Starting /dee2/code/volunteer_pipeline.sh SRR6958462 current disk space = 1547557752832 free memory = 1600196056 SRR6958462 SRAfilesize caa99392d631e960504cc5d0bf0fc0d6 SRR6958462.sra SRR6958462.sra file validated SRR6958462 is paired end SRR6958462 is conventional basespace SRR6958462 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.05875 18.0 18.0 31.0 18.0 32.0 2 29.53775 30.0 27.0 33.0 27.0 33.0 3 30.31925 31.0 29.0 33.0 27.0 33.0 4 31.1915 33.0 31.0 33.0 28.0 33.0 5 32.00525 33.0 32.0 33.0 31.0 34.0 6 35.819 38.0 36.0 38.0 31.0 38.0 7 36.77275 38.0 37.0 38.0 34.0 38.0 8 37.04575 38.0 38.0 38.0 35.0 38.0 9 37.179 38.0 38.0 38.0 36.0 38.0 10-14 37.26965 38.0 38.0 38.0 36.2 38.0 15-19 37.223150000000004 38.0 38.0 38.0 36.6 38.0 20-24 37.23115 38.0 38.0 38.0 36.6 38.0 25-29 37.11925 38.0 38.0 38.0 36.0 38.0 30-34 36.9907 38.0 38.0 38.0 35.8 38.0 35-39 36.724399999999996 38.0 38.0 38.0 34.6 38.0 40-44 36.876749999999994 38.0 38.0 38.0 35.0 38.0 45-49 36.6563 38.0 38.0 38.0 34.2 38.0 50-54 36.351549999999996 38.0 37.6 38.0 33.2 38.0 55-59 36.30915 38.0 37.6 38.0 33.2 38.0 60-64 36.83415 38.0 38.0 38.0 34.8 38.0 65-69 36.50975 38.0 38.0 38.0 33.8 38.0 70-74 36.030649999999994 38.0 37.2 38.0 31.4 38.0 75-79 35.820249999999994 38.0 36.6 38.0 30.2 38.0 80-84 35.9313 38.0 37.0 38.0 31.4 38.0 85-89 36.15035 38.0 37.2 38.0 32.8 38.0 90-94 35.91695 38.0 36.8 38.0 31.8 38.0 95-99 34.90160000000001 38.0 35.4 38.0 26.8 38.0 100-104 34.817499999999995 38.0 35.0 38.0 26.6 38.0 105-109 34.2752 38.0 34.0 38.0 23.4 38.0 110-114 34.54285 38.0 34.6 38.0 25.2 38.0 115-119 33.78995 38.0 33.8 38.0 20.6 38.0 120-124 33.79155 38.0 33.6 38.0 21.2 38.0 125-129 33.686449999999994 38.0 33.8 38.0 20.2 38.0 130-134 32.811150000000005 36.8 32.2 38.0 16.6 38.0 135-139 32.206900000000005 36.2 32.0 38.0 14.4 38.0 140-144 30.339999999999996 35.4 27.4 38.0 13.4 38.0 145-149 28.08155 34.0 20.6 38.0 2.0 38.0 150-151 24.0475 32.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 3.0 17 3.0 18 3.0 19 2.0 20 7.0 21 10.0 22 11.0 23 18.0 24 18.0 25 32.0 26 34.0 27 56.0 28 59.0 29 91.0 30 127.0 31 113.0 32 174.0 33 223.0 34 361.0 35 589.0 36 992.0 37 1069.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.961886482040036 16.753496024129422 6.00493556347683 40.27968193035372 2 22.45 12.525 30.725 34.300000000000004 3 20.75 16.925 23.45 38.875 4 25.900000000000002 23.1 22.3 28.7 5 26.674999999999997 28.249999999999996 23.175 21.9 6 23.775 31.724999999999998 24.05 20.45 7 17.95 23.799999999999997 38.7 19.55 8 21.675 24.625 27.200000000000003 26.5 9 19.8 22.8 33.375 24.025 10-14 23.21 25.525 26.125 25.14 15-19 22.755 24.845 26.724999999999998 25.674999999999997 20-24 23.565 24.84 25.605 25.990000000000002 25-29 22.74 25.779999999999998 26.245 25.235000000000003 30-34 22.625 25.430000000000003 26.235000000000003 25.71 35-39 23.21 25.345000000000002 26.424999999999997 25.019999999999996 40-44 22.884999999999998 25.169999999999998 25.85 26.095000000000002 45-49 22.73 25.09 26.169999999999998 26.009999999999998 50-54 23.435 25.230000000000004 25.564999999999998 25.77 55-59 