Starting /dee2/code/volunteer_pipeline.sh SRR6958461 current disk space = 1547537354752 free memory = 1599881252 SRR6958461 SRAfilesize 175e832b73412679a83b82afaf6d8af1 SRR6958461.sra SRR6958461.sra file validated SRR6958461 is paired end SRR6958461 is conventional basespace SRR6958461 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.85875 32.0 18.0 33.0 18.0 33.0 2 21.10125 18.0 18.0 25.0 18.0 31.0 3 28.23925 29.0 27.0 31.0 25.0 33.0 4 30.17375 31.0 29.0 33.0 27.0 33.0 5 32.1505 33.0 31.0 33.0 30.0 33.0 6 36.51525 38.0 37.0 38.0 34.0 38.0 7 36.8075 38.0 37.0 38.0 34.0 38.0 8 37.08275 38.0 38.0 38.0 35.0 38.0 9 37.3195 38.0 38.0 38.0 36.0 38.0 10-14 37.398399999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.51125 38.0 38.0 38.0 37.6 38.0 20-24 37.505100000000006 38.0 38.0 38.0 37.6 38.0 25-29 37.48715 38.0 38.0 38.0 37.4 38.0 30-34 37.460899999999995 38.0 38.0 38.0 37.2 38.0 35-39 37.4541 38.0 38.0 38.0 37.0 38.0 40-44 37.4129 38.0 38.0 38.0 37.0 38.0 45-49 37.41029999999999 38.0 38.0 38.0 37.2 38.0 50-54 37.29285 38.0 38.0 38.0 37.0 38.0 55-59 36.7604 38.0 38.0 38.0 36.0 38.0 60-64 36.55694999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.98485 38.0 38.0 38.0 36.0 38.0 70-74 37.101350000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.10850000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.0617 38.0 38.0 38.0 35.8 38.0 85-89 36.959450000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.8551 38.0 38.0 38.0 35.0 38.0 95-99 36.7053 38.0 38.0 38.0 34.4 38.0 100-104 36.567400000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.5329 38.0 38.0 38.0 34.0 38.0 110-114 36.28895 38.0 38.0 38.0 33.6 38.0 115-119 36.1836 38.0 37.6 38.0 33.0 38.0 120-124 35.82315 38.0 36.8 38.0 31.6 38.0 125-129 35.450450000000004 38.0 36.0 38.0 31.0 38.0 130-134 35.221999999999994 38.0 36.0 38.0 29.0 38.0 135-139 34.5887 38.0 35.2 38.0 27.4 38.0 140-144 34.09185000000001 38.0 33.8 38.0 25.2 38.0 145-149 33.3537 38.0 33.4 38.0 19.8 38.0 150-151 28.241125 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 8.0 23 6.0 24 7.0 25 11.0 26 13.0 27 26.0 28 29.0 29 41.0 30 43.0 31 65.0 32 71.0 33 113.0 34 166.0 35 356.0 36 908.0 37 2124.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.75 14.05 10.4 39.800000000000004 2 16.729182295573892 13.678419604901226 33.9584896224056 35.63390847711928 3 18.85 14.799999999999999 27.025 39.324999999999996 4 22.925 21.0 23.425 32.65 5 24.825 25.6 24.875 24.7 6 22.825 29.7 24.224999999999998 23.25 7 18.05 24.875 37.9 19.175 8 19.975 26.025 29.675 24.325 9 20.575 22.55 33.475 23.400000000000002 10-14 22.426213106553277 26.59829914957479 26.52826413206603 24.447223611805903 15-19 22.52 25.46 26.590000000000003 25.430000000000003 20-24 21.9 25.855 26.135 26.11 25-29 21.645 26.384999999999998 26.674999999999997 25.295 30-34 22.43 25.290000000000003 26.815 25.465 35-39 22.855 25.755 26.495 24.895 40-44 22.720000000000002 25.430000000000003 26.075 25.775 45-49 22.795 25.795 25.590000000000003 25.82 50-54 23.285 25.395 26.174999999999997 25.145 55-59 22.868433051319723 25.533208369218297 26.33365418714221 25.264704392319775 60-64 22.5877081317786 25.709048322216 26.034930495442744 25.66831305056266 65-69 22.139203690703038 25.829906729515596 26.23608464547187 25.794804934309497 70-74 22.759999999999998 25.755 26.340000000000003 25.145 75-79 22.650000000000002 25.185000000000002 25.945 26.22 80-84 22.35 25.490000000000002 26.525 25.635 85-89 22.985 25.15 26.119999999999997 25.745 90-94 23.244999999999997 25.205 26.395000000000003 25.155 95-99 23.035 24.104999999999997 26.93 25.929999999999996 100-104 23.875 25.085 25.885 25.155 105-109 23.285 24.97 26.119999999999997 25.624999999999996 110-114 23.23 24.945 25.89 25.935000000000002 115-119 23.115 25.755 25.130000000000003 26.0 120-124 23.325000000000003 24.85 26.295 25.53 125-129 23.43 25.215 25.665 25.69 130-134 23.18 25.415 25.695 25.71 135-139 23.27 25.305 25.165 26.26 140-144 23.294999999999998 25.595000000000002 25.585 25.525 145-149 23.01 24.975 25.8 26.215 150-151 23.849999999999998 24.325 25.8 26.