Starting /dee2/code/volunteer_pipeline.sh SRR6958456 current disk space = 1547651121152 free memory = 1601575236 SRR6958456 SRAfilesize 58b95a808cb45189d225a706e147ea46 SRR6958456.sra SRR6958456.sra file validated SRR6958456 is paired end SRR6958456 is conventional basespace SRR6958456 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.99 18.0 18.0 31.0 18.0 32.0 2 26.98325 28.0 25.0 31.0 18.0 33.0 3 28.76725 30.0 27.0 33.0 18.0 33.0 4 30.04725 31.0 29.0 33.0 25.0 33.0 5 30.25125 31.0 29.0 33.0 27.0 33.0 6 35.93325 37.0 36.0 38.0 32.0 38.0 7 36.9105 38.0 37.0 38.0 35.0 38.0 8 37.195 38.0 38.0 38.0 36.0 38.0 9 37.2755 38.0 38.0 38.0 37.0 38.0 10-14 37.287 38.0 38.0 38.0 36.8 38.0 15-19 37.386900000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.35055 38.0 38.0 38.0 36.8 38.0 25-29 37.1465 38.0 38.0 38.0 36.0 38.0 30-34 37.044 38.0 38.0 38.0 36.0 38.0 35-39 36.9939 38.0 38.0 38.0 36.0 38.0 40-44 36.92379999999999 38.0 38.0 38.0 35.4 38.0 45-49 36.79045 38.0 38.0 38.0 35.0 38.0 50-54 36.37480000000001 38.0 37.8 38.0 33.6 38.0 55-59 36.393449999999994 38.0 37.8 38.0 33.8 38.0 60-64 36.74085 38.0 38.0 38.0 34.6 38.0 65-69 36.88785 38.0 38.0 38.0 34.8 38.0 70-74 36.59495 38.0 38.0 38.0 34.2 38.0 75-79 36.0832 38.0 37.2 38.0 32.4 38.0 80-84 36.055600000000005 38.0 37.0 38.0 32.6 38.0 85-89 36.2972 38.0 37.2 38.0 33.2 38.0 90-94 36.19085 38.0 37.2 38.0 33.2 38.0 95-99 35.75834999999999 38.0 36.4 38.0 31.0 38.0 100-104 35.2374 38.0 35.6 38.0 28.6 38.0 105-109 34.72155 38.0 35.0 38.0 26.0 38.0 110-114 34.8057 38.0 35.0 38.0 27.0 38.0 115-119 34.473299999999995 38.0 34.4 38.0 25.0 38.0 120-124 34.2367 38.0 34.2 38.0 22.8 38.0 125-129 34.30625 38.0 34.4 38.0 24.6 38.0 130-134 33.551649999999995 38.0 33.6 38.0 20.6 38.0 135-139 32.965650000000004 37.8 32.2 38.0 18.2 38.0 140-144 32.11085 36.0 31.0 38.0 13.8 38.0 145-149 29.970550000000003 35.2 28.6 38.0 8.6 38.0 150-151 23.988125 31.0 8.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 6.0 20 5.0 21 4.0 22 9.0 23 21.0 24 18.0 25 21.0 26 24.0 27 37.0 28 46.0 29 71.0 30 72.0 31 105.0 32 171.0 33 234.0 34 323.0 35 545.0 36 1166.0 37 1116.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.28966639544345 16.70735014917277 4.719283970707893 42.28369948467589 2 20.0 12.875 30.925000000000004 36.199999999999996 3 18.8 15.125 27.625 38.45 4 28.4 20.1 22.675 28.825 5 29.175 22.25 24.375 24.2 6 22.900000000000002 31.424999999999997 22.7 22.975 7 16.725 24.474999999999998 38.7 20.1 8 22.125 23.225 27.700000000000003 26.950000000000003 9 20.3 20.95 33.625 25.124999999999996 10-14 22.63 25.46 26.555 25.355 15-19 23.095 24.16 26.305 26.44 20-24 23.294999999999998 24.435000000000002 26.695 25.575 25-29 23.335 24.805 25.52 26.340000000000003 30-34 23.48 24.990000000000002 25.715 25.814999999999998 35-39 23.22 25.064999999999998 25.6 26.115 40-44 24.310000000000002 24.065 25.5 26.125 45-49 23.31 24.995 24.93 26.765 50-54 24.165 24.36 25.419999999999998 