23.345 25.185000000000002 26.19 25.28 60-64 22.96 25.165 26.51 25.365 65-69 23.21 25.224999999999998 25.419999999999998 26.145000000000003 70-74 23.43 25.5 25.240000000000002 25.83 75-79 23.064999999999998 24.66 26.029999999999998 26.245 80-84 23.275000000000002 24.89 25.679999999999996 26.155 85-89 23.119999999999997 24.474999999999998 25.814999999999998 26.590000000000003 90-94 23.145 24.995 25.924999999999997 25.935000000000002 95-99 23.655 24.7 25.75 25.895000000000003 100-104 23.369999999999997 24.91 25.595000000000002 26.125 105-109 23.669999999999998 24.62 26.075 25.635 110-114 23.84 24.945 25.56 25.655 115-119 23.68 24.465 25.900000000000002 25.955000000000002 120-124 23.395 24.845 26.035000000000004 25.724999999999998 125-129 23.445 24.72 25.945 25.89 130-134 24.04 24.025 25.509999999999998 26.424999999999997 135-139 23.64 24.625 25.64 26.095000000000002 140-144 24.279999999999998 24.21 25.81 25.7 145-149 23.77 24.595 25.39 26.245 150-151 23.65 24.087500000000002 25.5625 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 1.5 28 1.0 29 5.0 30 6.5 31 5.0 32 10.0 33 15.5 34 21.5 35 28.5 36 47.0 37 70.0 38 79.0 39 99.5 40 124.0 41 141.5 42 171.5 43 195.5 44 209.0 45 216.5 46 208.5 47 206.5 48 195.5 49 183.5 50 178.5 51 156.5 52 133.0 53 142.5 54 127.0 55 97.0 56 88.5 57 79.0 58 83.5 59 74.5 60 66.0 61 63.5 62 55.0 63 48.0 64 53.0 65 53.5 66 42.0 67 41.0 68 38.5 69 28.0 70 19.5 71 17.5 72 18.0 73 17.0 74 12.5 75 7.0 76 4.5 77 3.5 78 3.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.7625 0.0 0.0 0.0 0.0 136-137 2.0625 0.0 0.0 0.0 0.0 138-139 2.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCCA 10 0.006843168 144.91249 3 >>END_MODULE SRR6958462 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.28375 33.0 33.0 34.0 31.0 34.0 2 32.29275 33.0 33.0 34.0 31.0 34.0 3 32.356 33.0 33.0 34.0 31.0 34.0 4 32.105 33.0 33.0 34.0 31.0 34.0 5 32.21975 33.0 33.0 34.0 31.0 34.0 6 35.76675 38.0 37.0 38.0 30.0 38.0 7 35.96025 38.0 37.0 38.0 31.0 38.0 8 36.05975 38.0 38.0 38.0 32.0 38.0 9 36.35625 38.0 38.0 38.0 34.0 38.0 10-14 36.14525 38.0 38.0 38.0 32.8 38.0 15-19 36.35555 38.0 38.0 38.0 33.8 38.0 20-24 36.4359 38.0 38.0 38.0 34.0 38.0 25-29 36.3645 38.0 38.0 38.0 34.2 38.0 30-34 36.24775 38.0 38.0 38.0 33.8 38.0 35-39 36.1858 38.0 38.0 38.0 33.8 38.0 40-44 36.0873 38.0 38.0 38.0 33.2 38.0 45-49 35.98315 38.0 37.8 38.0 32.6 38.0 50-54 35.937 38.0 37.6 38.0 32.4 38.0 55-59 35.88535 38.0 37.8 38.0 32.2 38.0 60-64 35.7802 38.0 37.4 38.0 31.8 38.0 65-69 35.647149999999996 38.0 37.0 38.0 31.0 38.0 70-74 35.444399999999995 38.0 37.0 38.0 29.8 38.0 75-79 35.39045 38.0 37.0 38.0 29.4 38.0 80-84 35.167100000000005 38.0 36.4 38.0 28.8 38.0 85-89 35.1896 38.0 36.2 38.0 29.2 38.0 90-94 34.93125 38.0 36.0 38.0 27.8 38.0 95-99 34.62055 38.0 35.6 38.0 26.2 38.0 100-104 33.98075 38.0 34.6 38.0 22.2 38.0 105-109 33.764649999999996 38.0 34.0 38.0 21.4 38.0 110-114 33.74595000000001 38.0 34.0 38.0 20.6 38.0 115-119 33.00785 38.0 33.8 38.0 15.0 38.0 120-124 32.8004 37.8 33.0 38.0 15.0 38.0 125-129 32.51225 37.6 32.4 38.0 14.6 38.0 130-134 31.84825 