Starting /dee2/code/volunteer_pipeline.sh SRR6958457 current disk space = 1547652358144 free memory = 1596161788 SRR6958457 SRAfilesize 091301657cdc1adb0d911662e23da980 SRR6958457.sra SRR6958457.sra file validated SRR6958457 is paired end SRR6958457 is conventional basespace SRR6958457 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.63025 18.0 18.0 31.0 18.0 32.0 2 29.67625 31.0 27.0 33.0 27.0 33.0 3 29.32325 31.0 28.0 33.0 18.0 33.0 4 30.23975 31.0 29.0 33.0 27.0 33.0 5 31.3555 33.0 32.0 33.0 28.0 33.0 6 36.04625 38.0 36.0 38.0 33.0 38.0 7 36.63875 38.0 37.0 38.0 34.0 38.0 8 36.60825 38.0 38.0 38.0 34.0 38.0 9 37.00775 38.0 38.0 38.0 35.0 38.0 10-14 37.136199999999995 38.0 38.0 38.0 36.0 38.0 15-19 37.2067 38.0 38.0 38.0 36.4 38.0 20-24 37.16435 38.0 38.0 38.0 36.0 38.0 25-29 37.0612 38.0 38.0 38.0 36.0 38.0 30-34 36.98765 38.0 38.0 38.0 35.8 38.0 35-39 36.6644 38.0 38.0 38.0 34.2 38.0 40-44 36.78705 38.0 38.0 38.0 34.8 38.0 45-49 36.60744999999999 38.0 38.0 38.0 34.2 38.0 50-54 36.2797 38.0 37.8 38.0 33.0 38.0 55-59 36.21535 38.0 37.6 38.0 32.8 38.0 60-64 36.82205 38.0 38.0 38.0 34.8 38.0 65-69 36.5008 38.0 38.0 38.0 33.8 38.0 70-74 36.04035 38.0 37.4 38.0 31.6 38.0 75-79 35.74235 38.0 36.8 38.0 30.2 38.0 80-84 35.9289 38.0 37.0 38.0 31.8 38.0 85-89 36.168949999999995 38.0 37.4 38.0 33.4 38.0 90-94 36.00165 38.0 36.8 38.0 32.2 38.0 95-99 34.96795 38.0 35.2 38.0 27.6 38.0 100-104 34.86555 38.0 35.0 38.0 26.6 38.0 105-109 34.292899999999996 38.0 34.4 38.0 23.8 38.0 110-114 34.6166 38.0 34.8 38.0 26.2 38.0 115-119 33.89895 38.0 34.0 38.0 22.2 38.0 120-124 33.960750000000004 38.0 34.0 38.0 23.0 38.0 125-129 33.70119999999999 38.0 33.8 38.0 21.0 38.0 130-134 32.8627 37.4 32.6 38.0 16.4 38.0 135-139 32.28225 36.6 32.2 38.0 14.2 38.0 140-144 30.5433 35.6 28.8 38.0 13.2 38.0 145-149 28.149549999999998 34.2 20.8 38.0 2.0 38.0 150-151 24.051375 32.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 3.0 17 6.0 18 4.0 19 9.0 20 7.0 21 9.0 22 15.0 23 16.0 24 20.0 25 30.0 26 29.0 27 62.0 28 65.0 29 74.0 30 113.0 31 152.0 32 165.0 33 229.0 34 314.0 35 559.0 36 987.0 37 1126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.56756756756757 14.297297297297298 6.621621621621622 39.513513513513516 2 24.224999999999998 11.525 28.999999999999996 35.25 3 23.125 15.6 24.6 36.675000000000004 4 25.1 22.275 21.85 30.775000000000002 5 26.025 25.374999999999996 23.974999999999998 24.625 6 23.95 30.15 23.5 22.400000000000002 7 18.475 23.724999999999998 37.75 20.05 8 21.175 23.075000000000003 27.55 28.199999999999996 9 21.375 21.9 31.574999999999996 25.15 10-14 23.79 25.195 25.31 25.705 15-19 23.52 24.195 26.095000000000002 26.19 20-24 23.825 25.205 25.44 25.53 25-29 23.74 24.779999999999998 25.115 26.365 30-34 23.785 24.525 25.605 26.085 35-39 24.13 24.495 25.009999999999998 26.365 40-44 24.099999999999998 24.535 25.264999999999997 26.1 45-49 23.61 24.73 25.39 26.27 50-54 24.015 24.465 24.82 26.700000000000003 55-59 23.945 24.42 25.25 26.384999999999998 60-64 23.849999999999998 24.675 25.445 