Starting /dee2/code/volunteer_pipeline.sh SRR6958460 current disk space = 1547515359232 free memory = 1601257464 SRR6958460 SRAfilesize 65e4793a7271f113e7f14c2c0c69e78f SRR6958460.sra SRR6958460.sra file validated SRR6958460 is paired end SRR6958460 is conventional basespace SRR6958460 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0585 32.0 18.0 33.0 18.0 33.0 2 26.39275 27.0 18.0 31.0 18.0 33.0 3 30.0465 31.0 29.0 33.0 27.0 33.0 4 31.747 33.0 31.0 33.0 29.0 33.0 5 32.48025 33.0 33.0 33.0 32.0 33.0 6 36.68525 38.0 37.0 38.0 35.0 38.0 7 37.25025 38.0 38.0 38.0 36.0 38.0 8 37.5385 38.0 38.0 38.0 37.0 38.0 9 37.626 38.0 38.0 38.0 38.0 38.0 10-14 37.6299 38.0 38.0 38.0 38.0 38.0 15-19 37.60205 38.0 38.0 38.0 38.0 38.0 20-24 37.4836 38.0 38.0 38.0 37.4 38.0 25-29 37.60695 38.0 38.0 38.0 38.0 38.0 30-34 37.53439999999999 38.0 38.0 38.0 37.6 38.0 35-39 37.611900000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.6029 38.0 38.0 38.0 38.0 38.0 45-49 37.561449999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.430299999999995 38.0 38.0 38.0 37.4 38.0 55-59 37.36625 38.0 38.0 38.0 37.0 38.0 60-64 37.3968 38.0 38.0 38.0 37.0 38.0 65-69 37.3439 38.0 38.0 38.0 37.0 38.0 70-74 37.22855 38.0 38.0 38.0 36.0 38.0 75-79 36.9274 38.0 38.0 38.0 35.6 38.0 80-84 35.8827 38.0 36.4 38.0 29.8 38.0 85-89 37.023900000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.94115 38.0 38.0 38.0 35.0 38.0 95-99 36.77965 38.0 38.0 38.0 34.6 38.0 100-104 36.56825 38.0 38.0 38.0 34.0 38.0 105-109 36.6074 38.0 38.0 38.0 34.4 38.0 110-114 36.422999999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.13244999999999 38.0 37.2 38.0 33.6 38.0 120-124 35.9495 38.0 37.0 38.0 32.8 38.0 125-129 35.78365 38.0 36.2 38.0 32.0 38.0 130-134 35.51915 38.0 36.0 38.0 31.0 38.0 135-139 35.42530000000001 38.0 36.0 38.0 31.0 38.0 140-144 34.953500000000005 38.0 35.2 38.0 29.4 38.0 145-149 34.37874999999999 38.0 34.8 38.0 27.2 38.0 150-151 29.898874999999997 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 0.0 23 4.0 24 7.0 25 7.0 26 7.0 27 14.0 28 15.0 29 20.0 30 34.0 31 54.0 32 61.0 33 109.0 34 173.0 35 326.0 36 873.0 37 2286.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.08609958506224 9.387966804979254 7.2354771784232375 30.29045643153527 2 26.450000000000003 11.799999999999999 34.300000000000004 27.450000000000003 3 21.425 16.875 26.474999999999998 35.225 4 26.625 25.974999999999998 22.0 25.4 5 25.025 30.025000000000002 23.5 21.45 6 20.25 34.25 23.925 21.575 7 16.825000000000003 24.224999999999998 41.175 17.775 8 20.175 22.575 30.625000000000004 26.625 9 19.475 22.125 34.275 24.125 10-14 23.01 27.01 26.095000000000002 23.885 15-19 22.39 25.729999999999997 26.865 25.014999999999997 20-24 22.84 26.075 26.755000000000003 24.33 25-29 22.435 26.045 27.12 24.4 30-34 22.509999999999998 26.155 26.625 24.709999999999997 35-39 22.759999999999998 26.384999999999998 26.224999999999998 24.63 40-44 23.135 26.25 25.965 24.65 45-49 22.75 25.724999999999998 26.55 24.975 50-54 22.720000000000002 25.605 26.540000000000003 25.135 55-59 23.13 25.855 26.185000000000002 24.83 60-64 22.84 25.775 26.575 24.81 65-69 22.645 25.845000000000002 26.474999999999998 25.035 70-74 23.35 25.435000000000002 26.205000000000002 25.009999999999998 75-79 22.86 25.41 26.6 25.130000000000003 80-84 22.57 