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 3.0 28 5.0 29 4.0 30 4.0 31 11.0 32 19.0 33 24.0 34 31.5 35 42.5 36 51.0 37 61.5 38 88.5 39 111.0 40 134.5 41 160.5 42 186.5 43 219.0 44 215.5 45 209.5 46 225.5 47 216.5 48 203.0 49 190.0 50 171.0 51 160.0 52 130.0 53 106.5 54 104.5 55 96.5 56 79.0 57 73.0 58 66.0 59 55.5 60 54.5 61 54.0 62 51.0 63 49.0 64 43.5 65 41.0 66 44.5 67 35.5 68 27.0 69 26.5 70 24.0 71 20.0 72 21.0 73 16.0 74 9.5 75 8.5 76 6.0 77 3.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.05 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 1.3050000000000002 60-64 1.805 65-69 0.29 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATCT 10 0.0068484643 144.875 7 >>END_MODULE SRR6958461 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93125 33.0 33.0 34.0 32.0 34.0 2 33.06875 34.0 33.0 34.0 32.0 34.0 3 33.0655 34.0 33.0 34.0 33.0 34.0 4 33.089 34.0 33.0 34.0 33.0 34.0 5 33.0425 34.0 33.0 34.0 33.0 34.0 6 37.2495 38.0 38.0 38.0 37.0 38.0 7 37.197 38.0 38.0 38.0 37.0 38.0 8 37.27525 38.0 38.0 38.0 37.0 38.0 9 37.21775 38.0 38.0 38.0 37.0 38.0 10-14 37.27919999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.222950000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.2032 38.0 38.0 38.0 37.0 38.0 25-29 37.22305 38.0 38.0 38.0 37.0 38.0 30-34 37.1913 38.0 38.0 38.0 37.0 38.0 35-39 37.183499999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.1536 38.0 38.0 38.0 37.0 38.0 45-49 37.119749999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.12584999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.07615 38.0 38.0 38.0 37.0 38.0 60-64 36.9918 38.0 38.0 38.0 36.0 38.0 65-69 36.9567 38.0 38.0 38.0 36.0 38.0 70-74 36.981 38.0 38.0 38.0 36.0 38.0 75-79 36.93645 38.0 38.0 38.0 36.0 38.0 80-84 36.90315 38.0 38.0 38.0 36.0 38.0 85-89 36.828050000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.73649999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.6137 38.0 38.0 38.0 34.8 38.0 100-104 36.56755 38.0 38.0 38.0 34.4 38.0 105-109 36.393499999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.1808 38.0 38.0 38.0 33.8 38.0 115-119 36.03275 38.0 38.0 38.0 33.4 38.0 120-124 35.966950000000004 38.0 37.6 38.0 32.8 38.0 125-129 35.82595 38.0 37.2 38.0 32.8 38.0 130-134 35.74589999999999 38.0 37.0 38.0 32.4 38.0 135-139 35.57445 38.0 36.0 38.0 32.2 38.0 140-144 35.114749999999994 38.0 36.0 38.0 31.0 38.0 145-149 34.69395000000001 38.0 35.8 38.0 29.0 38.0 150-151 30.637999999999998 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 2.0 12 0.0 13 1.0 14 0.0 15 2.0 16 0.0 17 2.0 18 3.0 19 3.0 20 4.0 21 5.0 22 6.0 23 7.0 24 7.0 25 9.0 26 18.0 27 21.0 28 29.0 29 24.0 30 39.0 31 48.0 32 54.0 33 70.0 34 127.0 35 190.0 36 508.0 37 2804.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.4 18.099999999999998 13.700000000000001 29.799999999999997 2 29.575000000000003 24.75 25.275 20.4 3 23.75 26.974999999999998 26.450000000000003 22.825 4 27.1 31.25 20.325 21.325 5 27.224999999999998 31.825 20.424999999999997 20.525 6 25.275 35.325 20.025000000000002 19.375 7 22.400000000000002 19.525000000000002 34.949999999999996 23.125 8 25.324999999999996 22.925 24.025 27.725 9 24.3 23.7 27.6 24.4 10-14 25.45 26.91 23.115 24.525 15-19 25.55 25.355 24.925 24.169999999999998 20-24 25.885 26.305 24.205 23.605 25-29 25.88 25.31 24.92 23.89 30-34 25.305 25.595000000000002 25.21 23.89 35-39 26.075 25.8 24.185000000000002 23.94 40-44 25.6 26.06 24.245 24.095 45-49 25.705 25.430000000000003 24.765 24.099999999999998 50-54 25.645 26.029999999999998 24.085 