26.029999999999998 65-69 23.995 24.055 25.395 26.555 70-74 24.055 24.665 25.005 26.275 75-79 24.265 23.945 25.25 26.540000000000003 80-84 24.485 23.849999999999998 25.124999999999996 26.540000000000003 85-89 24.685000000000002 23.565 25.419999999999998 26.33 90-94 24.12 24.22 25.074999999999996 26.584999999999997 95-99 24.58 23.775 25.385 26.26 100-104 24.404999999999998 24.0 25.03 26.565 105-109 24.595 23.990000000000002 25.319999999999997 26.095000000000002 110-114 24.89 24.27 24.175 26.665 115-119 24.535 23.715 25.235000000000003 26.515 120-124 24.545 24.08 25.085 26.290000000000003 125-129 24.985 24.08 24.895 26.040000000000003 130-134 25.069999999999997 24.41 24.48 26.040000000000003 135-139 24.785 24.215 24.310000000000002 26.69 140-144 25.515 24.26 24.26 25.965 145-149 24.735 24.34 24.709999999999997 26.215 150-151 25.074999999999996 23.5125 25.4375 25.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 2.0 29 3.0 30 2.0 31 6.0 32 11.0 33 13.5 34 20.0 35 29.5 36 34.0 37 49.5 38 61.0 39 75.0 40 102.0 41 127.0 42 154.5 43 184.5 44 200.5 45 197.0 46 202.0 47 195.5 48 189.0 49 181.5 50 161.5 51 148.0 52 137.0 53 124.0 54 109.5 55 111.5 56 109.0 57 84.5 58 82.0 59 85.0 60 81.5 61 79.0 62 63.5 63 60.0 64 73.0 65 76.5 66 58.5 67 44.0 68 48.0 69 43.5 70 34.0 71 35.5 72 33.0 73 25.5 74 18.5 75 12.0 76 7.5 77 6.5 78 3.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.8625 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.0250000000000004 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.199999999999999 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTCG 10 0.0068396386 144.9375 3 >>END_MODULE SRR6958457 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.373 33.0 33.0 34.0 31.0 34.0 2 32.45 33.0 33.0 34.0 31.0 34.0 3 32.489 33.0 33.0 34.0 31.0 34.0 4 32.35875 33.0 33.0 34.0 31.0 34.0 5 32.37825 33.0 33.0 34.0 31.0 34.0 6 35.89175 38.0 38.0 38.0 31.0 38.0 7 36.00475 38.0 38.0 38.0 31.0 38.0 8 36.08825 38.0 38.0 38.0 33.0 38.0 9 36.288 38.0 38.0 38.0 34.0 38.0 10-14 36.1204 38.0 38.0 38.0 32.6 38.0 15-19 36.45015 38.0 38.0 38.0 34.4 38.0 20-24 36.572849999999995 38.0 38.0 38.0 34.8 38.0 25-29 36.50765 38.0 38.0 38.0 34.8 38.0 30-34 36.39405 38.0 38.0 38.0 34.0 38.0 35-39 36.312799999999996 38.0 38.0 38.0 34.0 38.0 40-44 36.15065 38.0 38.0 38.0 33.4 38.0 45-49 36.075050000000005 38.0 38.0 38.0 32.8 38.0 50-54 36.13505 38.0 38.0 38.0 33.6 38.0 55-59 36.122350000000004 38.0 38.0 38.0 33.4 38.0 60-64 35.8109 38.0 37.4 38.0 31.4 38.0 65-69 35.8356 38.0 37.4 38.0 31.8 38.0 70-74 35.6289 38.0 37.0 38.0 30.6 38.0 75-79 35.54075 38.0 37.0 38.0 30.4 38.0 80-84 35.378099999999996 38.0 36.6 38.0 29.4 38.0 85-89 35.284749999999995 38.0 36.2 38.0 29.4 38.0 90-94 35.12965 38.0 36.2 38.0 28.4 38.0 95-99 34.8076 38.0 35.6 38.0 27.2 38.0 100-104 34.19405 38.0 34.8 38.0 23.4 38.0 105-109 34.08655 38.0 34.6 38.0 22.6 38.0 110-114 33.84125 38.0 34.0 38.0 21.8 38.0 115-119 33.229699999999994 38.0 33.8 38.0 17.4 38.0 120-124 33.13185 38.0 33.8 38.0 15.0 38.0 125-129 32.74725 37.6 33.2 