25.955000000000002 26.405 25.069999999999997 85-89 23.189999999999998 25.115 26.369999999999997 25.324999999999996 90-94 23.195 25.805 26.229999999999997 24.77 95-99 23.055 25.535000000000004 26.865 24.545 100-104 22.635658914728683 25.891472868217054 26.87671917979495 24.596149037259316 105-109 23.565 25.395 26.700000000000003 24.34 110-114 23.5 25.945 26.540000000000003 24.015 115-119 23.32 26.055 25.94 24.685000000000002 120-124 22.88 25.759999999999998 26.005 25.355 125-129 23.189999999999998 26.14 26.245 24.425 130-134 22.625 26.455000000000002 25.924999999999997 24.995 135-139 23.080000000000002 26.245 25.52 25.155 140-144 23.45 26.095000000000002 25.34 25.115 145-149 22.915 26.44 25.374999999999996 25.27 150-151 22.7 26.4125 25.424999999999997 25.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 3.0 28 4.5 29 5.5 30 8.0 31 13.5 32 18.0 33 25.0 34 37.0 35 44.5 36 55.5 37 61.0 38 75.0 39 111.5 40 141.0 41 165.5 42 182.0 43 215.5 44 231.0 45 211.0 46 222.0 47 226.5 48 210.5 49 182.5 50 170.5 51 162.0 52 124.5 53 116.0 54 118.5 55 96.5 56 83.5 57 78.0 58 73.5 59 68.0 60 67.0 61 63.0 62 46.5 63 44.5 64 44.0 65 40.0 66 32.5 67 22.0 68 19.0 69 14.5 70 12.0 71 12.0 72 10.5 73 9.5 74 7.5 75 5.0 76 3.0 77 2.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21855306276784 98.4 2 0.7310310057978321 1.4500000000000002 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.7374999999999998 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.675 0.0 0.0 0.0 0.0 130-131 5.262499999999999 0.0 0.0 0.0 0.0 132-133 5.925000000000001 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 7.0125 0.0 0.0 0.0 0.0 138-139 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958460 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.192 33.0 33.0 34.0 33.0 34.0 2 33.274 34.0 33.0 34.0 33.0 34.0 3 33.27325 34.0 33.0 34.0 33.0 34.0 4 33.239 34.0 33.0 34.0 33.0 34.0 5 33.3005 34.0 33.0 34.0 33.0 34.0 6 37.503 38.0 38.0 38.0 38.0 38.0 7 37.50275 38.0 38.0 38.0 38.0 38.0 8 37.464 38.0 38.0 38.0 38.0 38.0 9 37.515 38.0 38.0 38.0 38.0 38.0 10-14 37.489399999999996 38.0 38.0 38.0 38.0 38.0 15-19 36.209399999999995 38.0 36.6 38.0 31.4 38.0 20-24 36.130449999999996 38.0 36.6 38.0 30.0 38.0 25-29 37.3285 38.0 38.0 38.0 37.2 38.0 30-34 37.45335 38.0 38.0 38.0 38.0 38.0 35-39 37.40025000000001 38.0 38.0 38.0 37.8 38.0 40-44 37.4204 38.0 38.0 38.0 37.8 38.0 45-49 37.4188 38.0 38.0 38.0 38.0 38.0 50-54 37.214099999999995 38.0 38.0 38.0 37.2 38.0 55-59 37.2521 38.0 38.0 38.0 37.6 38.0 60-64 37.2482 38.0 38.0 38.0 37.4 38.0 65-69 37.165949999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.13775 38.0 38.0 38.0 37.0 38.0 75-79 37.0873 38.0 38.0 38.0 37.0 38.0 80-84 36.9938 38.0 38.0 38.0 36.4 38.0 85-89 36.98085 38.0 38.0 38.0 36.6 38.0 90-94 35.64675 38.0 36.0 38.0 29.8 38.0 95-99 33.98535 37.6 32.6 38.0 23.0 38.0 100-104 34.3207 37.8 33.2 38.0 25.6 38.0 105-109 36.471450000000004 38.0 38.0 38.0 34.4 38.0 110-114 36.24465 38.0 37.8 38.0 33.4 38.0 115-119 35.5355 38.0 36.8 38.0 28.4 38.0 120-124 35.538349999999994 38.0 36.8 38.0 30.0 38.0 125-129 35.5768 38.0 36.4 38.0 31.0 38.0 130-134 33.664550000000006 37.6 31.4 38.0 24.6 38.0 135-139 34.0919 38.0 34.2 38.0 24.2 38.0 140-144 33.8976 38.0 34.2 38.0 22.4 38.0 145-149 34.0058 38.0 34.8 38.0 25.0 38.0 150-151 29.3725 35.5 18.