Starting /dee2/code/volunteer_pipeline.sh SRR6958464 current disk space = 1547617722368 free memory = 1594679576 SRR6958464 SRAfilesize 099ef4bf988d64bfe174c65f36919667 SRR6958464.sra SRR6958464.sra file validated SRR6958464 is paired end SRR6958464 is conventional basespace SRR6958464 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.562 33.0 33.0 34.0 32.0 34.0 2 32.68075 33.0 33.0 34.0 31.0 34.0 3 32.83275 33.0 33.0 34.0 31.0 34.0 4 32.6965 33.0 33.0 34.0 31.0 34.0 5 32.87575 33.0 33.0 34.0 32.0 34.0 6 36.87525 38.0 37.0 38.0 35.0 38.0 7 37.22425 38.0 38.0 38.0 36.0 38.0 8 37.40625 38.0 38.0 38.0 37.0 38.0 9 37.60175 38.0 38.0 38.0 38.0 38.0 10-14 37.528299999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.603049999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.614999999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.57685000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.539649999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.477199999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.484700000000004 38.0 38.0 38.0 37.4 38.0 45-49 37.49315 38.0 38.0 38.0 37.4 38.0 50-54 37.4495 38.0 38.0 38.0 37.0 38.0 55-59 37.3492 38.0 38.0 38.0 37.0 38.0 60-64 36.7639 38.0 38.0 38.0 36.2 38.0 65-69 37.15635 38.0 38.0 38.0 36.4 38.0 70-74 37.276300000000006 38.0 38.0 38.0 36.4 38.0 75-79 37.1819 38.0 38.0 38.0 36.2 38.0 80-84 37.12275 38.0 38.0 38.0 36.0 38.0 85-89 37.07575 38.0 38.0 38.0 35.8 38.0 90-94 36.98715 38.0 38.0 38.0 35.4 38.0 95-99 36.930400000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.83415 38.0 38.0 38.0 35.0 38.0 105-109 36.6973 38.0 38.0 38.0 34.6 38.0 110-114 36.569900000000004 38.0 38.0 38.0 34.4 38.0 115-119 36.5111 38.0 38.0 38.0 34.0 38.0 120-124 36.2838 38.0 38.0 38.0 33.8 38.0 125-129 35.97345 38.0 37.0 38.0 31.8 38.0 130-134 35.48615 38.0 36.0 38.0 31.0 38.0 135-139 35.13145 38.0 36.0 38.0 30.0 38.0 140-144 34.71255 38.0 35.8 38.0 27.4 38.0 145-149 34.152249999999995 38.0 35.2 38.0 26.0 38.0 150-151 29.547 35.5 26.5 38.0 12.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 4.0 21 4.0 22 1.0 23 8.0 24 5.0 25 12.0 26 4.0 27 20.0 28 17.0 29 28.0 30 25.0 31 39.0 32 60.0 33 98.0 34 135.0 35 270.0 36 651.0 37 2614.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.75 10.05 10.075000000000001 37.125 2 25.275 11.625 32.25 30.85 3 21.175 15.325 25.174999999999997 38.324999999999996 4 25.825 22.45 22.775000000000002 28.95 5 27.474999999999998 24.6 23.974999999999998 23.95 6 25.624999999999996 30.225 22.525000000000002 21.625 7 18.45 23.625 38.45 19.475 8 22.05 22.775000000000002 27.625 27.55 9 21.349999999999998 21.85 30.9 25.900000000000002 10-14 24.132066033016507 25.477738869434717 25.54277138569285 24.847423711855928 15-19 23.419999999999998 23.785 26.200000000000003 26.595000000000002 20-24 24.125 24.66 25.31 25.905 25-29 23.990000000000002 24.795 25.15 26.064999999999998 30-34 23.815 24.154999999999998 25.074999999999996 26.955000000000002 35-39 23.96 24.455 25.31 26.275 40-44 23.75 24.415 25.28 26.555 45-49 24.21 24.474999999999998 24.610000000000003 26.705000000000002 50-54 24.065 24.695 25.185000000000002 26.055 55-59 24.349739895958383 24.23969587835134 24.92997198879552 26.480592236894758 60-64 24.155619889278277 24.048961348976587 25.521865000761846 26.273553760983294 65-69 24.39280885372327 24.272622564975713 25.118934348239776 26.215634233061248 70-74 