26.055 55-59 23.849999999999998 24.33 25.790000000000003 26.029999999999998 60-64 23.635 24.65 24.945 26.77 65-69 23.474999999999998 24.985 25.485000000000003 26.055 70-74 23.96 24.92 24.945 26.174999999999997 75-79 23.64 24.865000000000002 25.545 25.95 80-84 23.46 24.43 25.835 26.275 85-89 24.355 24.02 25.715 25.91 90-94 24.46 24.145 25.295 26.1 95-99 24.015 24.45 25.655 25.88 100-104 24.335 24.154999999999998 25.35 26.16 105-109 24.255 24.615000000000002 25.130000000000003 26.0 110-114 24.68 24.775 24.759999999999998 25.785000000000004 115-119 24.14 24.395 25.21 26.255 120-124 24.035 24.315 25.540000000000003 26.11 125-129 23.74 24.265 25.569999999999997 26.424999999999997 130-134 24.395 24.485 25.035 26.085 135-139 24.29 25.05 24.565 26.095000000000002 140-144 24.169999999999998 25.040000000000003 24.555 26.235000000000003 145-149 23.985 24.72 24.825 26.47 150-151 25.4 23.775 24.775 26.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 3.0 29 1.5 30 2.0 31 8.0 32 10.5 33 14.0 34 22.0 35 24.5 36 29.0 37 49.0 38 69.0 39 83.0 40 118.5 41 155.0 42 171.5 43 189.0 44 190.0 45 190.0 46 193.0 47 184.5 48 193.0 49 199.0 50 172.0 51 147.0 52 141.0 53 137.0 54 124.5 55 107.0 56 98.0 57 81.5 58 76.0 59 80.5 60 89.0 61 86.5 62 72.5 63 70.5 64 62.0 65 59.5 66 49.0 67 38.5 68 40.0 69 34.5 70 30.0 71 24.5 72 19.0 73 14.5 74 12.0 75 11.0 76 7.5 77 4.0 78 3.5 79 2.0 80 1.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.9 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.425 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.2875 0.0 0.0 0.0 0.0 130-131 4.825 0.0 0.0 0.0 0.0 132-133 5.5125 0.0 0.0 0.0 0.0 134-135 6.0875 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTCAA 10 0.006843168 144.91249 5 CAGGTCA 10 0.006843168 144.91249 145 TCTCAAT 10 0.006843168 144.91249 7 >>END_MODULE SRR6958456 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49725 33.0 33.0 34.0 32.0 34.0 2 32.378 33.0 33.0 34.0 31.0 34.0 3 32.43975 33.0 33.0 34.0 31.0 34.0 4 32.2815 33.0 33.0 34.0 31.0 34.0 5 32.3835 33.0 33.0 34.0 31.0 34.0 6 36.48025 38.0 38.0 38.0 34.0 38.0 7 36.4895 38.0 38.0 38.0 34.0 38.0 8 36.27225 38.0 38.0 38.0 33.0 38.0 9 36.4985 38.0 38.0 38.0 34.0 38.0 10-14 36.430899999999994 38.0 38.0 38.0 34.0 38.0 15-19 36.616200000000006 38.0 38.0 38.0 35.0 38.0 20-24 36.5854 38.0 38.0 38.0 34.6 38.0 25-29 36.65155 38.0 38.0 38.0 34.8 38.0 30-34 36.653650000000006 38.0 38.0 38.0 34.8 38.0 35-39 36.462199999999996 38.0 38.0 38.0 34.4 38.0 40-44 36.36095 38.0 38.0 38.0 33.8 38.0 45-49 36.32234999999999 38.0 38.0 38.0 33.8 38.0 50-54 36.35065 38.0 38.0 38.0 34.0 38.0 55-59 36.26715 38.0 38.0 38.0 33.8 38.0 60-64 36.10895 38.0 38.0 38.0 33.2 38.0 65-69 35.84615 38.0 37.2 38.0 31.6 38.0 70-74 35.8604 38.0 37.0 38.0 32.0 38.0 75-79 35.7367 38.0 37.0 38.0 31.8 38.0 80-84 35.50785 38.0 36.6 38.0 30.0 38.0 85-89 35.546749999999996 38.0 36.6 38.0 30.6 38.0 90-94 35.18875 38.0 36.2 38.0 28.6 38.0 95-99 