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 3.0 11 2.0 12 1.0 13 8.0 14 0.0 15 4.0 16 3.0 17 1.0 18 1.0 19 4.0 20 5.0 21 2.0 22 5.0 23 4.0 24 11.0 25 11.0 26 19.0 27 14.0 28 14.0 29 29.0 30 39.0 31 56.0 32 81.0 33 95.0 34 168.0 35 354.0 36 1136.0 37 1922.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.55 21.725 9.950000000000001 26.775 2 31.075000000000003 22.875 26.724999999999998 19.325 3 22.400000000000002 26.5 28.749999999999996 22.35 4 24.525 33.225 21.2 21.05 5 26.424999999999997 34.225 20.075000000000003 19.275000000000002 6 22.5 37.4 19.925 20.175 7 21.475 20.075000000000003 36.525 21.925 8 22.8 23.474999999999998 26.125 27.6 9 23.9 23.075000000000003 27.6 25.424999999999997 10-14 24.779999999999998 27.005000000000003 24.265 23.95 15-19 24.560000000000002 26.529999999999998 25.385 23.525 20-24 25.03 26.179999999999996 25.259999999999998 23.53 25-29 25.169999999999998 26.61 24.895 23.325000000000003 30-34 25.369999999999997 26.02 25.374999999999996 23.235 35-39 24.58 26.740000000000002 24.8 23.880000000000003 40-44 24.68 26.69 25.71 22.919999999999998 45-49 25.045 26.05 25.44 23.465 50-54 25.053801111055503 25.959661678594664 25.534257544667433 23.4522796656824 55-59 25.17398487958744 25.664647273819657 25.5695188504481 23.591848996144797 60-64 24.51063829787234 26.663329161451816 25.23654568210263 23.589486858573217 65-69 25.39674593241552 26.242803504380475 24.991239048811014 23.36921151439299 70-74 25.027535796535496 26.033843997196353 25.56823871032342 23.370381495944727 75-79 25.409302558453913 26.385620587793525 24.95368747809543 23.251389375657137 80-84 25.710277095755874 26.22638673147267 25.44470611815403 22.618630054617427 85-89 25.140252454417954 26.993588459226608 24.72951312362252 23.136645962732917 90-94 25.151439299123908 26.57321652065081 25.266583229036293 23.008760951188986 95-99 24.710888610763455 26.53817271589487 25.632040050062578 23.1188986232791 100-104 24.93617021276596 26.463078848560702 25.241551939924907 23.359198998748436 105-109 24.90613266583229 25.93241551939925 26.16770963704631 22.993742177722154 110-114 24.67083854818523 27.479349186483105 25.11639549436796 22.733416770963704 115-119 25.69211514392991 27.013767209011263 25.066332916145186 22.22778473091364 120-124 25.79595514617541 27.36784140969163 24.914897877452944 21.921305566680015 125-129 25.316645807259075 27.59949937421777 24.665832290362953 22.4180225281602 130-134 26.099794805064814 26.86552224613383 24.798558630699162 22.236124318102195 135-139 25.992490613266582 27.02377972465582 25.151439299123908 21.832290362953692 140-144 26.47235576923077 27.283653846153843 24.674479166666664 21.569511217948715 145-149 26.219084810253328 26.47942325022529 25.09262040652849 22.20887153299289 150-151 25.707488104182318 27.89882294014525 24.906085649887302 21.487603305785125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 1.0 25 1.0 26 1.5 27 4.0 28 8.0 29 5.5 30 6.0 31 12.0 32 15.5 33 22.5 34 29.5 35 40.0 36 54.5 37 64.0 38 84.5 39 103.5 40 122.0 41 165.5 42 196.0 43 182.0 44 179.0 45 207.0 46 226.5 47 213.5 48 203.5 49 195.5 50 167.5 51 158.0 52 146.0 53 126.5 54 115.5 55 97.0 56 81.0 57 76.5 58 76.5 59 79.0 60 69.5 61 60.0 62 56.0 63 57.0 64 53.0 65 39.0 66 37.0 67 37.5 68 29.5 69 21.5 70 17.0 71 13.5 72 12.0 73 7.5 74 4.0 75 4.0 76 4.0 77 3.