Starting /dee2/code/volunteer_pipeline.sh SRR6958469 current disk space = 1547598462976 free memory = 1595232192 SRR6958469 SRAfilesize 1bc7f04e9e5dc60fbb2f309b35017fab SRR6958469.sra SRR6958469.sra file validated SRR6958469 is paired end SRR6958469 is conventional basespace SRR6958469 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.2025 28.0 18.0 33.0 18.0 33.0 2 30.3885 32.0 28.0 33.0 25.0 33.0 3 31.736 33.0 32.0 33.0 27.0 34.0 4 29.822 31.0 29.0 33.0 15.0 33.0 5 32.1255 33.0 32.0 33.0 31.0 34.0 6 36.35425 38.0 37.0 38.0 34.0 38.0 7 36.6325 38.0 37.0 38.0 34.0 38.0 8 37.0385 38.0 38.0 38.0 35.0 38.0 9 37.26 38.0 38.0 38.0 36.0 38.0 10-14 37.241150000000005 38.0 38.0 38.0 36.6 38.0 15-19 37.387 38.0 38.0 38.0 37.0 38.0 20-24 37.26585 38.0 38.0 38.0 36.8 38.0 25-29 37.0971 38.0 38.0 38.0 36.0 38.0 30-34 36.757250000000006 38.0 38.0 38.0 34.8 38.0 35-39 36.75555 38.0 38.0 38.0 34.6 38.0 40-44 36.7841 38.0 38.0 38.0 34.6 38.0 45-49 36.6683 38.0 38.0 38.0 34.4 38.0 50-54 36.51675 38.0 38.0 38.0 34.0 38.0 55-59 36.2694 38.0 37.6 38.0 33.0 38.0 60-64 36.64805 38.0 38.0 38.0 34.2 38.0 65-69 36.467349999999996 38.0 37.8 38.0 33.6 38.0 70-74 36.10955 38.0 37.0 38.0 32.4 38.0 75-79 35.97279999999999 38.0 37.0 38.0 31.8 38.0 80-84 35.841950000000004 38.0 37.0 38.0 31.0 38.0 85-89 35.876400000000004 38.0 36.6 38.0 31.4 38.0 90-94 35.904250000000005 38.0 36.8 38.0 31.6 38.0 95-99 35.3159 38.0 36.0 38.0 29.0 38.0 100-104 35.00095 38.0 35.4 38.0 27.2 38.0 105-109 34.76685 38.0 35.0 38.0 26.6 38.0 110-114 34.6084 38.0 35.0 38.0 25.4 38.0 115-119 33.98245 38.0 34.0 38.0 23.0 38.0 120-124 33.7265 38.0 33.6 38.0 20.0 38.0 125-129 33.68995 38.0 33.8 38.0 21.0 38.0 130-134 33.806250000000006 38.0 33.8 38.0 22.4 38.0 135-139 31.8399 36.2 30.6 38.0 14.0 38.0 140-144 31.370749999999997 36.0 30.4 38.0 13.4 38.0 145-149 29.911400000000004 35.6 28.4 38.0 8.6 38.0 150-151 24.516624999999998 33.0 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 2.0 17 6.0 18 2.0 19 1.0 20 10.0 21 8.0 22 11.0 23 16.0 24 19.0 25 23.0 26 39.0 27 50.0 28 65.0 29 66.0 30 103.0 31 120.0 32 158.0 33 229.0 34 346.0 35 493.0 36 995.0 37 1233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.420937840785164 11.314067611777535 6.652126499454744 39.61286804798255 2 20.525 12.65 31.25 35.575 3 20.125 16.475 25.174999999999997 38.224999999999994 4 23.599999999999998 24.2 23.775 28.425 5 27.35 25.174999999999997 24.175 23.3 6 24.65 30.55 23.474999999999998 21.325 7 17.625 24.575 39.25 18.55 8 20.925 22.15 30.0 26.924999999999997 9 19.575 21.7 33.324999999999996 25.4 10-14 22.845 25.790000000000003 25.69 25.674999999999997 15-19 23.395 24.39 25.900000000000002 26.314999999999998 20-24 23.305 24.92 26.25 25.525 25-29 23.544999999999998 24.83 25.755 25.869999999999997 30-34 23.595 24.8 25.495 26.11 35-39 23.380000000000003 24.779999999999998 26.400000000000002 25.44 40-44 23.169999999999998 25.240000000000002 25.745 25.845000000000002 45-49 23.445 24.715 25.94 25.900000000000002 50-54 23.39 25.14 25.445 26.025 55-59 23.345 25.0 25.8 25.855 60-64 23.56 24.77 25.580000000000002 26.090000000000003 65-69 23.425 24.45 25.924999999999997 26.200000000000003 