24.240000000000002 55-59 25.795 25.935000000000002 24.41 23.86 60-64 25.95 25.825 24.84 23.385 65-69 25.650000000000002 25.945 24.85 23.555 70-74 25.805 26.185000000000002 24.685000000000002 23.325000000000003 75-79 25.95 26.05 24.48 23.52 80-84 25.355 26.16 25.005 23.48 85-89 26.31 25.740000000000002 24.455 23.494999999999997 90-94 25.83 25.840000000000003 25.21 23.119999999999997 95-99 26.075 26.375 24.23 23.32 100-104 26.045 25.845000000000002 24.355 23.755000000000003 105-109 25.995 25.995 25.005 23.005 110-114 26.345000000000002 26.68 24.575 22.400000000000002 115-119 26.185000000000002 26.145000000000003 25.180000000000003 22.49 120-124 26.35 26.474999999999998 24.6 22.575 125-129 26.035000000000004 26.465 24.834999999999997 22.665 130-134 26.595000000000002 26.27 24.44 22.695 135-139 26.369999999999997 26.565 24.51 22.555 140-144 26.700000000000003 26.255 24.67 22.375 145-149 26.8 26.085 24.82 22.295 150-151 27.787499999999998 25.724999999999998 25.224999999999998 21.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.5 27 1.5 28 2.5 29 5.0 30 4.0 31 5.5 32 9.5 33 17.0 34 20.0 35 22.0 36 39.5 37 55.5 38 65.5 39 92.5 40 122.0 41 152.0 42 184.5 43 198.5 44 211.0 45 220.0 46 216.5 47 212.5 48 186.5 49 180.5 50 170.0 51 124.0 52 118.5 53 119.5 54 109.5 55 106.5 56 93.5 57 83.5 58 81.0 59 85.5 60 75.5 61 56.5 62 58.5 63 58.0 64 54.0 65 55.0 66 59.5 67 54.5 68 41.0 69 40.5 70 36.5 71 26.0 72 20.0 73 12.5 74 9.0 75 8.5 76 6.5 77 5.0 78 2.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 1.05 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.275 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189532 spots for SRR6958461.sra Written 1189532 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra Read 1189516 spots for SRR6958461.sra Written 1189516 spots for SRR6958461.sra SRR ids: ['SRR6958461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e51hxl0v SRR6958461.sra spots: 23790336 blocks: [[1, 1189516], [1189517, 2379032], [2379033, 3568548], [3568549, 4758064], [4758065, 5947580], [5947581, 7137096], [7137097, 8326612], [8326613, 9516128], [9516129, 10705644], [10705645, 11895160], [11895161, 13084676], [13084677, 14274192], [14274193, 15463708], [15463709, 16653224], [16653225, 17842740], [17842741, 19032256], [19032257, 20221772], [20221773, 21411288], [21411289, 22600804], [22600805, 23790336]] SRR6958461 file size 8040063 SRR6958461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958461 SRR6958461_1.fastq SRR6958461_2.fastq Input file: SRR6958461_1.fastq Paired file: SRR6958461_2.fastq trimmed: SRR6958461-trimmed-pair1.fastq, SRR6958461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:42:44 2024 >> started Fri Dec 6 23:43:10 2024 >> done (26.314s) 23790336 read pairs processed; of these: 34523 ( 0.15%) short read pairs filtered out after trimming by size control 44339 ( 0.19%) empty read pairs filtered out after trimming by size control 23711474 (99.67%) read pairs available; of these: 9070633 (38.25%) trimmed read pairs available after processing 14640841 (61.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 1 0.00% 21 6 0.00% 22 9 0.00% 23 7 0.00% 24 6 0.00% 25 5 0.00% 26 8 0.00% 27 7 0.00% 28 6 0.00% 29 7 0.00% 30 12 0.00% 31 8 0.00% 32 9 0.00% 33 8 0.00% 34 6 0.00% 35 4 0.00% 36 6 0.00% 37 11 0.00% 38 14 0.00% 39 13 0.00% 40 11 0.00% 41 14 0.00% 42 8 0.00% 43 15 0.00% 44 18 0.00% 45 21 0.00% 46 15 0.00% 47 18 0.00% 48 30 0.00% 49 18 0.00% 50 26 0.00% 51 27 0.00% 52 34 0.00% 53 29 0.00% 54 43 0.00% 55 42 0.00% 56 51 0.00% 57 64 0.00% 58 60 0.00% 59 69 0.00% 60 71 0.00% 61 87 0.00% 62 121 0.00% 63 121 0.00% 64 118 0.00% 65 146 0.00% 66 178 0.00% 67 203 0.00% 68 229 0.00% 69 224 0.00% 70 299 0.00% 71 292 0.00% 72 355 0.00% 73 406 0.00% 74 471 0.00% 75 530 0.00% 76 611 0.00% 77 665 0.00% 78 815 0.00% 