 38.0 38.0 38.0 34.6 38.0 20-24 36.66135 38.0 38.0 38.0 35.2 38.0 25-29 36.647149999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.56115 38.0 38.0 38.0 34.8 38.0 35-39 36.468849999999996 38.0 38.0 38.0 34.2 38.0 40-44 36.39645 38.0 38.0 38.0 34.0 38.0 45-49 36.19995 38.0 38.0 38.0 33.4 38.0 50-54 36.31715 38.0 38.0 38.0 34.0 38.0 55-59 36.411449999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.2664 38.0 38.0 38.0 33.8 38.0 65-69 36.068400000000004 38.0 38.0 38.0 33.2 38.0 70-74 36.0762 38.0 38.0 38.0 33.2 38.0 75-79 35.824650000000005 38.0 37.4 38.0 32.0 38.0 80-84 35.78795 38.0 37.0 38.0 31.4 38.0 85-89 35.83485 38.0 37.0 38.0 32.2 38.0 90-94 35.67215 38.0 36.8 38.0 31.2 38.0 95-99 35.372099999999996 38.0 36.6 38.0 29.8 38.0 100-104 35.164 38.0 36.0 38.0 28.8 38.0 105-109 34.887299999999996 38.0 35.6 38.0 27.6 38.0 110-114 34.8051 38.0 35.4 38.0 27.0 38.0 115-119 34.67635 38.0 35.0 38.0 27.0 38.0 120-124 34.39155 38.0 35.0 38.0 24.6 38.0 125-129 33.9739 38.0 34.8 38.0 21.2 38.0 130-134 33.65794999999999 38.0 34.0 38.0 20.6 38.0 135-139 33.32965 38.0 33.8 38.0 18.6 38.0 140-144 32.61465 38.0 32.6 38.0 13.6 38.0 145-149 31.3452 37.6 30.4 38.0 8.6 38.0 150-151 25.885125000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 1.0 5 1.0 6 2.0 7 3.0 8 5.0 9 2.0 10 5.0 11 1.0 12 2.0 13 1.0 14 7.0 15 4.0 16 5.0 17 4.0 18 4.0 19 8.0 20 4.0 21 16.0 22 14.0 23 24.0 24 16.0 25 27.0 26 30.0 27 33.0 28 53.0 29 56.0 30 63.0 31 87.0 32 109.0 33 156.0 34 221.0 35 385.0 36 805.0 37 1826.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.3 17.150000000000002 14.075 31.474999999999998 2 29.332333083270818 22.930732683170792 26.731682920730183 21.005251312828207 3 22.83070767691923 26.731682920730183 26.731682920730183 23.705926481620406 4 25.206301575393848 32.25806451612903 19.42985746436609 23.10577644411103 5 27.906976744186046 32.03300825206302 19.179794948737182 20.880220055013755 6 22.95 34.425 20.1 22.525000000000002 7 22.2 19.525000000000002 34.075 24.2 8 24.3 23.325000000000003 24.375 28.000000000000004 9 24.5 23.025000000000002 26.825 25.650000000000002 10-14 25.629999999999995 25.790000000000003 23.369999999999997 25.21 15-19 25.585 25.174999999999997 24.555 24.685000000000002 20-24 26.105 25.8 24.18 23.915 25-29 26.415 25.374999999999996 23.43 24.779999999999998 30-34 25.75 24.765 24.59 24.895 35-39 26.085 25.290000000000003 23.46 25.165 40-44 26.465 24.95 23.985 24.6 45-49 26.14 24.985 24.125 24.75 50-54 26.340000000000003 24.72 24.255 24.685000000000002 55-59 25.86 25.615 23.825 24.7 60-64 25.924999999999997 25.119999999999997 24.255 24.7 65-69 26.650000000000002 24.805 24.57 23.974999999999998 70-74 26.245 24.725 24.175 24.855 75-79 26.135 25.069999999999997 24.715 24.08 80-84 26.290000000000003 25.335 24.275 24.099999999999998 85-89 26.150000000000002 25.205 24.54 24.104999999999997 90-94 25.835 25.040000000000003 24.58 24.545 95-99 26.009999999999998 24.795 24.94 24.255 100-104 26.16 25.380000000000003 24.490000000000002 23.97 105-109 26.325 25.41 24.08 24.185000000000002 110-114 26.245 25.330000000000002 24.45 23.974999999999998 115-119 26.340000000000003 24.92 24.33 24.41 120-124 25.735000000000003 25.945 24.34 23.98 125-129 26.905 25.44 23.94 23.715 130-134 26.39 24.745 24.535 24.33 135-139 26.325 25.515 24.23 23.93 