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.095 55-59 0.135 60-64 0.125 65-69 0.125 70-74 0.13 75-79 0.135 80-84 0.215 85-89 0.18 90-94 0.125 95-99 0.125 100-104 0.125 105-109 0.125 110-114 0.125 115-119 0.125 120-124 0.12 125-129 0.125 130-134 0.095 135-139 0.125 140-144 0.16 145-149 0.13 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4703656998739 98.6 2 0.4287515762925599 0.8500000000000001 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.025220680958385876 0.15 7 0.0 0.0 8 0.025220680958385876 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 8 0.2 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1625 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.6375 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.6624999999999996 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.324999999999999 0.0 0.0 0.0 0.0 138-139 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGT 10 0.006830828 145.0 3 >>END_MODULE Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695788 spots for SRR6958460.sra Written 695788 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra Read 695773 spots for SRR6958460.sra Written 695773 spots for SRR6958460.sra SRR ids: ['SRR6958460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bt3fcy1e SRR6958460.sra spots: 13915475 blocks: [[1, 695773], [695774, 1391546], [1391547, 2087319], [2087320, 2783092], [2783093, 3478865], [3478866, 4174638], [4174639, 4870411], [4870412, 5566184], [5566185, 6261957], [6261958, 6957730], [6957731, 7653503], [7653504, 8349276], [8349277, 9045049], [9045050, 9740822], [9740823, 10436595], [10436596, 11132368], [11132369, 11828141], [11828142, 12523914], [12523915, 13219687], [13219688, 13915475]] SRR6958460 file size 4693797 SRR6958460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958460 SRR6958460_1.fastq SRR6958460_2.fastq Input file: SRR6958460_1.fastq Paired file: SRR6958460_2.fastq trimmed: SRR6958460-trimmed-pair1.fastq, SRR6958460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:39:30 2024 >> started Fri Dec 6 23:39:46 2024 >> done (15.537s) 13915475 read pairs processed; of these: 6914 ( 0.05%) short read pairs filtered out after trimming by size control 9551 ( 0.07%) empty read pairs filtered out after trimming by size control 13899010 (99.88%) read pairs available; of these: 7954230 (57.23%) trimmed read pairs available after processing 5944780 (42.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 9 0.00% 21 7 0.00% 22 9 0.00% 23 6 0.00% 24 11 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 10 0.00% 29 8 0.00% 30 9 0.00% 31 6 0.00% 32 5 0.00% 33 13 0.00% 34 8 0.00% 35 15 0.00% 36 11 0.00% 37 17 0.00% 38 13 0.00% 39 28 0.00% 40 28 0.00% 41 16 0.00% 42 15 0.00% 43 22 0.00% 44 31 0.00% 45 26 0.00% 46 26 0.00% 47 27 0.00% 48 46 0.00% 49 45 0.00% 50 52 0.00% 51 57 0.00% 52 64 0.00% 53 88 0.00% 54 89 0.00% 55 91 0.00% 56 93 0.00% 57 107 0.00% 58 123 0.00% 59 145 0.00% 60 159 0.00% 61 184 0.00% 62 205 0.00% 63 218 0.00% 64 258 0.00% 65 280 0.00% 66 297 0.00% 67 344 0.00% 68 366 0.00% 69 450 0.00% 70 540 0.00% 71 551 0.00% 72 689 0.00% 73 778 0.01% 74 868 0.01% 75 1058 0.01% 76 1170 0.01% 77 1123 0.01% 78 1229 0.01% 79 1587 0.01% 80 1910 0.01% 81 1757 0.01% 82 2054 0.01% 83 2219 0.02% 84 2749 0.02% 85 3301 0.02% 86 3588 