79 898 0.00% 80 965 0.00% 81 1125 0.00% 82 1339 0.01% 83 1495 0.01% 84 2743 0.01% 85 3559 0.02% 86 3700 0.02% 87 3877 0.02% 88 4106 0.02% 89 4264 0.02% 90 4441 0.02% 91 4785 0.02% 92 5042 0.02% 93 5640 0.02% 94 5796 0.02% 95 6277 0.03% 96 6671 0.03% 97 7144 0.03% 98 7620 0.03% 99 8170 0.03% 100 8746 0.04% 101 9446 0.04% 102 10224 0.04% 103 10845 0.05% 104 11686 0.05% 105 12341 0.05% 106 13350 0.06% 107 14052 0.06% 108 14652 0.06% 109 15955 0.07% 110 16706 0.07% 111 17659 0.07% 112 18855 0.08% 113 20202 0.09% 114 21736 0.09% 115 22916 0.10% 116 24036 0.10% 117 25205 0.11% 118 26428 0.11% 119 27293 0.12% 120 28710 0.12% 121 30282 0.13% 122 32297 0.14% 123 34170 0.14% 124 34911 0.15% 125 36992 0.16% 126 38798 0.16% 127 40667 0.17% 128 41651 0.18% 129 43626 0.18% 130 46154 0.19% 131 48023 0.20% 132 50886 0.21% 133 53434 0.23% 134 56770 0.24% 135 59554 0.25% 136 63609 0.27% 137 67588 0.29% 138 71235 0.30% 139 75899 0.32% 140 81277 0.34% 141 87754 0.37% 142 96500 0.41% 143 107521 0.45% 144 121527 0.51% 145 143824 0.61% 146 176312 0.74% 147 246108 1.04% 148 362919 1.53% 149 738887 3.12% 150 5514042 23.25% 151 14640841 61.75% 23711474 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=10.45 fanout-score-rank=14 prefix-density=0.55 prefix-fanout=4.5 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=229.37 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=20.2 sequence=CAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCGGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAGACGCTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=39 prefix-density=0.32 prefix-fanout=1.9 sequence=GCGGCAACTGCG criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=104.60 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=14.0 sequence=GCCGCCGCCGCCA SRR6958461 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:43:59 Started mapping on | Dec 06 23:43:59 Finished on | Dec 06 23:46:26 Mapping speed, Million of reads per hour | 580.69 Number of input reads | 23711474 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22911632 Uniquely mapped reads % | 96.63% Average mapped length | 296.79 Number of splices: Total | 27741134 Number of splices: Annotated (sjdb) | 26137462 Number of splices: GT/AG | 27353822 Number of splices: GC/AG | 320284 Number of splices: AT/AC | 13448 Number of splices: Non-canonical | 53580 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 3.08 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297091 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 9085 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 520572 520572 520572 N_multimapping 297091 297091 297091 N_noFeature 824965 22365362 978460 N_ambiguous 469747 3238 78194 UnstrandedReadsAssigned:21616920 PositiveStrandReadsAssigned:543032 NegativeStrandReadsAssigned:21854978 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958461-trimmed-pair1.fastq SRR6958461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,711,474 reads, 21,845,351 reads pseudoaligned [quant] estimated average fragment length: 258.428 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR6958461.ke.tsv 35125 SRR6958461.se.tsv 88098 total ==> SRR6958461.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.937 15.4315 1.55655 PNS24247 1044 786.572 61.6835 5.3705 PNS24249 1928 1670.57 103.201 4.23063 PNS24246 1044 786.572 61.6835 5.3705 PNS24248 1044 786.572 61.6835 5.3705 PNS24244 1471 1213.57 71.3166 4.02448 PNS24243 293 84.5455 0 0 KQK14069 1603 1345.57 1055.58 53.7243 KQK14071 474 228.952 4.20364 1.25738 ==> SRR6958461.se.tsv <== BRADI_1g14170v3 1167 BRADI_1g53295v3 2050 BRADI_1g59795v3 124 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 593 BRADI_1g74790v3 310 BRADI_1g09890v3 0 BRADI_1g77505v3 401 BRADI_1g48960v3 0 SRR6958461 completed mapping pipeline successfully