140-144 26.919999999999998 24.66 24.83 23.59 145-149 26.345000000000002 26.064999999999998 24.33 23.26 150-151 27.175 25.112499999999997 24.825 22.8875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 1.5 25 1.0 26 2.5 27 2.5 28 1.5 29 2.0 30 4.5 31 6.5 32 7.5 33 12.0 34 24.0 35 26.0 36 32.0 37 47.5 38 65.5 39 91.0 40 111.0 41 133.0 42 164.0 43 174.5 44 177.0 45 191.5 46 189.0 47 177.5 48 173.5 49 168.5 50 150.0 51 152.0 52 151.5 53 127.0 54 114.0 55 99.0 56 88.0 57 90.0 58 95.5 59 94.5 60 88.5 61 75.5 62 80.0 63 82.5 64 63.5 65 57.5 66 60.0 67 62.0 68 55.0 69 50.0 70 44.5 71 33.0 72 25.0 73 24.0 74 20.0 75 11.5 76 6.5 77 3.0 78 1.5 79 2.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.5875 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 2.9625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027264 spots for SRR6958455.sra Written 1027264 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra Read 1027249 spots for SRR6958455.sra Written 1027249 spots for SRR6958455.sra SRR ids: ['SRR6958455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_35w5g5nq SRR6958455.sra spots: 20544995 blocks: [[1, 1027249], [1027250, 2054498], [2054499, 3081747], [3081748, 4108996], [4108997, 5136245], [5136246, 6163494], [6163495, 7190743], [7190744, 8217992], [8217993, 9245241], [9245242, 10272490], [10272491, 11299739], [11299740, 12326988], [12326989, 13354237], [13354238, 14381486], [14381487, 15408735], [15408736, 16435984], [16435985, 17463233], [17463234, 18490482], [18490483, 19517731], [19517732, 20544995]] SRR6958455 file size 6940324 SRR6958455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958455 SRR6958455_1.fastq SRR6958455_2.fastq Input file: SRR6958455_1.fastq Paired file: SRR6958455_2.fastq trimmed: SRR6958455-trimmed-pair1.fastq, SRR6958455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:34:35 2024 >> started Fri Dec 6 23:34:56 2024 >> done (21.045s) 20544995 read pairs processed; of these: 43986 ( 0.21%) short read pairs filtered out after trimming by size control 45771 ( 0.22%) empty read pairs filtered out after trimming by size control 20455238 (99.56%) read pairs available; of these: 8824327 (43.14%) trimmed read pairs available after processing 11630911 (56.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 2 0.00% 21 7 0.00% 22 9 0.00% 23 6 0.00% 24 10 0.00% 25 9 0.00% 26 7 0.00% 27 2 0.00% 28 8 0.00% 29 10 0.00% 30 12 0.00% 31 10 0.00% 32 3 0.00% 33 12 0.00% 34 12 0.00% 35 5 0.00% 36 14 0.00% 37 8 0.00% 38 8 0.00% 39 13 0.00% 40 26 0.00% 41 22 0.00% 42 25 0.00% 43 24 0.00% 44 26 0.00% 45 33 0.00% 46 25 0.00% 47 34 0.00% 48 26 0.00% 49 51 0.00% 50 67 0.00% 51 56 0.00% 52 68 0.00% 53 93 0.00% 54 86 0.00% 55 95 0.00% 56 119 0.00% 57 101 0.00% 58 132 0.00% 59 141 0.00% 60 173 0.00% 61 188 0.00% 62 204 0.00% 63 250 0.00% 64 263 0.00% 65 270 0.00% 66 334 0.00% 67 364 0.00% 68 382 0.00% 69 442 0.00% 70 544 0.00% 71 603 0.00% 72 648 0.00% 73 779 0.00% 74 783 0.00% 75 864 0.00% 76 1022 0.00% 77 1076 0.01% 78 1149 0.01% 79 1250 0.01% 80 1581 0.01% 81 1761 0.01% 82 1945 0.01% 83 2376 0.01% 84 4170 0.02% 85 5265 0.03% 86 5227 0.03% 87 5132 0.03% 88 5482 0.03% 89 5432 0.03% 90 5665 0.03% 91 5786 0.03% 92 6139 0.03% 93 6487 0.03% 94 6855 0.03% 95 7248 0.04% 96 7692 0.04% 97 8029 0.04% 98 8248 0.04% 99 8855 