24.490000000000002 24.095 25.180000000000003 26.235000000000003 75-79 24.505 23.65 25.44 26.405 80-84 23.755000000000003 24.025 25.435000000000002 26.784999999999997 85-89 25.064999999999998 23.785 25.22 25.929999999999996 90-94 24.875 24.255 25.005 25.865 95-99 24.795 23.62 24.83 26.755000000000003 100-104 24.92 24.055 25.130000000000003 25.895000000000003 105-109 24.94 23.294999999999998 25.490000000000002 26.275 110-114 24.54 24.465 24.33 26.665 115-119 25.005 24.275 24.79 25.929999999999996 120-124 24.525 24.365000000000002 24.67 26.44 125-129 24.82 24.325 24.455 26.400000000000002 130-134 25.319999999999997 24.305 24.68 25.695 135-139 24.645 24.005000000000003 25.019999999999996 26.33 140-144 24.884999999999998 24.465 24.485 26.165 145-149 24.705 24.575 24.224999999999998 26.495 150-151 25.1 23.4625 24.95 26.487500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 2.5 27 2.5 28 1.5 29 1.5 30 3.5 31 5.5 32 8.5 33 13.5 34 20.0 35 29.5 36 37.5 37 47.5 38 65.5 39 86.0 40 104.0 41 118.5 42 137.5 43 173.0 44 190.0 45 188.5 46 199.0 47 195.5 48 178.5 49 174.0 50 164.0 51 142.0 52 138.0 53 127.5 54 109.5 55 108.0 56 102.5 57 94.0 58 92.0 59 93.0 60 94.0 61 92.5 62 82.0 63 73.0 64 66.0 65 60.5 66 50.5 67 48.5 68 53.5 69 50.0 70 47.5 71 32.5 72 21.5 73 19.5 74 16.5 75 9.5 76 3.5 77 7.0 78 7.5 79 3.5 80 1.5 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.05 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.04 60-64 1.555 65-69 0.155 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.4375 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.2625 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958464 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958464_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9405 33.0 33.0 34.0 32.0 34.0 2 33.0215 34.0 33.0 34.0 32.0 34.0 3 33.038 34.0 33.0 34.0 33.0 34.0 4 33.02625 34.0 33.0 34.0 32.0 34.0 5 32.96625 34.0 33.0 34.0 33.0 34.0 6 37.22775 38.0 38.0 38.0 37.0 38.0 7 37.263 38.0 38.0 38.0 37.0 38.0 8 37.21925 38.0 38.0 38.0 37.0 38.0 9 37.15925 38.0 38.0 38.0 37.0 38.0 10-14 37.1288 38.0 38.0 38.0 37.0 38.0 15-19 37.14355 38.0 38.0 38.0 37.0 38.0 20-24 37.133050000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.118849999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.07165 38.0 38.0 38.0 37.0 38.0 35-39 37.0555 38.0 38.0 38.0 37.0 38.0 40-44 37.003099999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.969049999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.926700000000004 38.0 38.0 38.0 36.4 38.0 55-59 36.888000000000005 38.0 38.0 38.0 36.2 38.0 60-64 36.853899999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.781600000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.758950000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.8058 38.0 38.0 38.0 36.0 38.0 80-84 36.7441 38.0 38.0 38.0 36.0 38.0 85-89 36.63289999999999 38.0 38.0 38.0 35.2 38.0 90-94 36.55435 38.0 38.0 38.0 35.0 38.0 95-99 36.41255 38.0 38.0 38.0 34.6 38.0 100-104 36.34085 38.0 38.0 38.0 34.2 38.0 105-109 36.12485 38.0 38.0 38.0 34.0 38.0 110-114 35.9674 38.0 38.0 38.0 33.4 38.0 115-119 35.7358 38.0 38.0 38.0 32.6 38.0 120-124 35.75535 38.0 37.6 38.0 33.2 38.0 125-129 35.67274999999999 38.0 37.6 38.0 32.6 38.0 130-134 35.43045 38.0 36.2 38.0 31.6 38.0 135-139 35.092 38.0 36.0 38.0 30.2 38.0 140-144 34.779450000000004 38.0 36.0 38.0 28.2 38.0 145-149 34.1352 38.0 35.2 38.0 25.8 38.0 150-151 29.869625 35.5 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 10.0 4 0.0 5 4.0 6 3.0 7 1.0 8 0.0 9 1.0 10 2.0 11 3.0 12 3.0 13 3.0 14 1.0 15 3.0 16 1.0 17 4.0 18 2.0 19 6.0 20 7.0 21 2.0 22 7.0 23 9.0 24 17.0 25 10.0 26 10.0 27 10.0 28 20.0 29 27.0 30 37.0 31 48.0 32 62.0 33 84.0 34 106.0 35 225.0 36 507.0 37 2754.