Starting /dee2/code/volunteer_pipeline.sh SRR6958463 current disk space = 1547568242688 free memory = 1598757168 SRR6958463 SRAfilesize a228dca8a2f42655b62408d819d6d598 SRR6958463.sra SRR6958463.sra file validated SRR6958463 is paired end SRR6958463 is conventional basespace SRR6958463 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0645 31.0 18.0 33.0 18.0 33.0 2 30.51575 31.0 29.0 33.0 27.0 34.0 3 30.8945 33.0 30.0 33.0 27.0 34.0 4 31.38775 33.0 31.0 33.0 29.0 34.0 5 31.82025 33.0 32.0 33.0 30.0 34.0 6 36.5445 38.0 37.0 38.0 34.0 38.0 7 36.8875 38.0 38.0 38.0 35.0 38.0 8 37.15475 38.0 38.0 38.0 36.0 38.0 9 37.1285 38.0 38.0 38.0 36.0 38.0 10-14 37.2722 38.0 38.0 38.0 36.8 38.0 15-19 37.36055 38.0 38.0 38.0 37.0 38.0 20-24 37.30885 38.0 38.0 38.0 36.8 38.0 25-29 37.1451 38.0 38.0 38.0 36.0 38.0 30-34 36.9865 38.0 38.0 38.0 35.8 38.0 35-39 36.79215 38.0 38.0 38.0 35.0 38.0 40-44 36.868700000000004 38.0 38.0 38.0 35.4 38.0 45-49 36.84755 38.0 38.0 38.0 35.0 38.0 50-54 36.47405 38.0 38.0 38.0 33.8 38.0 55-59 36.464099999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.7678 38.0 38.0 38.0 34.6 38.0 65-69 36.68745 38.0 38.0 38.0 34.4 38.0 70-74 36.4851 38.0 38.0 38.0 34.0 38.0 75-79 35.91015 38.0 37.0 38.0 31.2 38.0 80-84 35.80965 38.0 36.8 38.0 30.6 38.0 85-89 36.07825 38.0 37.0 38.0 32.4 38.0 90-94 36.029999999999994 38.0 37.0 38.0 32.4 38.0 95-99 35.8406 38.0 36.6 38.0 31.8 38.0 100-104 35.051100000000005 38.0 35.4 38.0 27.4 38.0 105-109 34.705499999999994 38.0 34.8 38.0 26.0 38.0 110-114 34.85615 38.0 34.8 38.0 26.8 38.0 115-119 34.5453 38.0 34.8 38.0 25.2 38.0 120-124 34.49165000000001 38.0 34.4 38.0 25.0 38.0 125-129 34.309599999999996 38.0 34.2 38.0 25.2 38.0 130-134 34.062799999999996 38.0 34.0 38.0 23.0 38.0 135-139 33.14675 37.8 33.8 38.0 18.4 38.0 140-144 32.13365 36.2 32.0 38.0 13.8 38.0 145-149 30.282799999999998 35.4 29.0 38.0 8.6 38.0 150-151 25.045125 32.5 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 5.0 20 4.0 21 6.0 22 12.0 23 13.0 24 17.0 25 22.0 26 29.0 27 59.0 28 46.0 29 57.0 30 83.0 31 109.0 32 156.0 33 188.0 34 322.0 35 483.0 36 994.0 37 1389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.82779456193353 9.832463608898655 8.102169733589673 35.23757209557814 2 24.85 11.774999999999999 33.85 29.525000000000002 3 21.3 15.875 26.724999999999998 36.1 4 26.900000000000002 24.125 22.575 26.400000000000002 5 28.375 25.924999999999997 23.599999999999998 22.1 6 25.525 29.549999999999997 21.775 23.150000000000002 7 19.45 23.525 36.9 20.125 8 21.7 22.45 29.275000000000002 26.575 9 21.05 19.8 32.35 26.8 10-14 23.82 25.15 25.44 25.590000000000003 15-19 24.27 24.01 25.845000000000002 25.874999999999996 20-24 24.29 24.2 25.96 25.55 25-29 24.545 24.560000000000002 24.945 25.95 30-34 24.779999999999998 23.94 25.365 25.915 35-39 24.315 24.279999999999998 25.080000000000002 26.325 40-44 24.635 24.26 25.014999999999997 26.090000000000003 45-49 24.73 23.75 25.445 26.075 50-54 24.745 24.0 24.84 26.415 55-59 24.77 23.93 25.619999999999997 25.679999999999996 60-64 24.305 24.18 24.995 26.52 65-69 24.945 23.51 25.535000000000004 26.009999999999998 70-74 24.7 24.27 24.92 26.11 75-79 24.805 23.875 24.83 26.490000000000002 80-84 25.1 23.715 24.73 26.455000000000002 85-89 24.5 23.845 25.324999999999996 26.33 90-94 25.369999999999997 24.025 24.474999999999998 26.13 95-99 25.005 24.099999999999998 24.8 26.095000000000002 100-104 24.945 23.880000000000003 24.925 26.25 105-109 