0.03% 87 3878 0.03% 88 4057 0.03% 89 4453 0.03% 90 4843 0.03% 91 5456 0.04% 92 5751 0.04% 93 6386 0.05% 94 6940 0.05% 95 7384 0.05% 96 8072 0.06% 97 8693 0.06% 98 9489 0.07% 99 10708 0.08% 100 14322 0.10% 101 15496 0.11% 102 11304 0.08% 103 12004 0.09% 104 13096 0.09% 105 13690 0.10% 106 14443 0.10% 107 15384 0.11% 108 16283 0.12% 109 16926 0.12% 110 17689 0.13% 111 19076 0.14% 112 20208 0.15% 113 21271 0.15% 114 22616 0.16% 115 23863 0.17% 116 24799 0.18% 117 25932 0.19% 118 26571 0.19% 119 27665 0.20% 120 28778 0.21% 121 30353 0.22% 122 31940 0.23% 123 33879 0.24% 124 35797 0.26% 125 37774 0.27% 126 39125 0.28% 127 40554 0.29% 128 42091 0.30% 129 44379 0.32% 130 46250 0.33% 131 47973 0.35% 132 51110 0.37% 133 53801 0.39% 134 56946 0.41% 135 61217 0.44% 136 64654 0.47% 137 68674 0.49% 138 72473 0.52% 139 78319 0.56% 140 85365 0.61% 141 94520 0.68% 142 104890 0.75% 143 119060 0.86% 144 139000 1.00% 145 171785 1.24% 146 217127 1.56% 147 298466 2.15% 148 439719 3.16% 149 861723 6.20% 150 3966403 28.54% 151 5944780 42.77% 13899010 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=23 prefix-density=0.80 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=42.76 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=18 prefix-density=0.50 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=112.99 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGC SRR6958460 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:40:29 Started mapping on | Dec 06 23:40:30 Finished on | Dec 06 23:41:46 Mapping speed, Million of reads per hour | 658.37 Number of input reads | 13899010 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13549593 Uniquely mapped reads % | 97.49% Average mapped length | 293.62 Number of splices: Total | 15501591 Number of splices: Annotated (sjdb) | 14551474 Number of splices: GT/AG | 15295336 Number of splices: GC/AG | 179243 Number of splices: AT/AC | 5682 Number of splices: Non-canonical | 21330 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 122024 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 9872 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 233109 233109 233109 N_multimapping 122024 122024 122024 N_noFeature 518033 13151685 646316 N_ambiguous 321580 1958 52539 UnstrandedReadsAssigned:12709980 PositiveStrandReadsAssigned:395950 NegativeStrandReadsAssigned:12850738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958460-trimmed-pair1.fastq SRR6958460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,899,010 reads, 12,863,071 reads pseudoaligned [quant] estimated average fragment length: 241.231 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52973 SRR6958460.ke.tsv 35125 SRR6958460.se.tsv 88098 total ==> SRR6958460.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.327 0 0 PNS24247 1044 803.769 32.6875 4.85181 PNS24249 1928 1687.77 20.9375 1.48001 PNS24246 1044 803.769 32.6875 4.85181 PNS24248 1044 803.769 32.6875 4.85181 PNS24244 1471 1230.77 0 0 PNS24243 293 92.9942 0 0 KQK14069 1603 1362.77 2432.37 212.941 KQK14071 474 241.81 48.8873 24.1198 ==> SRR6958460.se.tsv <== BRADI_1g14170v3 2840 BRADI_1g53295v3 289 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 163 BRADI_1g74790v3 41 BRADI_1g09890v3 0 BRADI_1g77505v3 155 BRADI_1g48960v3 0 SRR6958460 completed mapping pipeline successfully