70-74 23.155 24.48 26.13 26.235000000000003 75-79 23.080000000000002 24.84 25.775 26.305 80-84 23.73 24.310000000000002 25.790000000000003 26.169999999999998 85-89 23.68 24.62 25.564999999999998 26.135 90-94 24.060000000000002 24.46 25.52 25.96 95-99 23.925 24.285 25.96 25.83 100-104 24.145 24.68 25.645 25.53 105-109 24.135 24.47 25.805 25.590000000000003 110-114 23.765 25.0 25.724999999999998 25.509999999999998 115-119 24.195 24.365000000000002 25.685000000000002 25.755 120-124 23.32 24.605 26.06 26.015 125-129 23.915 25.09 25.53 25.465 130-134 24.19 24.995 25.224999999999998 25.590000000000003 135-139 23.89 24.6 25.5 26.009999999999998 140-144 24.22 24.545 25.41 25.825 145-149 24.39 24.02 25.650000000000002 25.94 150-151 24.1125 24.2875 25.837500000000002 25.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 0.5 28 2.5 29 4.0 30 4.0 31 4.5 32 5.5 33 11.5 34 16.0 35 23.5 36 41.5 37 56.0 38 75.5 39 94.5 40 123.5 41 151.0 42 178.0 43 197.5 44 201.5 45 207.5 46 194.0 47 196.0 48 211.0 49 201.0 50 171.5 51 147.5 52 135.5 53 120.0 54 99.5 55 87.5 56 86.5 57 85.0 58 82.5 59 81.5 60 79.5 61 81.0 62 70.5 63 63.0 64 60.5 65 58.0 66 51.0 67 36.0 68 33.5 69 34.5 70 31.0 71 24.0 72 19.5 73 17.5 74 12.0 75 8.5 76 7.5 77 5.0 78 4.0 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958469 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958469_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.392 33.0 33.0 34.0 32.0 34.0 2 32.1815 33.0 33.0 34.0 30.0 34.0 3 32.10675 33.0 33.0 34.0 30.0 34.0 4 32.14275 33.0 33.0 34.0 31.0 34.0 5 32.1335 33.0 33.0 34.0 31.0 34.0 6 35.9685 38.0 38.0 38.0 31.0 38.0 7 36.156 38.0 38.0 38.0 33.0 38.0 8 36.1065 38.0 38.0 38.0 33.0 38.0 9 36.29675 38.0 38.0 38.0 34.0 38.0 10-14 36.112350000000006 38.0 38.0 38.0 33.0 38.0 15-19 36.28315 38.0 38.0 38.0 33.8 38.0 20-24 36.438 38.0 38.0 38.0 34.6 38.0 25-29 36.44055000000001 38.0 38.0 38.0 34.4 38.0 30-34 36.24059999999999 38.0 38.0 38.0 33.8 38.0 35-39 36.16685 38.0 38.0 38.0 33.4 38.0 40-44 36.1415 38.0 38.0 38.0 33.6 38.0 45-49 36.0355 38.0 38.0 38.0 33.2 38.0 50-54 36.0595 38.0 38.0 38.0 33.2 38.0 55-59 36.05455 38.0 38.0 38.0 33.2 38.0 60-64 35.78675 38.0 37.6 38.0 31.6 38.0 65-69 35.51595 38.0 37.0 38.0 30.2 38.0 70-74 35.3438 38.0 36.8 38.0 29.0 38.0 75-79 35.406099999999995 38.0 37.0 38.0 29.2 38.0 80-84 35.347300000000004 38.0 37.0 38.0 29.4 38.0 85-89 35.259100000000004 38.0 36.6 38.0 29.0 38.0 90-94 35.057849999999995 38.0 36.2 38.0 28.4 38.0 95-99 34.8861 38.0 36.0 38.0 27.4 38.0 100-104 34.4969 38.0 35.4 38.0 24.8 38.0 105-109 34.247 38.0 34.8 38.0 23.4 38.0 110-114 34.0229 38.0 34.6 38.0 22.6 38.0 115-119 33.87615000000001 38.0 34.4 38.0 21.0 38.0 120-124 33.41825 38.0 33.8 38.0 17.4 38.0 125-129 33.30475 38.0 33.8 38.0 16.2 38.0 130-134 32.54395 38.0 31.8 38.0 14.2 38.0 135-139 31.892499999999995 37.8 31.0 38.0 13.0 38.0 140-144 31.246950000000005 36.4 31.0 38.0 13.0 38.0 145-149 29.061700000000002 35.6 26.4 38.0 2.0 38.0 150-151 23.0185 28.5 7.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 11.0 4 4.0 5 0.0 6 4.0 7 3.0 8 1.0 9 3.0 10 0.0 11 4.0 12 2.0 13 3.0 14 3.0 15 4.0 16 7.0 17 8.0 18 7.0 19 8.0 20 11.0 21 17.0 22 15.0 23 25.0 24 21.0 25 34.0 26 38.0 27 57.0 28 55.0 29 85.0 30 102.0 31 120.0 32 126.0 33 179.0 34 253.0 35 449.0 36 885.0 37 1432.