25.014999999999997 24.044999999999998 24.825 26.115 110-114 24.995 23.990000000000002 24.529999999999998 26.484999999999996 115-119 24.805 24.275 24.474999999999998 26.445 120-124 25.0 23.49 24.85 26.66 125-129 24.935 24.05 24.625 26.39 130-134 26.145000000000003 23.845 24.26 25.75 135-139 25.180000000000003 24.685000000000002 23.84 26.295 140-144 25.415 24.775 24.22 25.590000000000003 145-149 25.575 24.5 23.835 26.090000000000003 150-151 24.575 24.9125 24.0125 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 0.5 30 3.0 31 6.5 32 10.5 33 16.0 34 21.5 35 30.5 36 39.0 37 52.0 38 67.0 39 78.0 40 97.0 41 130.5 42 158.0 43 167.5 44 174.5 45 187.5 46 185.5 47 176.0 48 172.0 49 171.0 50 166.0 51 139.5 52 125.0 53 125.0 54 107.0 55 97.5 56 103.0 57 100.5 58 97.5 59 101.5 60 94.0 61 87.0 62 88.5 63 80.5 64 82.5 65 85.5 66 68.0 67 53.0 68 48.0 69 43.0 70 41.0 71 32.5 72 24.5 73 20.5 74 15.5 75 11.5 76 7.5 77 4.0 78 2.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06589245140115 98.1 2 0.9088613986367079 1.7999999999999998 3 0.0 0.0 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 5.012499999999999 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 7.012499999999999 0.0 0.0 0.0 0.0 134-135 7.6125 0.0 0.0 0.0 0.0 136-137 8.25 0.0 0.0 0.0 0.0 138-139 8.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTATG 10 0.0054020355 156.67567 1 >>END_MODULE SRR6958463 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958463_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50225 33.0 33.0 34.0 32.0 34.0 2 32.54475 33.0 33.0 34.0 32.0 34.0 3 32.375 33.0 33.0 34.0 31.0 34.0 4 32.3415 33.0 33.0 34.0 31.0 34.0 5 32.33625 33.0 33.0 34.0 31.0 34.0 6 36.06475 38.0 38.0 38.0 33.0 38.0 7 36.32075 38.0 38.0 38.0 33.0 38.0 8 36.119 38.0 38.0 38.0 33.0 38.0 9 36.0175 38.0 38.0 38.0 31.0 38.0 10-14 36.30735 38.0 38.0 38.0 33.4 38.0 15-19 36.48975 38.0 38.0 38.0 34.4 38.0 20-24 36.620799999999996 38.0 38.0 38.0 34.6 38.0 25-29 36.641 38.0 38.0 38.0 35.0 38.0 30-34 36.55175 38.0 38.0 38.0 34.8 38.0 35-39 36.3258 38.0 38.0 38.0 33.8 38.0 40-44 36.22560000000001 38.0 38.0 38.0 33.4 38.0 45-49 36.1021 38.0 38.0 38.0 32.8 38.0 50-54 36.26775 38.0 38.0 38.0 33.4 38.0 55-59 36.339800000000004 38.0 38.0 38.0 34.0 38.0 60-64 36.2171 38.0 38.0 38.0 33.6 38.0 65-69 36.0773 38.0 38.0 38.0 33.0 38.0 70-74 35.9703 38.0 37.8 38.0 32.4 38.0 75-79 35.787099999999995 38.0 37.2 38.0 31.4 38.0 80-84 35.7403 38.0 37.0 38.0 31.2 38.0 85-89 35.6968 38.0 37.0 38.0 31.4 38.0 90-94 35.56415 38.0 37.0 38.0 30.4 38.0 95-99 35.24285 38.0 36.4 38.0 29.0 38.0 100-104 34.900800000000004 38.0 35.8 38.0 27.4 38.0 105-109 34.6303 38.0 35.0 38.0 26.4 38.0 110-114 34.591750000000005 38.0 35.0 38.0 25.6 38.0 115-119 34.3977 38.0 35.0 38.0 24.8 38.0 120-124 34.14684999999999 38.0 34.8 38.0 23.4 38.0 125-129 33.71470000000001 38.0 34.2 38.0 20.6 38.0 130-134 33.3193 38.0 34.0 38.0 18.6 38.0 135-139 32.8722 38.0 33.4 38.0 14.4 38.0 140-144 32.17960000000001 38.0 31.6 38.0 13.2 38.0 145-149 30.740250000000003 36.2 30.2 38.0 8.6 38.0 150-151 25.066 33.5 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 3.0 5 2.0 6 2.0 7 3.0 8 0.0 9 3.0 10 3.0 11 1.0 12 5.0 13 3.0 14 9.0 15 6.0 16 6.0 17 3.0 18 5.0 19 12.0 20 13.0 21 13.0 22 10.0 23 12.0 24 21.0 25 26.0 26 44.0 27 33.0 28 60.0 29 78.0 30 66.0 31 104.0 32 128.0 33 146.0 34 234.0 35 373.0 36 805.0 37 1750.