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.23823823823824 17.892892892892892 13.463463463463462 30.405405405405407 2 29.701978462309043 24.292511895817682 24.768344603055347 21.23716503881793 3 23.466065614825947 26.62158777861257 25.920360631104433 23.99198597545705 4 26.67167543200601 30.65364387678437 19.033308289506635 23.64137240170298 5 27.42299023290759 32.05609817180065 18.8580015026296 21.66291009266216 6 24.3 35.225 19.6 20.875 7 23.275000000000002 19.375 32.95 24.4 8 23.150000000000002 24.6 23.200000000000003 29.049999999999997 9 23.674999999999997 22.225 26.525 27.575 10-14 25.71 26.090000000000003 21.97 26.229999999999997 15-19 26.146307315365767 25.191259562978146 23.52617630881544 25.136256812840642 20-24 25.31 25.235000000000003 23.82 25.635 25-29 25.61 25.21 23.54 25.64 30-34 26.27 24.615000000000002 23.895 25.22 35-39 26.340000000000003 25.35 22.939999999999998 25.369999999999997 40-44 26.365 25.240000000000002 23.655 24.740000000000002 45-49 26.265 25.005 23.69 25.040000000000003 50-54 26.334999999999997 24.310000000000002 23.810000000000002 25.545 55-59 26.515 24.7 23.35 25.435000000000002 60-64 26.314999999999998 25.11 23.66 24.915000000000003 65-69 26.415 25.05 23.52 25.014999999999997 70-74 26.65766576657666 24.847484748474848 23.387338733873385 25.107510751075107 75-79 26.005 24.905 23.765 25.324999999999996 80-84 26.31 24.795 23.455000000000002 25.44 85-89 26.31 24.610000000000003 23.47 25.61 90-94 26.224999999999998 24.795 23.62 25.36 95-99 26.790000000000003 24.9 23.64 24.67 100-104 26.665 25.14 23.175 25.019999999999996 105-109 26.705000000000002 25.215 23.525 24.555 110-114 26.526326316315817 25.211260563028155 23.36616830841542 24.89624481224061 115-119 27.07 25.259999999999998 23.585 24.085 120-124 26.805 25.8 23.29 24.104999999999997 125-129 26.845000000000002 25.545 23.369999999999997 24.240000000000002 130-134 27.075 25.045 23.544999999999998 24.335 135-139 27.215 26.07 22.955000000000002 23.76 140-144 27.615000000000002 25.505 22.97 23.91 145-149 27.284999999999997 25.445 24.2 23.07 150-151 27.750000000000004 25.374999999999996 23.45 23.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 1.5 27 0.5 28 1.0 29 3.0 30 2.5 31 1.5 32 5.5 33 12.5 34 17.0 35 23.5 36 31.0 37 42.5 38 62.0 39 84.0 40 108.5 41 121.5 42 137.0 43 154.5 44 168.5 45 176.5 46 163.0 47 166.0 48 175.5 49 174.5 50 171.0 51 149.0 52 135.0 53 135.0 54 114.5 55 93.0 56 95.0 57 104.5 58 106.5 59 99.0 60 96.0 61 92.5 62 89.0 63 85.0 64 82.5 65 77.5 66 68.5 67 67.5 68 64.5 69 60.0 70 49.0 71 35.0 72 26.0 73 20.0 74 13.5 75 8.0 76 9.0 77 8.0 78 4.