Starting /dee2/code/volunteer_pipeline.sh SRR6958465 current disk space = 1547617730560 free memory = 1595203872 SRR6958465 SRAfilesize 00a688372d3f41e1bd37d65b6bead443 SRR6958465.sra SRR6958465.sra file validated SRR6958465 is paired end SRR6958465 is conventional basespace SRR6958465 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.91425 32.0 25.0 33.0 2.0 33.0 2 29.74925 31.0 28.0 33.0 25.0 33.0 3 31.243 33.0 31.0 33.0 27.0 33.0 4 32.34725 33.0 32.0 33.0 32.0 34.0 5 31.9725 33.0 32.0 33.0 31.0 34.0 6 35.9635 37.0 36.0 38.0 31.0 38.0 7 37.20175 38.0 38.0 38.0 36.0 38.0 8 37.4115 38.0 38.0 38.0 37.0 38.0 9 37.5575 38.0 38.0 38.0 37.0 38.0 10-14 37.48525 38.0 38.0 38.0 37.4 38.0 15-19 37.5089 38.0 38.0 38.0 37.6 38.0 20-24 37.459500000000006 38.0 38.0 38.0 37.6 38.0 25-29 37.1937 38.0 38.0 38.0 36.4 38.0 30-34 37.2401 38.0 38.0 38.0 36.8 38.0 35-39 37.5459 38.0 38.0 38.0 37.8 38.0 40-44 37.55145 38.0 38.0 38.0 38.0 38.0 45-49 37.43275 38.0 38.0 38.0 37.4 38.0 50-54 37.348499999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.32225 38.0 38.0 38.0 37.0 38.0 60-64 37.34654999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.346399999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.355599999999995 38.0 38.0 38.0 37.2 38.0 75-79 36.22685 38.0 37.0 38.0 30.8 38.0 80-84 37.02525 38.0 38.0 38.0 35.8 38.0 85-89 36.825849999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.59105 38.0 38.0 38.0 34.4 38.0 95-99 36.158950000000004 38.0 38.0 38.0 33.4 38.0 100-104 36.077600000000004 38.0 38.0 38.0 33.0 38.0 105-109 36.025600000000004 38.0 37.4 38.0 32.4 38.0 110-114 35.9547 38.0 37.4 38.0 32.4 38.0 115-119 36.3489 38.0 38.0 38.0 34.0 38.0 120-124 36.53144999999999 38.0 38.0 38.0 34.0 38.0 125-129 36.59905 38.0 38.0 38.0 33.8 38.0 130-134 36.32445 38.0 38.0 38.0 34.0 38.0 135-139 35.513850000000005 38.0 36.2 38.0 30.0 38.0 140-144 35.39625 38.0 36.0 38.0 31.0 38.0 145-149 33.31945 38.0 33.0 38.0 20.6 38.0 150-151 29.296125 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 5.0 22 4.0 23 4.0 24 4.0 25 9.0 26 16.0 27 24.0 28 19.0 29 35.0 30 39.0 31 62.0 32 71.0 33 102.0 34 152.0 35 309.0 36 726.0 37 2413.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.46549315451243 10.50572785694328 7.5998882369376926 35.428890751606595 2 25.55 12.7 34.599999999999994 27.150000000000002 3 21.675 18.575 24.349999999999998 35.4 4 27.500000000000004 26.275 19.950000000000003 26.275 5 26.474999999999998 28.975 23.5 21.05 6 22.75 31.025000000000002 24.15 22.075 7 17.775 21.675 39.975 20.575 8 20.825 23.025000000000002 29.125 27.025 9 20.225 20.0 33.45 26.325 10-14 23.97 25.235000000000003 25.674999999999997 25.119999999999997 15-19 23.515 25.074999999999996 26.015 25.395 20-24 23.595 25.230000000000004 26.169999999999998 25.005 25-29 23.84 25.115 25.34 25.705 30-34 23.815 25.16 25.55 25.474999999999998 35-39 23.585 24.945 25.955000000000002 25.515 40-44 23.485 25.069999999999997 25.900000000000002 25.545 45-49 23.794999999999998 25.35 24.965 25.89 50-54 23.445 25.03 25.71 25.814999999999998 55-59 23.330000000000002 25.155 25.605 25.91 60-64 23.915 24.715 25.319999999999997 26.05 65-69 23.325000000000003 24.93 25.945 25.8 70-74 24.11 24.959999999999997 25.235000000000003 25.695 75-79 23.7 24.855 25.319999999999997 26.125 80-84 23.505000000000003 25.095 26.224999999999998 25.174999999999997 85-89 23.919999999999998 24.625 25.56 25.895000000000003 90-94 23.875 25.465 25.41 25.25 95-99 23.674999999999997 24.48 25.895000000000003 25.95 100-104 23.415 24.73 25.81 26.045 105-109 23.97 24.195 26.235000000000003 25.6 110-114 24.490000000000002 24.94 24.93 25.64 115-119 23.685000000000002 25.66 24.990000000000002 25.665 120-124 24.345 25.224999999999998 24.985 25.445 125-129 23.44 25.295 25.3 25.965 130-134 