34.86130000000001 38.0 35.8 38.0 27.4 38.0 100-104 34.5481 38.0 35.0 38.0 25.4 38.0 105-109 34.1943 38.0 34.6 38.0 23.6 38.0 110-114 33.59755 38.0 34.4 38.0 19.4 38.0 115-119 33.4129 38.0 33.4 38.0 19.4 38.0 120-124 33.1158 38.0 33.0 38.0 20.2 38.0 125-129 32.17985 37.6 31.0 38.0 14.6 38.0 130-134 31.067200000000003 36.0 29.2 38.0 13.0 38.0 135-139 30.45625 35.8 28.6 38.0 12.6 38.0 140-144 30.199399999999997 36.0 28.0 38.0 9.6 38.0 145-149 28.219600000000003 34.2 22.2 38.0 2.0 38.0 150-151 21.79375 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 2.0 5 1.0 6 4.0 7 4.0 8 1.0 9 1.0 10 4.0 11 2.0 12 4.0 13 1.0 14 2.0 15 9.0 16 12.0 17 13.0 18 9.0 19 11.0 20 13.0 21 13.0 22 13.0 23 32.0 24 26.0 25 29.0 26 31.0 27 62.0 28 59.0 29 59.0 30 110.0 31 114.0 32 149.0 33 193.0 34 348.0 35 501.0 36 998.0 37 1153.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 18.25 11.600000000000001 31.7 2 28.999999999999996 24.05 26.075 20.875 3 23.275000000000002 25.324999999999996 26.875 24.525 4 25.275 31.5 20.0 23.225 5 28.199999999999996 32.074999999999996 18.8 20.925 6 23.65 35.449999999999996 19.7 21.2 7 22.05 20.9 32.95 24.099999999999998 8 24.3 23.549999999999997 24.4 27.750000000000004 9 24.025 23.575 26.875 25.525 10-14 26.595000000000002 26.51 22.395 24.5 15-19 25.729999999999997 24.735 24.12 25.415 20-24 25.985000000000003 25.895000000000003 23.79 24.33 25-29 26.21 25.515 23.525 24.75 30-34 25.95 25.75 23.735 24.565 35-39 25.619999999999997 25.180000000000003 24.060000000000002 25.14 40-44 26.415 24.575 23.865 25.145 45-49 26.63 25.11 24.19 24.07 50-54 26.935 25.275 23.244999999999997 24.545 55-59 26.745 25.685000000000002 22.939999999999998 24.63 60-64 25.89 25.285000000000004 24.525 24.3 65-69 26.735 25.295 23.575 24.395 70-74 26.490000000000002 25.319999999999997 23.705000000000002 24.485 75-79 25.814999999999998 25.195 24.21 24.779999999999998 80-84 26.43 24.8 24.145 24.625 85-89 26.265 24.54 24.645 24.55 90-94 25.840000000000003 25.22 24.09 24.85 95-99 25.624999999999996 26.040000000000003 24.245 24.09 100-104 26.889999999999997 24.92 24.085 24.104999999999997 105-109 26.02 25.47 23.71 24.8 110-114 26.565 25.885 24.175 23.375 115-119 27.01 25.135 24.13 23.724999999999998 120-124 26.56 25.805 24.03 23.605 125-129 27.205000000000002 25.669999999999998 23.64 23.485 130-134 26.985 25.785000000000004 23.68 23.549999999999997 135-139 26.655 25.895000000000003 24.37 23.080000000000002 140-144 27.655 25.724999999999998 23.47 23.150000000000002 145-149 27.755000000000003 25.074999999999996 24.04 23.13 150-151 28.3375 25.674999999999997 22.7625 23.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.5 29 4.0 30 4.0 31 5.5 32 5.5 33 8.0 34 13.5 35 23.5 36 31.0 37 45.5 38 74.0 39 87.0 40 102.0 41 129.5 42 153.0 43 168.5 44 186.5 45 196.5 46 195.0 47 188.0 48 170.5 49 158.0 50 165.5 51 166.0 52 141.5 53 123.0 54 109.0 55 95.0 56 99.0 57 111.0 58 105.0 59 91.0 60 87.0 61 80.0 62 72.5 63 78.5 64 82.0 65 70.0 66 60.0 67 53.5 68 51.0 69 46.0 70 34.0 71 29.5 72 26.5 73 18.0 74 17.0 75 19.5 76 10.5 77 3.