Starting /dee2/code/volunteer_pipeline.sh SRR6958459 current disk space = 1547473088512 free memory = 1603331864 SRR6958459 SRAfilesize ff2b41b75d382dc96c407d47b10d7722 SRR6958459.sra SRR6958459.sra file validated SRR6958459 is paired end SRR6958459 is conventional basespace SRR6958459 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.0945 18.0 18.0 30.0 18.0 32.0 2 23.01525 25.0 18.0 27.0 18.0 31.0 3 29.0895 29.0 27.0 31.0 27.0 33.0 4 30.756 32.0 32.0 33.0 27.0 33.0 5 30.50975 32.0 31.0 33.0 25.0 33.0 6 34.814 37.0 34.0 38.0 29.0 38.0 7 36.42575 38.0 36.0 38.0 34.0 38.0 8 37.186 38.0 38.0 38.0 36.0 38.0 9 37.43575 38.0 38.0 38.0 37.0 38.0 10-14 37.425200000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.52955 38.0 38.0 38.0 37.6 38.0 20-24 37.483 38.0 38.0 38.0 37.6 38.0 25-29 37.2217 38.0 38.0 38.0 36.8 38.0 30-34 37.3298 38.0 38.0 38.0 37.2 38.0 35-39 37.60039999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.57215 38.0 38.0 38.0 38.0 38.0 45-49 37.4852 38.0 38.0 38.0 38.0 38.0 50-54 37.432249999999996 38.0 38.0 38.0 37.4 38.0 55-59 37.400549999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.452549999999995 38.0 38.0 38.0 37.2 38.0 65-69 37.47735 38.0 38.0 38.0 37.2 38.0 70-74 37.4707 38.0 38.0 38.0 37.4 38.0 75-79 36.193650000000005 38.0 36.6 38.0 31.0 38.0 80-84 37.167 38.0 38.0 38.0 36.6 38.0 85-89 36.97065 38.0 38.0 38.0 35.6 38.0 90-94 36.794050000000006 38.0 38.0 38.0 35.2 38.0 95-99 36.453050000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.4418 38.0 38.0 38.0 34.0 38.0 105-109 36.372899999999994 38.0 38.0 38.0 33.8 38.0 110-114 36.234750000000005 38.0 38.0 38.0 33.6 38.0 115-119 36.527950000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.718849999999996 38.0 38.0 38.0 34.8 38.0 125-129 36.74075 38.0 38.0 38.0 34.8 38.0 130-134 36.51345 38.0 38.0 38.0 34.0 38.0 135-139 35.93105 38.0 36.8 38.0 32.4 38.0 140-144 35.83805 38.0 36.8 38.0 32.0 38.0 145-149 33.908899999999996 38.0 33.6 38.0 24.0 38.0 150-151 29.93475 35.5 27.5 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 3.0 24 3.0 25 6.0 26 11.0 27 12.0 28 18.0 29 29.0 30 34.0 31 74.0 32 72.0 33 95.0 34 148.0 35 296.0 36 848.0 37 2345.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.67084127416281 16.60767764769943 7.296487884563027 43.424993193574736 2 21.5 15.225 32.175 31.1 3 21.224999999999998 16.625 23.775 38.375 4 26.525 23.375 19.950000000000003 30.15 5 25.3 29.975 22.75 21.975 6 22.025 31.85 24.6 21.525 7 17.974999999999998 24.224999999999998 38.875 18.925 8 20.025000000000002 24.675 28.475 26.825 9 18.75 21.8 34.300000000000004 25.15 10-14 22.400000000000002 26.83 25.929999999999996 24.84 15-19 22.515 25.624999999999996 26.32 25.540000000000003 20-24 22.505 25.995 25.83 25.669999999999998 25-29 22.735 25.735000000000003 26.229999999999997 25.3 30-34 22.8 25.319999999999997 26.495 25.385 35-39 22.49 26.69 25.8 25.019999999999996 40-44 23.27 25.185000000000002 26.195 25.35 45-49 22.775000000000002 26.224999999999998 25.47 25.53 50-54 22.875 25.285000000000004 26.284999999999997 25.555 55-59 22.98 25.71 26.035000000000004 25.275 60-64 22.705000000000002 25.775 26.19 25.330000000000002 65-69 23.02 25.22 25.91 25.85 70-74 23.25 25.16 26.224999999999998 25.365 75-79 22.75 25.4 26.479999999999997 25.369999999999997 80-84 22.615 25.585 26.16 25.64 85-89 22.645 25.5 26.27 25.585 90-94 23.44 25.25 26.334999999999997 24.975 95-99 22.805 25.569999999999997 26.040000000000003 25.585 100-104 23.215 25.575 26.06 25.15 105-109 23.345 25.419999999999998 25.629999999999995 25.605 110-114 23.03 25.174999999999997 26.325 25.47 115-119 23.06 25.365 25.89 25.685000000000002 120-124 23.395 25.480000000000004 25.509999999999998 25.615 125-129 23.155 25.130000000000003 25.945 25.77 130-134 23.525 25.235000000000003 25.755 25.485000000000003 135-139 23.365 25.119999999999997 25.83 25.685000000000002 140-144 23.255 25.515 25.525 25.705 145-149 23.474999999999998 25.009999999999998 25.705 25.81 150-151 23.8875 24.9375 25.662499999999998 25.