24.6 24.2 25.419999999999998 25.779999999999998 135-139 24.0 25.005 24.875 26.119999999999997 140-144 24.29 24.605 25.11 25.995 145-149 23.955000000000002 25.130000000000003 25.295 25.619999999999997 150-151 24.275 24.6125 24.8 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 1.0 28 2.0 29 2.0 30 4.5 31 5.5 32 6.5 33 14.0 34 20.0 35 32.5 36 47.0 37 59.5 38 75.0 39 101.5 40 124.0 41 155.5 42 186.5 43 189.0 44 195.5 45 208.5 46 219.0 47 213.5 48 206.5 49 176.5 50 144.0 51 153.0 52 128.5 53 99.0 54 103.0 55 87.5 56 79.0 57 87.0 58 80.0 59 80.0 60 86.0 61 76.5 62 64.5 63 61.0 64 69.0 65 64.0 66 43.5 67 39.5 68 40.5 69 37.5 70 33.5 71 27.0 72 22.0 73 15.0 74 11.5 75 8.0 76 4.5 77 3.0 78 1.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88663967611336 97.7 2 1.0374493927125508 2.0500000000000003 3 0.05060728744939271 0.15 4 0.025303643724696356 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.2249999999999996 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958465 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01475 33.0 33.0 34.0 32.0 34.0 2 33.0795 34.0 33.0 34.0 32.0 34.0 3 33.252 34.0 33.0 34.0 33.0 34.0 4 33.17625 34.0 33.0 34.0 33.0 34.0 5 33.214 34.0 33.0 34.0 33.0 34.0 6 37.294 38.0 38.0 38.0 37.0 38.0 7 37.18175 38.0 38.0 38.0 37.0 38.0 8 37.17375 38.0 38.0 38.0 37.0 38.0 9 37.26725 38.0 38.0 38.0 37.0 38.0 10-14 37.139649999999996 38.0 38.0 38.0 36.6 38.0 15-19 37.03285 38.0 38.0 38.0 36.2 38.0 20-24 36.9889 38.0 38.0 38.0 36.2 38.0 25-29 37.138600000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.32340000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.387350000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.380649999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.242200000000004 38.0 38.0 38.0 37.0 38.0 50-54 36.948699999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.01805 38.0 38.0 38.0 36.0 38.0 60-64 36.98780000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.91835 38.0 38.0 38.0 35.8 38.0 70-74 36.7838 38.0 38.0 38.0 35.4 38.0 75-79 36.57020000000001 38.0 38.0 38.0 35.0 38.0 80-84 36.3264 38.0 38.0 38.0 33.8 38.0 85-89 36.133700000000005 38.0 38.0 38.0 33.2 38.0 90-94 36.51955 38.0 38.0 38.0 34.4 38.0 95-99 36.680899999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.736200000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.658249999999995 38.0 38.0 38.0 34.6 38.0 110-114 36.46505 38.0 38.0 38.0 34.0 38.0 115-119 34.048199999999994 37.4 32.8 38.0 26.0 38.0 120-124 32.5748 36.8 28.4 38.0 20.2 38.0 125-129 34.681000000000004 38.0 35.0 38.0 26.2 38.0 130-134 33.62385 37.6 32.2 38.0 21.8 38.0 135-139 30.1 33.8 24.4 38.0 16.2 38.0 140-144 34.522999999999996 38.0 35.2 38.0 27.2 38.0 145-149 33.8378 38.0 35.2 38.0 24.0 38.0 150-151 28.195 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 4.0 11 1.0 12 1.0 13 1.0 14 3.0 15 0.0 16 3.0 17 3.0 18 1.0 19 4.0 20 1.0 21 12.0 22 7.0 23 14.0 24 22.0 25 14.0 26 28.0 27 29.0 28 30.0 29 31.0 30 51.0 31 60.0 32 92.0 33 126.0 34 187.0 35 356.0 36 991.0 37 1922.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 17.5 11.525 31.324999999999996 2 28.999999999999996 24.65 26.8 19.55 3 22.25 26.900000000000002 27.0 23.849999999999998 4 26.3 31.65 19.75 22.3 5 28.050000000000004 32.300000000000004 19.125 20.525 6 23.599999999999998 34.699999999999996 19.375 22.325 7 22.1 18.45 34.599999999999994 24.85 8 24.4 23.200000000000003 23.375 29.025000000000002 9 22.875 24.474999999999998 26.275 26.375 10-14 26.19 25.5 23.044999999999998 25.264999999999997 15-19 26.340000000000003 25.095 23.919999999999998 24.645 20-24 25.555 25.775 23.86 24.81 25-29 26.005 25.564999999999998 23.965 24.465 30-34 25.665 25.6 24.345 24.39 35-39 25.974999999999998 25.335 24.545 24.145 40-44 26.13 25.055 