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.5125000000000002 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0875000000000004 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.762499999999999 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009996 spots for SRR6958456.sra Written 1009996 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra Read 1009982 spots for SRR6958456.sra Written 1009982 spots for SRR6958456.sra SRR ids: ['SRR6958456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4_1hgglg SRR6958456.sra spots: 20199654 blocks: [[1, 1009982], [1009983, 2019964], [2019965, 3029946], [3029947, 4039928], [4039929, 5049910], [5049911, 6059892], [6059893, 7069874], [7069875, 8079856], [8079857, 9089838], [9089839, 10099820], [10099821, 11109802], [11109803, 12119784], [12119785, 13129766], [13129767, 14139748], [14139749, 15149730], [15149731, 16159712], [16159713, 17169694], [17169695, 18179676], [18179677, 19189658], [19189659, 20199654]] SRR6958456 file size 6823299 SRR6958456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958456 SRR6958456_1.fastq SRR6958456_2.fastq Input file: SRR6958456_1.fastq Paired file: SRR6958456_2.fastq trimmed: SRR6958456-trimmed-pair1.fastq, SRR6958456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:34:28 2024 >> started Fri Dec 6 23:34:50 2024 >> done (21.209s) 20199654 read pairs processed; of these: 31985 ( 0.16%) short read pairs filtered out after trimming by size control 30328 ( 0.15%) empty read pairs filtered out after trimming by size control 20137341 (99.69%) read pairs available; of these: 10399908 (51.64%) trimmed read pairs available after processing 9737433 (48.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 7 0.00% 26 6 0.00% 27 3 0.00% 28 7 0.00% 29 5 0.00% 30 2 0.00% 31 6 0.00% 32 4 0.00% 33 12 0.00% 34 19 0.00% 35 10 0.00% 36 5 0.00% 37 12 0.00% 38 16 0.00% 39 15 0.00% 40 11 0.00% 41 16 0.00% 42 16 0.00% 43 24 0.00% 44 27 0.00% 45 29 0.00% 46 35 0.00% 47 39 0.00% 48 44 0.00% 49 41 0.00% 50 59 0.00% 51 65 0.00% 52 64 0.00% 53 82 0.00% 54 103 0.00% 55 79 0.00% 56 101 0.00% 57 124 0.00% 58 153 0.00% 59 135 0.00% 60 172 0.00% 61 191 0.00% 62 223 0.00% 63 216 0.00% 64 299 0.00% 65 286 0.00% 66 322 0.00% 67 351 0.00% 68 401 0.00% 69 445 0.00% 70 529 0.00% 71 605 0.00% 72 738 0.00% 73 754 0.00% 74 900 0.00% 75 972 0.00% 76 1170 0.01% 77 1327 0.01% 78 1399 0.01% 79 1627 0.01% 80 1890 0.01% 81 2190 0.01% 82 2602 0.01% 83 2984 0.01% 84 4310 0.02% 85 5408 0.03% 86 5521 0.03% 87 5811 0.03% 88 6222 0.03% 89 6443 0.03% 90 6866 0.03% 91 7554 0.04% 92 8199 0.04% 93 8952 0.04% 94 9698 0.05% 95 10519 0.05% 96 11273 0.06% 97 12358 0.06% 98 13168 0.07% 99 13917 0.07% 100 14947 0.07% 101 16017 0.08% 102 17345 0.09% 103 18635 0.09% 104 20349 0.10% 105 21473 0.11% 106 22946 0.11% 107 24216 0.12% 108 25936 0.13% 109 27129 