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.0 27 1.5 28 5.0 29 6.5 30 7.5 31 11.0 32 15.5 33 20.0 34 27.0 35 35.5 36 51.5 37 70.0 38 96.0 39 109.5 40 120.0 41 162.5 42 185.0 43 200.5 44 218.0 45 216.5 46 217.0 47 205.0 48 196.0 49 191.5 50 173.5 51 158.5 52 137.5 53 113.0 54 99.0 55 87.0 56 87.5 57 86.0 58 65.0 59 59.5 60 65.5 61 66.5 62 66.5 63 62.5 64 52.5 65 45.0 66 40.5 67 34.5 68 28.5 69 21.0 70 15.5 71 16.0 72 16.0 73 12.0 74 8.0 75 3.5 76 2.5 77 2.0 78 1.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.6 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.425000000000001 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAGGA 10 0.0068396386 144.9375 8 GGTACCA 10 0.0068396386 144.9375 4 TGATGTA 10 0.0068396386 144.9375 4 >>END_MODULE SRR6958459 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06375 33.0 33.0 34.0 32.0 34.0 2 33.1515 34.0 33.0 34.0 33.0 34.0 3 33.249 34.0 33.0 34.0 33.0 34.0 4 33.23225 34.0 33.0 34.0 33.0 34.0 5 33.27875 34.0 33.0 34.0 33.0 34.0 6 37.4245 38.0 38.0 38.0 38.0 38.0 7 37.324 38.0 38.0 38.0 37.0 38.0 8 37.36525 38.0 38.0 38.0 38.0 38.0 9 37.41575 38.0 38.0 38.0 37.0 38.0 10-14 37.283550000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.2279 38.0 38.0 38.0 37.0 38.0 20-24 37.178250000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.2803 38.0 38.0 38.0 37.0 38.0 30-34 37.4481 38.0 38.0 38.0 38.0 38.0 35-39 37.4982 38.0 38.0 38.0 38.0 38.0 40-44 37.473200000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.369299999999996 38.0 38.0 38.0 37.4 38.0 50-54 37.159349999999996 38.0 38.0 38.0 36.6 38.0 55-59 37.21625 38.0 38.0 38.0 37.0 38.0 60-64 37.17085 38.0 38.0 38.0 37.0 38.0 65-69 37.11455 38.0 38.0 38.0 36.8 38.0 70-74 37.097699999999996 38.0 38.0 38.0 36.6 38.0 75-79 36.9022 38.0 38.0 38.0 35.6 38.0 80-84 36.6862 38.0 38.0 38.0 34.8 38.0 85-89 36.38885 38.0 38.0 38.0 34.0 38.0 90-94 36.7648 38.0 38.0 38.0 35.4 38.0 95-99 36.907599999999995 38.0 38.0 38.0 35.6 38.0 100-104 36.86925 38.0 38.0 38.0 35.2 38.0 105-109 36.8281 38.0 38.0 38.0 35.0 38.0 110-114 36.67045 38.0 38.0 38.0 34.8 38.0 115-119 34.76115 38.0 34.4 38.0 27.4 38.0 120-124 33.39905 37.6 31.6 38.0 21.4 38.0 125-129 34.9954 38.0 35.6 38.0 27.4 38.0 130-134 33.69575 37.8 32.8 38.0 21.2 38.0 135-139 30.3812 34.2 25.4 38.0 16.6 38.0 140-144 34.683350000000004 38.0 35.4 38.0 28.6 38.0 145-149 33.7873 38.0 35.0 38.0 23.6 38.0 150-151 28.01775 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 2.0 20 2.0 21 2.0 22 7.0 23 7.0 24 15.0 25 11.0 26 24.0 27 23.0 28 20.0 29 24.0 30 48.0 31 55.0 32 84.0 33 113.0 34 215.0 35 365.0 36 936.0 37 2029.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.5 18.175 11.0 32.324999999999996 2 28.825 22.975 27.750000000000004 20.45 3 20.875 27.725 27.025 24.375 4 25.900000000000002 30.5 21.05 22.55 5 27.125 34.5 19.725 18.65 6 22.85 35.65 21.25 20.25 7 23.200000000000003 20.175 33.725 22.900000000000002 8 22.475 24.575 24.6 28.349999999999998 9 22.900000000000002 23.150000000000002 27.950000000000003 26.0 10-14 25.490000000000002 26.57 23.75 24.19 15-19 25.4 25.990000000000002 24.8 23.810000000000002 20-24 25.424999999999997 26.41 24.54 23.625 25-29 25.61 26.119999999999997 25.069999999999997 23.200000000000003 30-34 25.230000000000004 26.325 24.560000000000002 23.885 35-39 25.564999999999998 25.46 24.91 24.065 40-44 25.955000000000002 26.115 23.535 24.395 45-49 25.285000000000004 25.525 25.674999999999997 23.515 50-54 25.86 