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.725 19.400000000000002 11.225 29.65 2 29.497122842131603 23.867900925694272 25.544158118588946 21.09081811358519 3 22.742056542406804 26.294721040780583 27.24543407555667 23.71778834125594 4 27.652652652652655 29.704704704704703 19.26926926926927 23.373373373373376 5 26.745058794095574 30.122591943957964 20.06504878658994 23.067300475356518 6 24.137068534267133 33.991995997999 19.384692346173086 22.486243121560783 7 22.511255627813906 19.459729864932466 34.14207103551776 23.88694347173587 8 24.437218609304654 23.936968484242122 22.11105552776388 29.514757378689342 9 23.78094523630908 23.280820205051263 26.006501625406354 26.93173293323331 10-14 26.16808404202101 25.142571285642823 22.161080540270135 26.52826413206603 15-19 26.248124062031014 24.892446223111556 23.1615807903952 25.697848924462228 20-24 25.867933966983493 25.072536268134066 23.43671835917959 25.62281140570285 25-29 26.15807903951976 24.607303651825912 23.19159579789895 26.043021510755377 30-34 26.43321660830415 24.757378689344673 23.196598299149578 25.6128064032016 35-39 25.64654094342454 25.616527437346807 23.065379420739333 25.671552198489323 40-44 26.169159205722003 24.97374080928325 23.418196368729056 25.438903616265694 45-49 26.514279997999303 24.588606012104236 23.1230930825789 25.774020907317563 50-54 26.60697313791206 24.01580711320094 23.905757590915915 25.471462157971086 55-59 26.788394197098548 23.911955977988995 23.34667333666833 25.952976488244122 60-64 26.163081540770385 24.17208604302151 23.931965982991496 25.732866433216607 65-69 26.043021510755377 24.39719859929965 23.896948474237117 25.662831415707853 70-74 26.36686508929018 24.65109299184633 23.04537041668751 25.93667150217598 75-79 26.518259129564782 24.967483741870936 23.141570785392695 25.372686343171587 80-84 26.94943230130546 24.993747811734107 22.968038813584755 25.08878107337568 85-89 26.231804311940373 24.365964684107848 24.380971437146716 25.02125956680506 90-94 27.093546773386695 24.68734367183592 23.026513256628313 25.192596298149073 95-99 26.258129064532266 24.427213606803402 23.961980990495245 25.352676338169083 100-104 26.73703166424891 24.671101995898155 23.415536991646242 25.176329348206693 105-109 26.010404161664667 25.00500200080032 23.619447779111642 25.36514605842337 110-114 27.058529264632313 25.68784392196098 23.186593296648326 24.06703351675838 115-119 27.180872348939577 24.694877951180473 23.364345738295317 24.759903961584634 120-124 27.393217965389617 25.012503751125337 23.281984595378614 24.312293688106433 125-129 27.050410082016402 25.465093018603717 22.684536907381474 24.7999599919984 130-134 27.63829148744623 25.867760328098427 22.78183455036511 23.712113634090226 135-139 27.57465112789476 25.008753063572247 23.23313159605862 24.183464212474366 140-144 27.966991747936987 25.186296574143537 23.400850212553138 23.44586146536634 145-149 28.04762142964334 25.99169626331849 22.800260117052673 23.160422189985493 150-151 28.348130548955858 25.697136426159812 22.44591721895711 23.50881580592722 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 1.0 29 2.5 30 4.5 31 6.5 32 7.5 33 8.0 34 11.0 35 15.5 36 26.0 37 32.0 38 45.0 39 70.0 40 94.5 41 124.0 42 131.0 43 140.0 44 167.0 45 172.0 46 172.0 47 180.5 48 174.0 49 165.5 50 157.0 51 157.0 52 145.5 53 127.0 54 124.5 55 119.0 56 108.5 57 100.0 58 107.5 59 108.5 60 93.0 61 90.0 62 96.0 63 97.0 64 87.5 65 75.0 66 75.0 67 69.5 68 55.0 69 53.5 70 51.5 71 34.5 72 27.5 73 23.5 74 21.0 75 15.5 76 7.0 77 6.5 78 