0.04% 100 9233 0.05% 101 9834 0.05% 102 10248 0.05% 103 11022 0.05% 104 11778 0.06% 105 12150 0.06% 106 12867 0.06% 107 13554 0.07% 108 14247 0.07% 109 14634 0.07% 110 15626 0.08% 111 16379 0.08% 112 17398 0.09% 113 18421 0.09% 114 19426 0.09% 115 20802 0.10% 116 21592 0.11% 117 22599 0.11% 118 23711 0.12% 119 24801 0.12% 120 25840 0.13% 121 27001 0.13% 122 28194 0.14% 123 29377 0.14% 124 31493 0.15% 125 33285 0.16% 126 35033 0.17% 127 37587 0.18% 128 38989 0.19% 129 41042 0.20% 130 43209 0.21% 131 45934 0.22% 132 48927 0.24% 133 52247 0.26% 134 55412 0.27% 135 58938 0.29% 136 63139 0.31% 137 67274 0.33% 138 71535 0.35% 139 78151 0.38% 140 85403 0.42% 141 94317 0.46% 142 105946 0.52% 143 122512 0.60% 144 143339 0.70% 145 172978 0.85% 146 219868 1.07% 147 302203 1.48% 148 464920 2.27% 149 958988 4.69% 150 4798537 23.46% 151 11630911 56.86% 20455238 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=23 prefix-density=0.65 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=52.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=19 prefix-density=0.50 prefix-fanout=3.0 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=60.90 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=11.8 sequence=GCCGCCGCCGCC SRR6958455 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:35:49 Started mapping on | Dec 06 23:35:50 Finished on | Dec 06 23:37:10 Mapping speed, Million of reads per hour | 920.49 Number of input reads | 20455238 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19904548 Uniquely mapped reads % | 97.31% Average mapped length | 296.44 Number of splices: Total | 22719548 Number of splices: Annotated (sjdb) | 21398956 Number of splices: GT/AG | 22425421 Number of splices: GC/AG | 267382 Number of splices: AT/AC | 8955 Number of splices: Non-canonical | 17790 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 133880 % of reads mapped to multiple loci | 0.65% Number of reads mapped to too many loci | 14632 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.50% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 443400 443400 443400 N_multimapping 133880 133880 133880 N_noFeature 598271 19363872 736847 N_ambiguous 476466 2686 75272 UnstrandedReadsAssigned:18829811 PositiveStrandReadsAssigned:537990 NegativeStrandReadsAssigned:19092429 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958455-trimmed-pair1.fastq SRR6958455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,455,238 reads, 19,118,027 reads pseudoaligned [quant] estimated average fragment length: 275.789 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR6958455.ke.tsv 35125 SRR6958455.se.tsv 88098 total ==> SRR6958455.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.715 0 0 PNS24247 1044 769.211 85.6889 8.55507 PNS24249 1928 1653.21 57.4953 2.67084 PNS24246 1044 769.211 85.6889 8.55507 PNS24248 1044 769.211 85.6889 8.55507 PNS24244 1471 1196.21 44.4379 2.85293 PNS24243 293 80.1958 0 0 KQK14069 1603 1328.21 3935.76 227.565 KQK14071 474 217.135 46.4185 16.4174 ==> SRR6958455.se.tsv <== BRADI_1g14170v3 4322 BRADI_1g53295v3 291 BRADI_1g59795v3 245 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 302 BRADI_1g74790v3 138 BRADI_1g09890v3 0 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR6958455 completed mapping pipeline successfully