38.0 16.0 38.0 130-134 32.14835000000001 37.4 32.2 38.0 14.0 38.0 135-139 31.2464 36.0 30.4 38.0 13.0 38.0 140-144 30.554949999999998 36.0 29.2 38.0 13.0 38.0 145-149 28.690199999999997 34.6 24.6 38.0 2.0 38.0 150-151 22.540125 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 10.0 4 3.0 5 4.0 6 3.0 7 4.0 8 2.0 9 2.0 10 0.0 11 1.0 12 4.0 13 4.0 14 5.0 15 5.0 16 5.0 17 7.0 18 9.0 19 7.0 20 15.0 21 16.0 22 16.0 23 21.0 24 27.0 25 39.0 26 46.0 27 56.0 28 56.0 29 61.0 30 97.0 31 135.0 32 155.0 33 187.0 34 288.0 35 474.0 36 898.0 37 1319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.83445861465366 17.879469867466867 12.928232058014505 31.357839459864966 2 28.95 23.525 24.025 23.5 3 23.849999999999998 26.474999999999998 27.05 22.625 4 26.200000000000003 30.7 18.0 25.1 5 28.875 31.574999999999996 17.9 21.65 6 24.7 35.449999999999996 19.3 20.549999999999997 7 23.45 18.95 33.4 24.2 8 24.25 23.549999999999997 22.95 29.25 9 24.474999999999998 23.3 26.5 25.724999999999998 10-14 26.155 25.505 22.395 25.945 15-19 26.064999999999998 24.995 23.755000000000003 25.185000000000002 20-24 26.155 25.014999999999997 23.225 25.605 25-29 26.724999999999998 25.405 22.439999999999998 25.430000000000003 30-34 26.295 25.259999999999998 23.105 25.34 35-39 25.779999999999998 25.380000000000003 23.28 25.56 40-44 26.185000000000002 25.155 23.365 25.295 45-49 26.805 24.355 23.66 25.180000000000003 50-54 26.775 24.705 23.155 25.365 55-59 26.450000000000003 24.695 23.47 25.385 60-64 26.775 24.884999999999998 23.995 24.345 65-69 26.155 24.825 23.985 25.035 70-74 26.529999999999998 24.224999999999998 24.315 24.93 75-79 26.33 24.905 23.91 24.855 80-84 26.515 24.285 24.44 24.759999999999998 85-89 26.39 24.91 23.665 25.035 90-94 25.95 25.235000000000003 23.84 24.975 95-99 26.384999999999998 24.495 23.94 25.180000000000003 100-104 26.205000000000002 25.019999999999996 23.86 24.915000000000003 105-109 26.555 25.074999999999996 23.585 24.785 110-114 26.735 25.4 23.86 24.005000000000003 115-119 27.235 24.45 24.205 24.11 120-124 26.855 24.83 23.93 24.385 125-129 27.265 25.580000000000002 23.294999999999998 23.86 130-134 27.485 25.71 22.97 23.835 135-139 26.955000000000002 25.5 23.76 23.785 140-144 27.98 25.655 23.035 23.330000000000002 145-149 28.29 25.255 23.380000000000003 23.075000000000003 150-151 28.299999999999997 25.0125 22.8625 23.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 3.0 27 3.5 28 2.0 29 2.0 30 2.5 31 2.5 32 3.5 33 8.0 34 16.0 35 21.0 36 30.0 37 48.5 38 56.5 39 68.0 40 101.5 41 123.0 42 133.5 43 157.0 44 171.5 45 174.5 46 181.0 47 192.0 48 184.0 49 163.5 50 150.0 51 160.0 52 154.5 53 116.0 54 106.0 55 110.0 56 102.5 57 93.5 58 90.5 59 90.5 60 95.0 61 92.5 62 84.0 63 91.5 64 88.0 65 69.5 66 65.0 67 68.5 68 64.5 69 46.0 70 43.5 71 43.0 72 30.0 73 27.0 74 22.5 75 15.5 76 10.0 77 7.5 78 4.5 79 1.0 80 0.5 81 0.5 82 1.0 83 0.