4.5 79 1.5 80 1.0 81 1.5 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.1 5 0.075 6 0.05 7 0.05 8 0.05 9 0.025 10-14 0.05 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.045 40-44 0.034999999999999996 45-49 0.034999999999999996 50-54 0.045 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.045 75-79 0.05 80-84 0.034999999999999996 85-89 0.045 90-94 0.05 95-99 0.05 100-104 0.045 105-109 0.04 110-114 0.05 115-119 0.04 120-124 0.03 125-129 0.02 130-134 0.03 135-139 0.034999999999999996 140-144 0.025 145-149 0.045 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08929926637995 97.925 2 0.6830255502150265 1.35 3 0.17708069820389577 0.525 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.35 0.0 0.0 0.0 0.0 122-123 3.9124999999999996 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 5.0875 0.0 0.0 0.0 0.0 128-129 5.6375 0.0 0.0 0.0 0.0 130-131 6.4 0.0 0.0 0.0 0.0 132-133 7.112500000000001 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.3625 0.0 0.0 0.0 0.0 138-139 8.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGGTA 10 0.006830828 145.0 9 GGAAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120128 spots for SRR6958463.sra Written 1120128 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra Read 1120116 spots for SRR6958463.sra Written 1120116 spots for SRR6958463.sra SRR ids: ['SRR6958463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xw40ud_1 SRR6958463.sra spots: 22402332 blocks: [[1, 1120116], [1120117, 2240232], [2240233, 3360348], [3360349, 4480464], [4480465, 5600580], [5600581, 6720696], [6720697, 7840812], [7840813, 8960928], [8960929, 10081044], [10081045, 11201160], [11201161, 12321276], [12321277, 13441392], [13441393, 14561508], [14561509, 15681624], [15681625, 16801740], [16801741, 17921856], [17921857, 19041972], [19041973, 20162088], [20162089, 21282204], [21282205, 22402332]] SRR6958463 file size 7569714 SRR6958463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958463 SRR6958463_1.fastq SRR6958463_2.fastq Input file: SRR6958463_1.fastq Paired file: SRR6958463_2.fastq trimmed: SRR6958463-trimmed-pair1.fastq, SRR6958463-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:41:39 2024 >> started Fri Dec 6 23:42:07 2024 >> done (28.068s) 22402332 read pairs processed; of these: 36713 ( 0.16%) short read pairs filtered out after trimming by size control 33104 ( 0.15%) empty read pairs filtered out after trimming by size control 22332515 (99.69%) read pairs available; of these: 10762807 (48.19%) trimmed read pairs available after processing 11569708 (51.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 4 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 5 0.00% 25 5 0.00% 26 9 0.00% 27 4 0.00% 28 9 0.00% 29 8 0.00% 30 5 0.00% 31 9 0.00% 32 10 0.00% 33 11 0.00% 34 7 0.00% 35 7 0.00% 36 17 0.00% 37 21 0.00% 38 13 0.00% 39 16 0.00% 40 21 0.00% 41 29 0.00% 42 21 0.00% 43 36 0.00% 44 36 0.00% 45 32 0.00% 46 25 0.00% 47 51 0.00% 48 57 0.00% 49 49 0.00% 50 59 0.00% 51 67 0.00% 52 73 0.00% 53 103 0.00% 54 86 0.00% 55 99 0.00% 56 106 0.00% 57 133 0.00% 58 160 0.00% 59 174 0.00% 60 224 0.00% 61 234 0.00% 62 285 0.00% 63 303 0.00% 64 349 0.00% 65 366 0.00% 66 415 0.00% 67 484 0.00% 68 520 0.00% 69 575 0.00% 70 702 0.00% 71 782 0.00% 72 897 0.00% 73 1009 0.00% 74 1168 0.01% 75 1268 0.01% 76 1437 0.01% 77 1600 0.01% 78 1761 0.01% 79 2139 0.01% 80 2346 0.01% 81 2719 0.01% 82 3244 0.01% 83 3612 0.02% 84 5604 0.03% 85 6579 0.03% 86 