36.6 31.8 38.0 13.8 38.0 135-139 31.062450000000002 36.0 30.0 38.0 13.0 38.0 140-144 30.585 35.8 29.2 38.0 13.0 38.0 145-149 28.795849999999994 34.6 25.0 38.0 2.0 38.0 150-151 22.886625000000002 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 9.0 4 5.0 5 1.0 6 3.0 7 5.0 8 3.0 9 1.0 10 7.0 11 3.0 12 4.0 13 3.0 14 3.0 15 7.0 16 9.0 17 10.0 18 13.0 19 13.0 20 14.0 21 18.0 22 16.0 23 30.0 24 24.0 25 29.0 26 33.0 27 52.0 28 60.0 29 87.0 30 84.0 31 105.0 32 163.0 33 213.0 34 288.0 35 502.0 36 846.0 37 1316.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.159539884971245 18.704676169042262 13.528382095523881 29.607401850462615 2 30.625000000000004 23.200000000000003 25.5 20.674999999999997 3 23.775 25.624999999999996 26.875 23.724999999999998 4 24.8 30.9 20.200000000000003 24.099999999999998 5 27.224999999999998 33.2 19.125 20.45 6 23.474999999999998 34.5 19.35 22.675 7 23.325000000000003 18.95 33.85 23.875 8 25.174999999999997 22.975 22.375 29.475 9 24.8 22.075 26.5 26.625 10-14 26.895000000000003 25.895000000000003 22.615 24.595 15-19 26.035000000000004 24.94 24.275 24.75 20-24 25.790000000000003 25.374999999999996 24.104999999999997 24.73 25-29 26.26 25.195 24.12 24.425 30-34 25.635 25.509999999999998 24.455 24.4 35-39 25.83 25.34 24.11 24.72 40-44 25.990000000000002 25.555 23.825 24.63 45-49 26.035000000000004 25.595000000000002 23.79 24.58 50-54 26.325 26.0 24.275 23.400000000000002 55-59 26.400000000000002 24.865000000000002 24.044999999999998 24.69 60-64 26.419999999999998 25.61 23.919999999999998 24.05 65-69 26.13 25.374999999999996 23.935000000000002 24.560000000000002 70-74 26.39 25.715 24.115000000000002 23.78 75-79 25.790000000000003 25.540000000000003 24.41 24.26 80-84 26.47 24.95 24.705 23.875 85-89 26.455000000000002 25.019999999999996 24.695 23.830000000000002 90-94 26.650000000000002 25.14 24.555 23.655 95-99 26.755000000000003 25.185000000000002 24.610000000000003 23.45 100-104 26.029999999999998 25.095 24.595 24.279999999999998 105-109 26.395000000000003 25.4 24.51 23.695 110-114 26.375 25.264999999999997 24.58 23.78 115-119 26.245 25.430000000000003 24.305 24.02 120-124 26.200000000000003 26.095000000000002 23.945 23.76 125-129 26.119999999999997 25.83 24.575 23.474999999999998 130-134 26.125 25.53 24.535 23.810000000000002 135-139 26.345000000000002 26.055 24.4 23.200000000000003 140-144 27.215 25.635 24.16 22.99 145-149 26.55 25.885 24.19 23.375 150-151 26.187500000000004 25.474999999999998 24.85 23.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 3.0 29 4.5 30 3.0 31 3.5 32 7.0 33 9.5 34 18.5 35 26.5 36 30.5 37 43.0 38 58.0 39 78.5 40 105.0 41 140.0 42 165.5 43 169.5 44 179.0 45 194.0 46 202.0 47 196.5 48 198.5 49 192.0 50 174.0 51 166.0 52 145.5 53 114.5 54 102.0 55 104.0 56 94.5 57 86.5 58 91.5 59 89.0 60 80.0 61 84.5 62 83.0 63 72.0 64 63.5 65 58.0 66 55.0 67 50.5 68 47.5 69 44.0 70 40.0 71 33.0 72 26.0 73 19.0 74 11.0 75 7.0 76 7.5 77 6.5 78 2.0 79 1.0 80 4.0 81 3.0 82 1.0 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49622166246851 98.75 2 0.4030226700251889 0.8 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.025188916876574305 0.125 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.2 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.6125 0.0 0.0 0.0 0.0 136-137 1.925 0.0 0.0 0.0 0.0 138-139 2.