0.13% 110 28067 0.14% 111 30300 0.15% 112 32288 0.16% 113 33799 0.17% 114 36022 0.18% 115 38852 0.19% 116 40390 0.20% 117 42005 0.21% 118 43716 0.22% 119 45344 0.23% 120 46958 0.23% 121 50027 0.25% 122 51939 0.26% 123 54893 0.27% 124 57751 0.29% 125 61047 0.30% 126 63051 0.31% 127 66198 0.33% 128 68632 0.34% 129 71040 0.35% 130 74101 0.37% 131 77781 0.39% 132 82145 0.41% 133 85990 0.43% 134 90206 0.45% 135 95263 0.47% 136 99906 0.50% 137 105105 0.52% 138 109635 0.54% 139 117385 0.58% 140 124309 0.62% 141 134781 0.67% 142 149777 0.74% 143 166226 0.83% 144 188840 0.94% 145 222867 1.11% 146 273705 1.36% 147 366017 1.82% 148 546039 2.71% 149 1061082 5.27% 150 4897231 24.32% 151 9737433 48.36% 20137341 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=21 prefix-density=0.61 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=43.66 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=58.36 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958456 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:35:47 Started mapping on | Dec 06 23:35:47 Finished on | Dec 06 23:37:14 Mapping speed, Million of reads per hour | 833.27 Number of input reads | 20137341 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19798809 Uniquely mapped reads % | 98.32% Average mapped length | 293.58 Number of splices: Total | 22089226 Number of splices: Annotated (sjdb) | 20746309 Number of splices: GT/AG | 21803065 Number of splices: GC/AG | 260851 Number of splices: AT/AC | 8764 Number of splices: Non-canonical | 16546 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125025 % of reads mapped to multiple loci | 0.62% Number of reads mapped to too many loci | 8481 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 232257 232257 232257 N_multimapping 125025 125025 125025 N_noFeature 560382 19268163 699626 N_ambiguous 462004 2369 71423 UnstrandedReadsAssigned:18776423 PositiveStrandReadsAssigned:528277 NegativeStrandReadsAssigned:19027760 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958456-trimmed-pair1.fastq SRR6958456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,137,341 reads, 19,057,390 reads pseudoaligned [quant] estimated average fragment length: 236.494 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958456.ke.tsv 35125 SRR6958456.se.tsv 88098 total ==> SRR6958456.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.979 0 0 PNS24247 1044 808.506 68.6888 6.54028 PNS24249 1928 1692.51 52.246 2.37638 PNS24246 1044 808.506 68.6888 6.54028 PNS24248 1044 808.506 68.6888 6.54028 PNS24244 1471 1235.51 35.6877 2.22366 PNS24243 293 96.3619 0 0 KQK14069 1603 1367.51 4388.6 247.053 KQK14071 474 247.592 124.272 38.6394 ==> SRR6958456.se.tsv <== BRADI_1g14170v3 5044 BRADI_1g53295v3 302 BRADI_1g59795v3 239 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 339 BRADI_1g74790v3 157 BRADI_1g09890v3 0 BRADI_1g77505v3 248 BRADI_1g48960v3 0 SRR6958456 completed mapping pipeline successfully