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85728796343322 97.32499999999999 2 0.8125952260030471 1.6 3 0.25393600812595224 0.75 4 0.050787201625190445 0.2 5 0.025393600812595223 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0125 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.037500000000000006 0.0 0.025 0.0 0.0 80-81 0.0625 0.0 0.025 0.0 0.0 82-83 0.16249999999999998 0.0 0.025 0.0 0.0 84-85 0.175 0.0 0.025 0.0 0.0 86-87 0.175 0.0 0.025 0.0 0.0 88-89 0.175 0.0 0.025 0.0 0.0 90-91 0.175 0.0 0.025 0.0 0.0 92-93 0.21250000000000002 0.0 0.025 0.0 0.0 94-95 0.2875 0.0 0.025 0.0 0.0 96-97 0.3375 0.0 0.025 0.0 0.0 98-99 0.42500000000000004 0.0 0.025 0.0 0.0 100-101 0.525 0.0 0.025 0.0 0.0 102-103 0.6625 0.0 0.025 0.0 0.0 104-105 0.725 0.0 0.025 0.0 0.0 106-107 0.8625 0.0 0.025 0.0 0.0 108-109 0.9624999999999999 0.0 0.025 0.0 0.0 110-111 1.125 0.0 0.025 0.0 0.0 112-113 1.3375 0.0 0.025 0.0 0.0 114-115 1.5625 0.0 0.025 0.0 0.0 116-117 1.8375 0.0 0.025 0.0 0.0 118-119 1.95 0.0 0.025 0.0 0.0 120-121 2.1 0.0 0.025 0.0 0.0 122-123 2.25 0.0 0.025 0.0 0.0 124-125 2.45 0.0 0.025 0.0 0.0 126-127 2.8375 0.0 0.025 0.0 0.0 128-129 3.2874999999999996 0.0 0.025 0.0 0.0 130-131 3.65 0.0 0.025 0.0 0.0 132-133 4.175000000000001 0.0 0.025 0.0 0.0 134-135 4.725 0.0 0.025 0.0 0.0 136-137 5.15 0.0 0.025 0.0 0.0 138-139 5.3375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489066 spots for SRR6958464.sra Written 1489066 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra Read 1489063 spots for SRR6958464.sra Written 1489063 spots for SRR6958464.sra SRR ids: ['SRR6958464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5qoq8y71 SRR6958464.sra spots: 29781263 blocks: [[1, 1489063], [1489064, 2978126], [2978127, 4467189], [4467190, 5956252], [5956253, 7445315], [7445316, 8934378], [8934379, 10423441], [10423442, 11912504], [11912505, 13401567], [13401568, 14890630], [14890631, 16379693], [16379694, 17868756], [17868757, 19357819], [19357820, 20846882], [20846883, 22335945], [22335946, 23825008], [23825009, 25314071], [25314072, 26803134], [26803135, 28292197], [28292198, 29781263]] SRR6958464 file size 10070192 SRR6958464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958464 SRR6958464_1.fastq SRR6958464_2.fastq Input file: SRR6958464_1.fastq Paired file: SRR6958464_2.fastq trimmed: SRR6958464-trimmed-pair1.fastq, SRR6958464-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:50:17 2024 >> started Fri Dec 6 23:50:56 2024 >> done (38.931s) 29781263 read pairs processed; of these: 45618 ( 0.15%) short read pairs filtered out after trimming by size control 67100 ( 0.23%) empty read pairs filtered out after trimming by size control 29668545 (99.62%) read pairs available; of these: 11130815 (37.52%) trimmed read pairs available after processing 18537730 (62.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 2 0.00% 24 8 0.00% 25 8 0.00% 26 4 0.00% 27 5 0.00% 28 4 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 9 0.00% 33 14 0.00% 34 7 0.00% 35 7 0.00% 36 17 0.00% 37 13 0.00% 38 13 0.00% 39 17 0.00% 40 23 0.00% 41 16 0.00% 42 27 0.00% 43 16 0.00% 44 20 0.00% 45 13 0.00% 46 26 0.00% 47 33 0.00% 48 48 0.00% 49 36 0.00% 50 41 0.00% 51 51 0.00% 52 56 0.00% 53 61 0.00% 54 72 0.00% 55 82 0.00% 56 86 0.00% 57 96 0.00% 58 121 0.00% 59 120 0.00% 60 120 0.00% 61 144 0.00% 62 172 0.00% 63 192 0.00% 64 212 0.00% 65 268 0.00% 66 241 0.00% 67 316 0.00% 68 340 0.00% 69 378 0.00% 70 434 0.00% 71 503 0.00% 72 597 0.00% 73 731 0.00% 74 763 0.00% 75 915 0.00% 76 1010 0.00% 77 1138 0.00% 78 1351 0.00% 79 1418 0.00% 80 1637 0.01% 81 1874 0.01% 82 2210 0.01% 83 2614 0.01% 84 4292 0.01% 85 5661 0.02% 86 5749 0.02% 87 6116 0.02% 88 6600 0.02% 89 6931 0.02% 90 7322 0.02% 91 7590 0.03% 92 8423 0.03% 93 8924 0.03% 94 9847 0.03% 95 10372 0.03% 96 10914 0.04% 97 