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGCT 10 0.006830828 145.0 6 TGTCATC 10 0.006830828 145.0 2 AGGAGGT 10 0.006830828 145.0 1 >>END_MODULE Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198775 spots for SRR6958462.sra Written 1198775 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra Read 1198764 spots for SRR6958462.sra Written 1198764 spots for SRR6958462.sra SRR ids: ['SRR6958462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yep6gno7 SRR6958462.sra spots: 23975291 blocks: [[1, 1198764], [1198765, 2397528], [2397529, 3596292], [3596293, 4795056], [4795057, 5993820], [5993821, 7192584], [7192585, 8391348], [8391349, 9590112], [9590113, 10788876], [10788877, 11987640], [11987641, 13186404], [13186405, 14385168], [14385169, 15583932], [15583933, 16782696], [16782697, 17981460], [17981461, 19180224], [19180225, 20378988], [20378989, 21577752], [21577753, 22776516], [22776517, 23975291]] SRR6958462 file size 8102739 SRR6958462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958462 SRR6958462_1.fastq SRR6958462_2.fastq Input file: SRR6958462_1.fastq Paired file: SRR6958462_2.fastq trimmed: SRR6958462-trimmed-pair1.fastq, SRR6958462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:41:19 2024 >> started Fri Dec 6 23:41:47 2024 >> done (27.806s) 23975291 read pairs processed; of these: 54237 ( 0.23%) short read pairs filtered out after trimming by size control 50538 ( 0.21%) empty read pairs filtered out after trimming by size control 23870516 (99.56%) read pairs available; of these: 10807868 (45.28%) trimmed read pairs available after processing 13062648 (54.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 5 0.00% 23 7 0.00% 24 7 0.00% 25 3 0.00% 26 7 0.00% 27 12 0.00% 28 6 0.00% 29 10 0.00% 30 14 0.00% 31 14 0.00% 32 15 0.00% 33 8 0.00% 34 10 0.00% 35 13 0.00% 36 17 0.00% 37 24 0.00% 38 16 0.00% 39 15 0.00% 40 19 0.00% 41 22 0.00% 42 23 0.00% 43 26 0.00% 44 29 0.00% 45 34 0.00% 46 30 0.00% 47 38 0.00% 48 46 0.00% 49 37 0.00% 50 68 0.00% 51 58 0.00% 52 67 0.00% 53 85 0.00% 54 91 0.00% 55 93 0.00% 56 114 0.00% 57 123 0.00% 58 124 0.00% 59 141 0.00% 60 160 0.00% 61 201 0.00% 62 187 0.00% 63 179 0.00% 64 201 0.00% 65 236 0.00% 66 230 0.00% 67 270 0.00% 68 298 0.00% 69 335 0.00% 70 358 0.00% 71 391 0.00% 72 432 0.00% 73 508 0.00% 74 583 0.00% 75 630 0.00% 76 679 0.00% 77 704 0.00% 78 819 0.00% 79 979 0.00% 80 1018 0.00% 81 1258 0.01% 82 1449 0.01% 83 1713 0.01% 84 3818 0.02% 85 4891 0.02% 86 4834 0.02% 87 4811 0.02% 88 4906 0.02% 89 4972 0.02% 90 5060 0.02% 91 5068 0.02% 92 5088 0.02% 93 5426 0.02% 94 5767 0.02% 95 5821 0.02% 96 6358 0.03% 97 6461 0.03% 98 6595 0.03% 99 7245 0.03% 100 7829 0.03% 101 8030 0.03% 102 8676 0.04% 103 9058 0.04% 104 9521 0.04% 105 10451 0.04% 106 10974 0.05% 107 11606 0.05% 108 12527 0.05% 109 12951 0.05% 110 13895 0.06% 111 14911 0.06% 112 16009 0.07% 