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.35 19.625 12.125 28.9 2 29.4 23.525 25.174999999999997 21.9 3 22.7 26.35 27.35 23.599999999999998 4 25.45 32.125 20.025000000000002 22.400000000000002 5 26.724999999999998 32.05 20.275000000000002 20.95 6 22.650000000000002 35.125 19.75 22.475 7 21.224999999999998 20.974999999999998 34.675 23.125 8 24.7 22.55 22.875 29.875 9 24.275 23.025000000000002 26.6 26.1 10-14 26.085 26.169999999999998 23.145 24.6 15-19 25.415 25.385 24.235 24.965 20-24 26.174999999999997 25.705 23.93 24.19 25-29 25.945 26.135 23.565 24.355 30-34 25.790000000000003 26.025 23.74 24.445 35-39 26.0 25.795 23.76 24.445 40-44 26.295 25.374999999999996 23.630000000000003 24.7 45-49 26.11 25.45 23.965 24.474999999999998 50-54 26.284999999999997 25.635 24.03 24.05 55-59 26.72 24.945 23.77 24.565 60-64 26.52 25.28 24.404999999999998 23.794999999999998 65-69 26.235000000000003 25.729999999999997 24.615000000000002 23.419999999999998 70-74 26.025 25.085 24.310000000000002 24.58 75-79 25.825 25.71 24.235 24.23 80-84 26.3 25.424999999999997 24.385 23.89 85-89 26.009999999999998 25.124999999999996 24.755 24.11 90-94 26.075 25.155 24.86 23.91 95-99 25.885 25.005 24.775 24.335 100-104 26.405 24.97 24.69 23.935000000000002 105-109 25.785000000000004 25.979999999999997 24.610000000000003 23.625 110-114 26.419999999999998 25.935000000000002 23.990000000000002 23.655 115-119 26.775 25.540000000000003 23.875 23.810000000000002 120-124 26.834999999999997 25.790000000000003 24.035 23.34 125-129 26.735 25.41 24.884999999999998 22.97 130-134 26.515 26.41 23.865 23.21 135-139 27.255000000000003 25.590000000000003 24.04 23.115 140-144 27.634999999999998 25.629999999999995 24.15 22.585 145-149 26.69 25.7 24.47 23.14 150-151 27.975 25.650000000000002 23.825 22.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 2.5 29 2.5 30 3.5 31 6.0 32 8.0 33 7.5 34 10.0 35 19.5 36 30.0 37 52.5 38 76.5 39 89.5 40 123.0 41 156.5 42 161.5 43 170.0 44 188.0 45 196.5 46 201.0 47 183.0 48 166.0 49 181.5 50 179.0 51 150.5 52 132.5 53 119.0 54 109.0 55 109.5 56 102.0 57 97.0 58 93.0 59 83.0 60 79.0 61 73.0 62 67.0 63 63.5 64 66.5 65 70.0 66 61.0 67 55.5 68 51.5 69 45.5 70 38.5 71 30.0 72 24.0 73 17.5 74 14.5 75 9.5 76 4.5 77 5.5 78 5.5 79 2.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01190777805928 97.7 2 0.7854066379528756 1.55 3 0.10134279199391943 0.3 4 0.05067139599695972 0.2 5 0.05067139599695972 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0125 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.037500000000000006 0.0 0.0 0.0 0.025 90-91 0.0875 0.0 0.0 0.0 0.025 92-93 0.1 0.0 0.0 0.0 0.025 94-95 0.175 0.0 0.0 0.0 0.025 96-97 0.225 0.0 0.0 0.0 0.025 98-99 0.2375 0.0 0.0 0.0 0.025 100-101 0.2625 0.0 0.0 0.0 0.025 102-103 0.325 0.0 0.0 0.0 0.025 104-105 0.475 0.0 0.0 0.0 0.025 106-107 0.625 0.0 0.0 0.0 0.025 108-109 0.725 0.0 0.0 0.0 0.025 110-111 0.8125 0.0 0.0 0.0 0.025 112-113 0.9 0.0 0.0 0.0 0.025 114-115 1.0375 0.0 0.0 0.0 0.025 116-117 1.2 0.0 0.0 0.0 0.025 