23.794999999999998 25.019999999999996 45-49 25.569999999999997 25.674999999999997 24.255 24.5 50-54 25.509999999999998 25.88 24.255 24.355 55-59 26.009999999999998 24.795 24.665 24.529999999999998 60-64 25.27 25.445 24.455 24.83 65-69 25.36 25.285000000000004 25.1 24.255 70-74 26.71 24.68 24.044999999999998 24.565 75-79 26.035000000000004 24.855 23.98 25.130000000000003 80-84 25.845000000000002 25.385 24.474999999999998 24.295 85-89 25.77 24.825 24.7 24.705 90-94 25.705 25.455 24.86 23.98 95-99 25.755 25.61 24.115000000000002 24.52 100-104 25.679999999999996 25.724999999999998 23.965 24.63 105-109 25.955000000000002 26.055 24.2 23.79 110-114 26.145000000000003 25.264999999999997 24.83 23.76 115-119 26.075 26.46 23.905 23.56 120-124 26.545 25.41 24.335 23.71 125-129 26.009999999999998 25.619999999999997 23.915 24.455 130-134 26.35 26.06 24.395 23.195 135-139 26.72 25.619999999999997 24.095 23.565 140-144 26.834999999999997 25.45 24.315 23.400000000000002 145-149 26.935 24.92 24.895 23.25 150-151 26.9625 26.0125 24.65 22.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 0.5 26 0.0 27 1.0 28 3.5 29 5.0 30 6.0 31 5.5 32 9.0 33 13.5 34 16.0 35 25.0 36 28.5 37 46.5 38 83.0 39 100.5 40 112.5 41 138.5 42 163.0 43 173.5 44 186.5 45 201.5 46 191.5 47 173.5 48 171.5 49 178.0 50 172.0 51 154.0 52 142.5 53 119.0 54 94.0 55 83.0 56 84.5 57 87.5 58 85.0 59 91.0 60 94.5 61 88.5 62 78.5 63 70.5 64 63.0 65 72.0 66 72.5 67 54.0 68 47.5 69 41.0 70 38.5 71 37.5 72 26.5 73 18.5 74 15.0 75 9.5 76 7.0 77 5.0 78 3.0 79 3.0 80 1.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47328244274809 96.75 2 1.3486005089058526 2.65 3 0.10178117048346055 0.3 4 0.07633587786259542 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.8250000000000002 0.0 0.0 0.0 0.0 124-125 2.0875 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.8499999999999996 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040513 spots for SRR6958465.sra Written 1040513 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra Read 1040494 spots for SRR6958465.sra Written 1040494 spots for SRR6958465.sra SRR ids: ['SRR6958465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9wui4ahr SRR6958465.sra spots: 20809899 blocks: [[1, 1040494], [1040495, 2080988], [2080989, 3121482], [3121483, 4161976], [4161977, 5202470], [5202471, 6242964], [6242965, 7283458], [7283459, 8323952], [8323953, 9364446], [9364447, 10404940], [10404941, 11445434], [11445435, 12485928], [12485929, 13526422], [13526423, 14566916], [14566917, 15607410], [15607411, 16647904], [16647905, 17688398], [17688399, 18728892], [18728893, 19769386], [19769387, 20809899]] SRR6958465 file size 7030091 SRR6958465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958465 SRR6958465_1.fastq SRR6958465_2.fastq Input file: SRR6958465_1.fastq Paired file: SRR6958465_2.fastq trimmed: SRR6958465-trimmed-pair1.fastq, SRR6958465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:48:09 2024 >> started Fri Dec 6 23:48:31 2024 >> done (22.103s) 20809899 read pairs processed; of these: 14322 ( 0.07%) short read pairs filtered out after trimming by size control 11132 ( 0.05%) empty read pairs filtered out after trimming by size control 20784445 (99.88%) read pairs available; of these: 6891929 (33.16%) trimmed read pairs available after processing 13892516 (66.