11786 0.04% 98 12514 0.04% 99 13357 0.05% 100 14531 0.05% 101 15248 0.05% 102 16769 0.06% 103 17732 0.06% 104 19433 0.07% 105 20426 0.07% 106 22042 0.07% 107 22824 0.08% 108 24021 0.08% 109 25331 0.09% 110 26860 0.09% 111 28558 0.10% 112 30857 0.10% 113 32599 0.11% 114 34861 0.12% 115 36795 0.12% 116 38798 0.13% 117 40447 0.14% 118 41948 0.14% 119 43222 0.15% 120 45365 0.15% 121 47358 0.16% 122 49984 0.17% 123 52270 0.18% 124 54664 0.18% 125 57581 0.19% 126 59412 0.20% 127 61614 0.21% 128 63422 0.21% 129 65632 0.22% 130 68460 0.23% 131 70806 0.24% 132 74554 0.25% 133 78822 0.27% 134 82027 0.28% 135 85809 0.29% 136 89937 0.30% 137 94136 0.32% 138 97955 0.33% 139 104447 0.35% 140 109797 0.37% 141 116963 0.39% 142 126779 0.43% 143 139243 0.47% 144 156436 0.53% 145 181904 0.61% 146 219064 0.74% 147 279819 0.94% 148 410941 1.39% 149 845755 2.85% 150 6429355 21.67% 151 18537730 62.48% 29668545 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=15 prefix-density=0.73 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=28.42 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=24 prefix-density=0.54 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=148.72 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.8 sequence=AGAACAAGGAGTGCAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958464 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:51:40 Started mapping on | Dec 06 23:51:40 Finished on | Dec 06 23:54:10 Mapping speed, Million of reads per hour | 712.05 Number of input reads | 29668545 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 28672769 Uniquely mapped reads % | 96.64% Average mapped length | 296.33 Number of splices: Total | 32499617 Number of splices: Annotated (sjdb) | 30446065 Number of splices: GT/AG | 32057954 Number of splices: GC/AG | 387526 Number of splices: AT/AC | 11266 Number of splices: Non-canonical | 42871 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247231 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 30482 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.82% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 773406 773406 773406 N_multimapping 247231 247231 247231 N_noFeature 819953 27872117 1040663 N_ambiguous 696831 3897 117849 UnstrandedReadsAssigned:27155985 PositiveStrandReadsAssigned:796755 NegativeStrandReadsAssigned:27514257 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958464 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958464-trimmed-pair1.fastq SRR6958464-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,668,545 reads, 27,510,081 reads pseudoaligned [quant] estimated average fragment length: 255.2 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 SRR6958464.ke.tsv 35125 SRR6958464.se.tsv 88098 total ==> SRR6958464.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.289 54.1546 4.1886 PNS24247 1044 789.8 83.889 5.60519 PNS24249 1928 1673.8 134.703 4.24692 PNS24246 1044 789.8 83.889 5.60519 PNS24248 1044 789.8 83.889 5.60519 PNS24244 1471 1216.8 29.4758 1.27835 PNS24243 293 88.4418 0 0 KQK14069 1603 1348.8 12357.8 483.499 KQK14071 474 232.976 209.157 47.3765 ==> SRR6958464.se.tsv <== BRADI_1g14170v3 13715 BRADI_1g53295v3 228 BRADI_1g59795v3 310 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 241 BRADI_1g74790v3 140 BRADI_1g09890v3 0 BRADI_1g77505v3 352 BRADI_1g48960v3 0 SRR6958464 completed mapping pipeline successfully