118-119 1.35 0.0 0.0 0.0 0.025 120-121 1.5875 0.0 0.0 0.0 0.025 122-123 1.85 0.0 0.0 0.0 0.025 124-125 2.1625 0.0 0.0 0.0 0.025 126-127 2.45 0.0 0.0 0.0 0.025 128-129 2.6125 0.0 0.0 0.0 0.025 130-131 2.8375 0.0 0.0 0.0 0.025 132-133 3.15 0.0 0.0 0.0 0.025 134-135 3.4875 0.0 0.0 0.0 0.025 136-137 3.8875 0.0 0.0 0.0 0.025 138-139 4.3125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCCGG 10 0.006830828 145.0 5 >>END_MODULE Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117782 spots for SRR6958469.sra Written 1117782 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra Read 1117768 spots for SRR6958469.sra Written 1117768 spots for SRR6958469.sra SRR ids: ['SRR6958469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r0t4qf10 SRR6958469.sra spots: 22355374 blocks: [[1, 1117768], [1117769, 2235536], [2235537, 3353304], [3353305, 4471072], [4471073, 5588840], [5588841, 6706608], [6706609, 7824376], [7824377, 8942144], [8942145, 10059912], [10059913, 11177680], [11177681, 12295448], [12295449, 13413216], [13413217, 14530984], [14530985, 15648752], [15648753, 16766520], [16766521, 17884288], [17884289, 19002056], [19002057, 20119824], [20119825, 21237592], [21237593, 22355374]] SRR6958469 file size 7553802 SRR6958469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958469 SRR6958469_1.fastq SRR6958469_2.fastq Input file: SRR6958469_1.fastq Paired file: SRR6958469_2.fastq trimmed: SRR6958469-trimmed-pair1.fastq, SRR6958469-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:53:51 2024 >> started Fri Dec 6 23:54:18 2024 >> done (27.005s) 22355374 read pairs processed; of these: 46046 ( 0.21%) short read pairs filtered out after trimming by size control 40467 ( 0.18%) empty read pairs filtered out after trimming by size control 22268861 (99.61%) read pairs available; of these: 10644431 (47.80%) trimmed read pairs available after processing 11624430 (52.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 5 0.00% 22 5 0.00% 23 2 0.00% 24 6 0.00% 25 1 0.00% 26 5 0.00% 27 12 0.00% 28 8 0.00% 29 9 0.00% 30 6 0.00% 31 10 0.00% 32 10 0.00% 33 8 0.00% 34 12 0.00% 35 14 0.00% 36 8 0.00% 37 8 0.00% 38 13 0.00% 39 21 0.00% 40 30 0.00% 41 18 0.00% 42 23 0.00% 43 22 0.00% 44 30 0.00% 45 34 0.00% 46 35 0.00% 47 37 0.00% 48 37 0.00% 49 45 0.00% 50 56 0.00% 51 59 0.00% 52 85 0.00% 53 82 0.00% 54 86 0.00% 55 113 0.00% 56 110 0.00% 57 120 0.00% 58 139 0.00% 59 157 0.00% 60 147 0.00% 61 178 0.00% 62 212 0.00% 63 242 0.00% 64 249 0.00% 65 241 0.00% 66 292 0.00% 67 306 0.00% 68 314 0.00% 69 397 0.00% 70 415 0.00% 71 521 0.00% 72 534 0.00% 73 669 0.00% 74 739 0.00% 75 784 0.00% 76 913 0.00% 77 934 0.00% 78 1029 0.00% 79 1227 0.01% 80 1391 0.01% 81 1678 0.01% 82 1835 0.01% 83 2214 0.01% 84 4157 0.02% 85 5197 0.02% 86 5443 0.02% 87 5285 0.02% 88 5515 0.02% 89 5705 0.03% 90 5833 0.03% 91 6289 0.03% 92 6627 0.03% 93 7154 0.03% 94 7555 0.03% 95 8349 0.04% 96 8725 0.04% 97 9219 0.04% 98 9794 0.04% 99 10214 0.05% 100 10903 0.05% 101 11713 0.05% 102 12690 0.06% 103 13670 0.06% 104 14576 0.07% 105 15740 0.07% 106 16962 0.08% 107 17569 0.08% 108 18538 0.08% 109 19775 0.09% 110 21160 0.10% 111 22130 0.10% 112 23726 0.11% 