26.11 24.685000000000002 23.345 55-59 26.125 25.295 24.685000000000002 23.895 60-64 25.805 25.81 25.055 23.330000000000002 65-69 25.71 26.105 25.05 23.135 70-74 25.4 25.869999999999997 24.915000000000003 23.815 75-79 25.259999999999998 25.77 25.1 23.87 80-84 25.064999999999998 26.490000000000002 25.085 23.36 85-89 25.595000000000002 25.755 24.625 24.025 90-94 26.169999999999998 25.305 24.97 23.555 95-99 25.605 26.955000000000002 24.27 23.169999999999998 100-104 26.075 26.040000000000003 24.83 23.055 105-109 25.455 26.185000000000002 25.264999999999997 23.095 110-114 25.805 26.255 24.759999999999998 23.18 115-119 26.035000000000004 26.275 25.119999999999997 22.57 120-124 26.025 25.71 25.230000000000004 23.035 125-129 26.045 26.31 24.740000000000002 22.905 130-134 26.669999999999998 27.015 24.115000000000002 22.2 135-139 26.76 25.745 25.080000000000002 22.415 140-144 26.83 26.575 24.66 21.935 145-149 27.139999999999997 26.474999999999998 24.825 21.560000000000002 150-151 27.325 25.45 25.7125 21.512500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 0.5 27 1.5 28 4.5 29 7.5 30 8.0 31 8.5 32 12.5 33 18.5 34 23.0 35 26.5 36 33.0 37 51.0 38 81.0 39 104.5 40 129.5 41 159.5 42 171.0 43 187.0 44 192.5 45 198.5 46 210.5 47 204.0 48 198.0 49 200.5 50 179.5 51 142.5 52 124.5 53 105.0 54 99.0 55 100.0 56 88.0 57 89.0 58 93.0 59 88.5 60 76.5 61 64.0 62 65.5 63 64.0 64 60.0 65 56.0 66 50.0 67 48.0 68 42.0 69 34.0 70 31.0 71 24.0 72 14.0 73 8.5 74 6.5 75 3.0 76 2.5 77 2.5 78 2.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65379730759462 97.1 2 1.1684023368046736 2.3 3 0.12700025400050802 0.375 4 0.025400050800101596 0.1 5 0.025400050800101596 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.9 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 5.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATCT 10 0.006830828 145.0 3 GTGCGTT 10 0.006830828 145.0 9 >>END_MODULE Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930873 spots for SRR6958459.sra Written 930873 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra Read 930860 spots for SRR6958459.sra Written 930860 spots for SRR6958459.sra SRR ids: ['SRR6958459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yr4w5t5a SRR6958459.sra spots: 18617213 blocks: [[1, 930860], [930861, 1861720], [1861721, 2792580], [2792581, 3723440], [3723441, 4654300], [4654301, 5585160], [5585161, 6516020], [6516021, 7446880], [7446881, 8377740], [8377741, 9308600], [9308601, 10239460], [10239461, 11170320], [11170321, 12101180], [12101181, 13032040], [13032041, 13962900], [13962901, 14893760], [14893761, 15824620], [15824621, 16755480], [16755481, 17686340], [17686341, 18617213]] SRR6958459 file size 6287062 SRR6958459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958459 SRR6958459_1.fastq SRR6958459_2.fastq Input file: SRR6958459_1.fastq Paired file: SRR6958459_2.fastq trimmed: SRR6958459-trimmed-pair1.fastq, SRR6958459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:38:06 2024 >> started Fri Dec 6 23:38:24 2024 >> done (18.254s) 18617213 read pairs processed; of these: 9547 ( 0.05%) short read pairs filtered out after trimming by size control 9066 ( 0.05%) empty read pairs filtered out after trimming by size control 18598600 (99.90%) read pairs available; of these: 6355435 (34.17%) trimmed read pairs available after processing 12243165 (65.