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26786165109822 98.3 2 0.6059075990911386 1.2 3 0.025246149962130777 0.075 4 0.07573844988639232 0.3 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.7125000000000004 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.7 0.0 0.0 0.0 0.0 134-135 5.2375 0.0 0.0 0.0 0.0 136-137 5.75 0.0 0.0 0.0 0.0 138-139 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAT 10 0.006830828 145.0 145 >>END_MODULE Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159800 spots for SRR6958457.sra Written 1159800 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra Read 1159789 spots for SRR6958457.sra Written 1159789 spots for SRR6958457.sra SRR ids: ['SRR6958457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_euu4xtvo SRR6958457.sra spots: 23195791 blocks: [[1, 1159789], [1159790, 2319578], [2319579, 3479367], [3479368, 4639156], [4639157, 5798945], [5798946, 6958734], [6958735, 8118523], [8118524, 9278312], [9278313, 10438101], [10438102, 11597890], [11597891, 12757679], [12757680, 13917468], [13917469, 15077257], [15077258, 16237046], [16237047, 17396835], [17396836, 18556624], [18556625, 19716413], [19716414, 20876202], [20876203, 22035991], [22035992, 23195791]] SRR6958457 file size 7838592 SRR6958457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958457 SRR6958457_1.fastq SRR6958457_2.fastq Input file: SRR6958457_1.fastq Paired file: SRR6958457_2.fastq trimmed: SRR6958457-trimmed-pair1.fastq, SRR6958457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:35:21 2024 >> started Fri Dec 6 23:36:03 2024 >> done (42.176s) 23195791 read pairs processed; of these: 54660 ( 0.24%) short read pairs filtered out after trimming by size control 46523 ( 0.20%) empty read pairs filtered out after trimming by size control 23094608 (99.56%) read pairs available; of these: 11134060 (48.21%) trimmed read pairs available after processing 11960548 (51.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 10 0.00% 26 6 0.00% 27 7 0.00% 28 7 0.00% 29 11 0.00% 30 8 0.00% 31 8 0.00% 32 6 0.00% 33 14 0.00% 34 9 0.00% 35 2 0.00% 36 15 0.00% 37 10 0.00% 38 12 0.00% 39 18 0.00% 40 20 0.00% 41 20 0.00% 42 28 0.00% 43 27 0.00% 44 30 0.00% 45 34 0.00% 46 41 0.00% 47 41 0.00% 48 37 0.00% 49 45 0.00% 50 65 0.00% 51 57 0.00% 52 64 0.00% 53 67 0.00% 54 76 0.00% 55 117 0.00% 56 103 0.00% 57 101 0.00% 58 138 0.00% 59 130 0.00% 60 152 0.00% 61 162 0.00% 62 202 0.00% 63 197 0.00% 64 258 0.00% 65 248 0.00% 66 326 0.00% 67 356 0.00% 68 389 0.00% 69 467 0.00% 70 551 0.00% 71 575 0.00% 72 750 0.00% 73 776 0.00% 74 882 0.00% 75 1030 0.00% 76 1150 0.00% 77 1182 0.01% 78 1340 0.01% 79 1614 0.01% 80 1788 0.01% 81 2022 0.01% 82 2461 0.01% 83 2885 0.01% 84 4907 0.02% 85 6328 0.03% 86 6468 0.03% 87 6644 0.03% 88 7001 0.03% 89 7262 0.03% 90 7597 0.03% 91 7926 0.03% 92 8401 0.04% 93 9163 0.04% 94 9843 0.04% 95 10435 0.05% 96 11168 0.05% 97 11891 0.05% 98 12361 0.05% 99 12970 0.06% 100 14440 0.06% 101 15415 0.07% 102 16578 0.07% 103 17802 0.08% 104 19107 0.08% 105 19824 0.09% 106 21447 0.09% 107 22620 0.10% 108 23577 0.10% 109 25261 0.11% 110 26392 0.11% 111 27984 0.12% 112 29292 0.13% 113 30902 0.13% 114 33249 0.14% 115 35345 0.15% 