113 16539 0.07% 114 17741 0.07% 115 18950 0.08% 116 20136 0.08% 117 20959 0.09% 118 21845 0.09% 119 23302 0.10% 120 24354 0.10% 121 25736 0.11% 122 27020 0.11% 123 29364 0.12% 124 31050 0.13% 125 33275 0.14% 126 34935 0.15% 127 37859 0.16% 128 39813 0.17% 129 42578 0.18% 130 44723 0.19% 131 47858 0.20% 132 51202 0.21% 133 55369 0.23% 134 58528 0.25% 135 63710 0.27% 136 68337 0.29% 137 73570 0.31% 138 80166 0.34% 139 87002 0.36% 140 96310 0.40% 141 107669 0.45% 142 122411 0.51% 143 141747 0.59% 144 168080 0.70% 145 208545 0.87% 146 265836 1.11% 147 371956 1.56% 148 584578 2.45% 149 1201388 5.03% 150 6194570 25.95% 151 13062648 54.72% 23870516 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=78.15 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.5 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.92 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=3.5 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=195.11 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTT SRR6958462 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:42:44 Started mapping on | Dec 06 23:42:45 Finished on | Dec 06 23:44:54 Mapping speed, Million of reads per hour | 666.15 Number of input reads | 23870516 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 23146934 Uniquely mapped reads % | 96.97% Average mapped length | 296.91 Number of splices: Total | 26440496 Number of splices: Annotated (sjdb) | 24905801 Number of splices: GT/AG | 26088845 Number of splices: GC/AG | 304503 Number of splices: AT/AC | 13616 Number of splices: Non-canonical | 33532 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.50 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226245 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 17824 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.48% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 529130 529130 529130 N_multimapping 226245 226245 226245 N_noFeature 692101 22533331 856263 N_ambiguous 535975 3669 88004 UnstrandedReadsAssigned:21918858 PositiveStrandReadsAssigned:609934 NegativeStrandReadsAssigned:22202667 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958462-trimmed-pair1.fastq SRR6958462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,870,516 reads, 22,232,468 reads pseudoaligned [quant] estimated average fragment length: 269.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR6958462.ke.tsv 35125 SRR6958462.se.tsv 88098 total ==> SRR6958462.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.399 0.000116334 1.12564e-05 PNS24247 1044 775.078 85.511 7.12449 PNS24249 1928 1659.08 119.759 4.66144 PNS24246 1044 775.078 85.511 7.12449 PNS24248 1044 775.078 85.511 7.12449 PNS24244 1471 1202.08 86.7075 4.65802 PNS24243 293 76.7322 0 0 KQK14069 1603 1334.08 2167.03 104.896 KQK14071 474 217.048 38.8268 11.5519 ==> SRR6958462.se.tsv <== BRADI_1g14170v3 2469 BRADI_1g53295v3 205 BRADI_1g59795v3 566 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 787 BRADI_1g74790v3 277 BRADI_1g09890v3 2 BRADI_1g77505v3 416 BRADI_1g48960v3 0 SRR6958462 completed mapping pipeline successfully