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 6 0.00% 21 7 0.00% 22 6 0.00% 23 9 0.00% 24 4 0.00% 25 7 0.00% 26 2 0.00% 27 6 0.00% 28 12 0.00% 29 6 0.00% 30 8 0.00% 31 7 0.00% 32 10 0.00% 33 6 0.00% 34 6 0.00% 35 9 0.00% 36 8 0.00% 37 6 0.00% 38 8 0.00% 39 6 0.00% 40 10 0.00% 41 20 0.00% 42 11 0.00% 43 17 0.00% 44 21 0.00% 45 14 0.00% 46 22 0.00% 47 29 0.00% 48 27 0.00% 49 23 0.00% 50 26 0.00% 51 30 0.00% 52 38 0.00% 53 45 0.00% 54 36 0.00% 55 55 0.00% 56 48 0.00% 57 57 0.00% 58 65 0.00% 59 73 0.00% 60 102 0.00% 61 97 0.00% 62 115 0.00% 63 166 0.00% 64 159 0.00% 65 173 0.00% 66 196 0.00% 67 212 0.00% 68 246 0.00% 69 254 0.00% 70 322 0.00% 71 347 0.00% 72 428 0.00% 73 497 0.00% 74 548 0.00% 75 566 0.00% 76 690 0.00% 77 739 0.00% 78 803 0.00% 79 1030 0.00% 80 1181 0.01% 81 1287 0.01% 82 1536 0.01% 83 1846 0.01% 84 2531 0.01% 85 3134 0.02% 86 3275 0.02% 87 3575 0.02% 88 3737 0.02% 89 3929 0.02% 90 4327 0.02% 91 4634 0.02% 92 5149 0.02% 93 5517 0.03% 94 6023 0.03% 95 6489 0.03% 96 6891 0.03% 97 7242 0.03% 98 7870 0.04% 99 8245 0.04% 100 9020 0.04% 101 9558 0.05% 102 10448 0.05% 103 11453 0.06% 104 12018 0.06% 105 13021 0.06% 106 13964 0.07% 107 14092 0.07% 108 14912 0.07% 109 15574 0.07% 110 16608 0.08% 111 17445 0.08% 112 18795 0.09% 113 19938 0.10% 114 21401 0.10% 115 22724 0.11% 116 23567 0.11% 117 24216 0.12% 118 24765 0.12% 119 25575 0.12% 120 26910 0.13% 121 28033 0.13% 122 29772 0.14% 123 31320 0.15% 124 33217 0.16% 125 34824 0.17% 126 36025 0.17% 127 36942 0.18% 128 37739 0.18% 129 39151 0.19% 130 40681 0.20% 131 42124 0.20% 132 44242 0.21% 133 47439 0.23% 134 49385 0.24% 135 51907 0.25% 136 55033 0.26% 137 56507 0.27% 138 58779 0.28% 139 61956 0.30% 140 65802 0.32% 141 70255 0.34% 142 77208 0.37% 143 85657 0.41% 144 95859 0.46% 145 111172 0.53% 146 131525 0.63% 147 172152 0.83% 148 251437 1.21% 149 507292 2.44% 150 4045570 19.46% 151 13892516 66.84% 20784445 reads passed initial QC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=22 prefix-density=1.10 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=49.42 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=16 prefix-density=0.79 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=26.61 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958465 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:49:24 Started mapping on | Dec 06 23:49:25 Finished on | Dec 06 23:51:22 Mapping speed, Million of reads per hour | 639.52 Number of input reads | 20784445 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20092204 Uniquely mapped reads % | 96.67% Average mapped length | 296.98 Number of splices: Total | 23571640 Number of splices: Annotated (sjdb) | 22279330 Number of splices: GT/AG | 23261086 Number of splices: GC/AG | 274675 Number of splices: AT/AC | 8336 Number of splices: Non-canonical | 27543 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161813 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 17386 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 540408 540408 540408 N_multimapping 161813 161813 161813 N_noFeature 580939 19533914 732170 N_ambiguous 485425 2530 79737 UnstrandedReadsAssigned:19025840 PositiveStrandReadsAssigned:555760 NegativeStrandReadsAssigned:19280297 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958465-trimmed-pair1.fastq SRR6958465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,784,445 reads, 19,279,233 reads pseudoaligned [quant] estimated average fragment length: 264.932 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR6958465.ke.tsv 35125 SRR6958465.se.tsv 88098 total ==> SRR6958465.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.558 0 0 PNS24247 1044 780.068 62.2943 6.18027 PNS24249 1928 1664.07 64.9044 3.01852 PNS24246 1044 780.068 62.2943 6.18027 PNS24248 1044 780.068 62.2943 6.18027 PNS24244 1471 1207.07 4.2128 0.270104 PNS24243 293 86.1227 0 0 KQK14069 1603 1339.07 4321.09 249.737 KQK14071 474 227.018 70.4423 24.014 ==> SRR6958465.se.tsv <== BRADI_1g14170v3 4747 BRADI_1g53295v3 173 BRADI_1g59795v3 172 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 233 BRADI_1g74790v3 97 BRADI_1g09890v3 1 BRADI_1g77505v3 211 BRADI_1g48960v3 0 SRR6958465 completed mapping pipeline successfully