116 37050 0.16% 117 38738 0.17% 118 40462 0.18% 119 41889 0.18% 120 43307 0.19% 121 45432 0.20% 122 47699 0.21% 123 50612 0.22% 124 53067 0.23% 125 56042 0.24% 126 58600 0.25% 127 60808 0.26% 128 63907 0.28% 129 65834 0.29% 130 69184 0.30% 131 71831 0.31% 132 76518 0.33% 133 80948 0.35% 134 84689 0.37% 135 90257 0.39% 136 94393 0.41% 137 99181 0.43% 138 104032 0.45% 139 111594 0.48% 140 119344 0.52% 141 130090 0.56% 142 143803 0.62% 143 160830 0.70% 144 186493 0.81% 145 221077 0.96% 146 273324 1.18% 147 367235 1.59% 148 557670 2.41% 149 1118578 4.84% 150 5726775 24.80% 151 11960548 51.79% 23094608 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=20 prefix-density=0.79 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=32.99 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=19 prefix-density=0.52 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=107.17 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=4.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958457 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:36:43 Started mapping on | Dec 06 23:36:43 Finished on | Dec 06 23:38:35 Mapping speed, Million of reads per hour | 742.33 Number of input reads | 23094608 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22499310 Uniquely mapped reads % | 97.42% Average mapped length | 294.88 Number of splices: Total | 24933557 Number of splices: Annotated (sjdb) | 23462863 Number of splices: GT/AG | 24613059 Number of splices: GC/AG | 292142 Number of splices: AT/AC | 9490 Number of splices: Non-canonical | 18866 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 145276 % of reads mapped to multiple loci | 0.63% Number of reads mapped to too many loci | 15260 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.49% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 478457 478457 478457 N_multimapping 145276 145276 145276 N_noFeature 567740 21883350 727189 N_ambiguous 538179 2848 82728 UnstrandedReadsAssigned:21393391 PositiveStrandReadsAssigned:613112 NegativeStrandReadsAssigned:21689393 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958457-trimmed-pair1.fastq SRR6958457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,094,608 reads, 21,716,027 reads pseudoaligned [quant] estimated average fragment length: 244.418 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,289 rounds 52973 SRR6958457.ke.tsv 35125 SRR6958457.se.tsv 88098 total ==> SRR6958457.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.899 0 0 PNS24247 1044 800.582 68.3468 5.61046 PNS24249 1928 1684.58 49.0863 1.91493 PNS24246 1044 800.582 68.3468 5.61046 PNS24248 1044 800.582 68.3468 5.61046 PNS24244 1471 1227.58 46.8733 2.50934 PNS24243 293 91.2795 0 0 KQK14069 1603 1359.58 4923.72 237.998 KQK14071 474 240.065 88.0744 24.1105 ==> SRR6958457.se.tsv <== BRADI_1g14170v3 5412 BRADI_1g53295v3 222 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 345 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 301 BRADI_1g48960v3 0 SRR6958457 completed mapping pipeline successfully