6866 0.03% 87 7297 0.03% 88 7740 0.03% 89 8066 0.04% 90 8901 0.04% 91 9644 0.04% 92 10698 0.05% 93 11507 0.05% 94 12773 0.06% 95 13604 0.06% 96 14638 0.07% 97 15686 0.07% 98 16406 0.07% 99 17764 0.08% 100 19066 0.09% 101 20574 0.09% 102 22437 0.10% 103 24268 0.11% 104 25944 0.12% 105 27671 0.12% 106 29476 0.13% 107 30743 0.14% 108 32322 0.14% 109 34230 0.15% 110 35697 0.16% 111 38419 0.17% 112 41274 0.18% 113 43095 0.19% 114 46414 0.21% 115 48671 0.22% 116 50899 0.23% 117 52983 0.24% 118 54824 0.25% 119 56276 0.25% 120 59118 0.26% 121 60665 0.27% 122 64064 0.29% 123 67567 0.30% 124 71331 0.32% 125 74257 0.33% 126 77252 0.35% 127 79977 0.36% 128 81928 0.37% 129 84492 0.38% 130 87516 0.39% 131 91462 0.41% 132 95190 0.43% 133 99230 0.44% 134 103198 0.46% 135 109070 0.49% 136 111773 0.50% 137 116646 0.52% 138 121301 0.54% 139 128827 0.58% 140 135514 0.61% 141 144657 0.65% 142 156480 0.70% 143 173117 0.78% 144 193701 0.87% 145 223446 1.00% 146 268423 1.20% 147 349030 1.56% 148 506598 2.27% 149 997923 4.47% 150 4889960 21.90% 151 11569708 51.81% 22332515 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=16 prefix-density=0.81 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=35.30 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=62.51 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=4.3 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958463 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:42:54 Started mapping on | Dec 06 23:42:54 Finished on | Dec 06 23:44:42 Mapping speed, Million of reads per hour | 744.42 Number of input reads | 22332515 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21704248 Uniquely mapped reads % | 97.19% Average mapped length | 292.85 Number of splices: Total | 23715128 Number of splices: Annotated (sjdb) | 22265378 Number of splices: GT/AG | 23401759 Number of splices: GC/AG | 274072 Number of splices: AT/AC | 8580 Number of splices: Non-canonical | 30717 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 168437 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 14917 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.64% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 481429 481429 481429 N_multimapping 168437 168437 168437 N_noFeature 560432 21130666 712330 N_ambiguous 500308 2818 79349 UnstrandedReadsAssigned:20643508 PositiveStrandReadsAssigned:570764 NegativeStrandReadsAssigned:20912569 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6958463 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958463-trimmed-pair1.fastq SRR6958463-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,332,515 reads, 20,925,265 reads pseudoaligned [quant] estimated average fragment length: 241.135 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958463.ke.tsv 35125 SRR6958463.se.tsv 88098 total ==> SRR6958463.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.181 0 0 PNS24247 1044 803.865 62.7437 5.45314 PNS24249 1928 1687.87 86.0142 3.56035 PNS24246 1044 803.865 62.7437 5.45314 PNS24248 1044 803.865 62.7437 5.45314 PNS24244 1471 1230.87 38.7547 2.19976 PNS24243 293 98.6632 0 0 KQK14069 1603 1362.87 4062.79 208.273 KQK14071 474 246.37 76.4737 21.6863 ==> SRR6958463.se.tsv <== BRADI_1g14170v3 4541 BRADI_1g53295v3 148 BRADI_1g59795v3 230 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 236 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 250 BRADI_1g48960v3 0 SRR6958463 completed mapping pipeline successfully