113 25294 0.11% 114 27010 0.12% 115 28335 0.13% 116 30137 0.14% 117 31391 0.14% 118 33094 0.15% 119 33997 0.15% 120 35872 0.16% 121 37589 0.17% 122 39910 0.18% 123 42314 0.19% 124 45194 0.20% 125 47690 0.21% 126 50141 0.23% 127 52747 0.24% 128 54766 0.25% 129 57854 0.26% 130 60644 0.27% 131 63714 0.29% 132 67820 0.30% 133 72274 0.32% 134 76188 0.34% 135 80961 0.36% 136 86293 0.39% 137 91021 0.41% 138 97122 0.44% 139 104756 0.47% 140 112245 0.50% 141 123298 0.55% 142 136490 0.61% 143 155025 0.70% 144 181052 0.81% 145 217963 0.98% 146 274932 1.23% 147 373503 1.68% 148 574530 2.58% 149 1137499 5.11% 150 5534606 24.85% 151 11624430 52.20% 22268861 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=22 prefix-density=0.57 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=49.35 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.3 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=3.2 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=65.79 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=10.5 sequence=CCGCCGCCGCCG SRR6958469 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:55:05 Started mapping on | Dec 06 23:55:05 Finished on | Dec 06 23:57:03 Mapping speed, Million of reads per hour | 679.39 Number of input reads | 22268861 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21609270 Uniquely mapped reads % | 97.04% Average mapped length | 295.32 Number of splices: Total | 24960474 Number of splices: Annotated (sjdb) | 23414277 Number of splices: GT/AG | 24615560 Number of splices: GC/AG | 302342 Number of splices: AT/AC | 10282 Number of splices: Non-canonical | 32290 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.54 Insertion rate per base | 0.01% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190445 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 13320 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 497071 497071 497071 N_multimapping 190445 190445 190445 N_noFeature 642611 21042922 793361 N_ambiguous 503373 2949 88448 UnstrandedReadsAssigned:20463286 PositiveStrandReadsAssigned:563399 NegativeStrandReadsAssigned:20727461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958469 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958469-trimmed-pair1.fastq SRR6958469-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,268,861 reads, 20,751,934 reads pseudoaligned [quant] estimated average fragment length: 254.378 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958469.ke.tsv 35125 SRR6958469.se.tsv 88098 total ==> SRR6958469.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.179 20.8707 2.20503 PNS24247 1044 790.622 73.8936 6.74603 PNS24249 1928 1674.62 95.1408 4.10072 PNS24246 1044 790.622 73.8936 6.74603 PNS24248 1044 790.622 73.8936 6.74603 PNS24244 1471 1217.62 26.3077 1.55948 PNS24243 293 87.2848 0 0 KQK14069 1603 1349.62 8996.22 481.125 KQK14071 474 232.549 135.416 42.0305 ==> SRR6958469.se.tsv <== BRADI_1g14170v3 9837 BRADI_1g53295v3 275 BRADI_1g59795v3 382 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 266 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 287 BRADI_1g48960v3 0 SRR6958469 completed mapping pipeline successfully