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 9 0.00% 24 6 0.00% 25 3 0.00% 26 3 0.00% 27 8 0.00% 28 8 0.00% 29 8 0.00% 30 5 0.00% 31 7 0.00% 32 9 0.00% 33 6 0.00% 34 11 0.00% 35 7 0.00% 36 10 0.00% 37 6 0.00% 38 11 0.00% 39 5 0.00% 40 14 0.00% 41 12 0.00% 42 11 0.00% 43 16 0.00% 44 18 0.00% 45 24 0.00% 46 24 0.00% 47 28 0.00% 48 26 0.00% 49 32 0.00% 50 36 0.00% 51 39 0.00% 52 49 0.00% 53 49 0.00% 54 39 0.00% 55 76 0.00% 56 65 0.00% 57 90 0.00% 58 94 0.00% 59 115 0.00% 60 135 0.00% 61 163 0.00% 62 175 0.00% 63 196 0.00% 64 249 0.00% 65 258 0.00% 66 319 0.00% 67 338 0.00% 68 389 0.00% 69 437 0.00% 70 549 0.00% 71 597 0.00% 72 751 0.00% 73 843 0.00% 74 944 0.01% 75 1065 0.01% 76 1151 0.01% 77 1378 0.01% 78 1558 0.01% 79 1735 0.01% 80 1861 0.01% 81 2167 0.01% 82 2573 0.01% 83 2956 0.02% 84 3560 0.02% 85 4226 0.02% 86 4488 0.02% 87 4800 0.03% 88 5231 0.03% 89 5582 0.03% 90 5968 0.03% 91 6566 0.04% 92 7139 0.04% 93 7914 0.04% 94 8311 0.04% 95 9227 0.05% 96 9619 0.05% 97 10180 0.05% 98 10906 0.06% 99 11355 0.06% 100 12310 0.07% 101 13167 0.07% 102 13776 0.07% 103 14934 0.08% 104 15888 0.09% 105 16634 0.09% 106 17596 0.09% 107 18306 0.10% 108 19156 0.10% 109 20001 0.11% 110 20716 0.11% 111 21863 0.12% 112 23018 0.12% 113 23895 0.13% 114 25141 0.14% 115 27213 0.15% 116 27902 0.15% 117 28616 0.15% 118 29562 0.16% 119 30223 0.16% 120 31389 0.17% 121 32188 0.17% 122 33190 0.18% 123 35189 0.19% 124 36660 0.20% 125 38533 0.21% 126 39704 0.21% 127 41100 0.22% 128 42070 0.23% 129 43751 0.24% 130 44979 0.24% 131 46037 0.25% 132 48223 0.26% 133 50545 0.27% 134 51778 0.28% 135 53963 0.29% 136 56979 0.31% 137 58241 0.31% 138 61108 0.33% 139 63992 0.34% 140 67282 0.36% 141 71195 0.38% 142 76993 0.41% 143 83433 0.45% 144 91642 0.49% 145 104624 0.56% 146 121801 0.65% 147 154767 0.83% 148 221666 1.19% 149 435425 2.34% 150 3458221 18.59% 151 12243165 65.83% 18598600 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=23 prefix-density=0.82 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=27.06 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=26.38 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958459 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:39:11 Started mapping on | Dec 06 23:39:11 Finished on | Dec 06 23:40:39 Mapping speed, Million of reads per hour | 760.85 Number of input reads | 18598600 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18146122 Uniquely mapped reads % | 97.57% Average mapped length | 295.77 Number of splices: Total | 21105245 Number of splices: Annotated (sjdb) | 19829496 Number of splices: GT/AG | 20826701 Number of splices: GC/AG | 246280 Number of splices: AT/AC | 7792 Number of splices: Non-canonical | 24472 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161365 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 17518 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297028 297028 297028 N_multimapping 161365 161365 161365 N_noFeature 673565 17589541 847798 N_ambiguous 458586 2701 77856 UnstrandedReadsAssigned:17013971 PositiveStrandReadsAssigned:553880 NegativeStrandReadsAssigned:17220468 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958459-trimmed-pair1.fastq SRR6958459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,598,600 reads, 17,232,225 reads pseudoaligned [quant] estimated average fragment length: 256.666 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR6958459.ke.tsv 35125 SRR6958459.se.tsv 88098 total ==> SRR6958459.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.912 0 0 PNS24247 1044 788.334 61.4814 6.87718 PNS24249 1928 1672.33 23.5521 1.24189 PNS24246 1044 788.334 61.4814 6.87718 PNS24248 1044 788.334 61.4814 6.87718 PNS24244 1471 1215.33 45.0037 3.26534 PNS24243 293 91.3361 0 0 KQK14069 1603 1347.33 3886.1 254.34 KQK14071 474 234.214 53.8243 20.2648 ==> SRR6958459.se.tsv <== BRADI_1g14170v3 4428 BRADI_1g53295v3 390 BRADI_1g59795v3 248 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 241 BRADI_1g74790v3 87 BRADI_1g09890v3 0 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR6958459 completed mapping pipeline successfully