Starting /dee2/code/volunteer_pipeline.sh SRR7473317 current disk space = 1543212982272 free memory = 1599380512 SRR7473317 SRAfilesize a803754bf6fd2b4efea97479137881d6 SRR7473317.sra SRR7473317.sra file validated SRR7473317 is paired end SRR7473317 is conventional basespace SRR7473317 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473317_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.37025 34.0 33.0 34.0 33.0 34.0 2 33.2975 34.0 34.0 34.0 33.0 34.0 3 33.44425 34.0 34.0 34.0 33.0 34.0 4 33.45675 34.0 34.0 34.0 33.0 34.0 5 33.3165 34.0 34.0 34.0 33.0 34.0 6 37.04375 38.0 37.0 38.0 36.0 38.0 7 37.3895 38.0 38.0 38.0 37.0 38.0 8 37.4625 38.0 38.0 38.0 37.0 38.0 9 37.5015 38.0 38.0 38.0 38.0 38.0 10-14 37.47855 38.0 38.0 38.0 37.8 38.0 15-19 37.463550000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.53605 38.0 38.0 38.0 38.0 38.0 25-29 37.4014 38.0 38.0 38.0 37.2 38.0 30-34 37.19985 38.0 38.0 38.0 36.8 38.0 35-39 37.129450000000006 38.0 38.0 38.0 36.4 38.0 40-44 36.87905 38.0 38.0 38.0 35.4 38.0 45-49 36.9101 38.0 38.0 38.0 35.6 38.0 50-54 36.869749999999996 38.0 38.0 38.0 35.2 38.0 55-59 37.0021 38.0 38.0 38.0 35.6 38.0 60-64 36.90965 38.0 38.0 38.0 35.6 38.0 65-69 36.691449999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.631150000000005 38.0 38.0 38.0 34.4 38.0 75-79 36.528499999999994 38.0 38.0 38.0 34.2 38.0 80-84 36.49165000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.40445 38.0 38.0 38.0 33.8 38.0 90-94 36.11495000000001 38.0 37.8 38.0 33.2 38.0 95-99 35.8879 38.0 37.0 38.0 32.6 38.0 100-104 35.849000000000004 38.0 37.0 38.0 32.6 38.0 105-109 35.6975 38.0 36.8 38.0 31.8 38.0 110-114 35.431 38.0 36.2 38.0 30.2 38.0 115-119 35.16955 38.0 36.0 38.0 29.0 38.0 120-124 35.008649999999996 38.0 35.4 38.0 28.4 38.0 125-129 34.590250000000005 38.0 35.0 38.0 26.6 38.0 130-134 34.0713 38.0 34.8 38.0 23.6 38.0 135-139 33.698 38.0 34.2 38.0 22.2 38.0 140-144 32.87755 38.0 33.6 38.0 14.0 38.0 145-149 32.336 38.0 33.4 38.0 11.4 38.0 150-151 27.934375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 2.0 10 2.0 11 1.0 12 2.0 13 2.0 14 1.0 15 1.0 16 3.0 17 2.0 18 11.0 19 11.0 20 5.0 21 8.0 22 5.0 23 11.0 24 12.0 25 19.0 26 20.0 27 27.0 28 37.0 29 49.0 30 47.0 31 79.0 32 96.0 33 122.0 34 179.0 35 300.0 36 824.0 37 2119.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.97496871088861 14.618272841051313 9.887359198998748 35.51939924906133 2 26.56289229224203 16.972131559126286 31.23273914135074 25.232237007280943 3 22.075 23.549999999999997 25.55 28.825 4 24.875 29.849999999999998 22.55 22.725 5 25.639739086803814 31.234320120421476 21.500250878073256 21.625689914701454 6 21.7 32.300000000000004 23.1 22.900000000000002 7 18.85 20.625 39.225 21.3 8 20.674999999999997 21.95 27.625 29.75 9 21.55 20.075000000000003 30.325000000000003 28.050000000000004 10-14 23.669999999999998 24.585 25.0 26.745 15-19 23.755000000000003 24.335 25.4 26.51 20-24 23.34 24.425 25.25 26.985 25-29 23.47 25.19 25.264999999999997 26.075 30-34 23.93 24.725 25.335 26.009999999999998 35-39 23.653278647526633 25.10378632521382 24.70864802680938 26.534287000450156 40-44 24.11773539570506 24.418080792911848 25.529358762576965 25.934825048806125 45-49 24.164498699219532 24.8198919351611 24.969981989193517 26.045627376425855 50-54 23.82 24.705 25.195 26.279999999999998 55-59 23.849999999999998 24.715 24.855 26.58 60-64 23.44 24.185000000000002 25.775 26.6 65-69 24.18 24.279999999999998 25.314999999999998 26.224999999999998 70-74 23.835 24.8 25.045 26.32 75-79 23.646182309115456 24.951247562378118 24.73123656182809 26.671333566678335 80-84 24.41622081104055 24.8262413120656 24.601230061503074 26.156307815390768 85-89 24.305 24.779999999999998 24.8 26.115 90-94 24.57122856142807 24.89624481224061 24.421221061053053 26.111305565278265 95-99 24.374749899959983 24.349739895958383 24.479791916766708 26.795718287314923 100-104 24.44 24.575 24.6 26.384999999999998 105-109 24.065 24.7 24.535 26.700000000000003 110-114 24.05 25.16 24.34 26.450000000000003 115-119 24.385 24.895 23.845 26.875 120-124 24.01 25.245 24.005000000000003 26.740000000000002 125-129 24.066659993994595 24.61215093584226 24.537083375037533 26.784105695125614 130-134 24.723562525130678 24.819059107358264 24.12042621632489 26.336952151186168 135-139 24.75774464025707 24.250640156650096 24.59707787317367 26.394537329919167 140-144 25.033775331498624 24.648486364773582 24.038028521391045 26.279709782336752 145-149 24.330424315377673 24.661450496539274 24.07964690540676 26.9284782826763 150-151 24.87430869783811 24.270990447461035 24.86173956762192 25.992961287078938 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 0.5 26 1.5 27 2.5 28 4.0 29 7.0 30 7.0 31 10.0 32 19.0 33 21.0 34 23.5 35 43.0 36 54.5 37 54.0 38 62.0 39 83.5 40 102.5 41 131.5 42 159.5 43 156.5 44 155.0 45 174.0 46 182.0 47 178.0 48 170.0 49 163.5 50 151.0 51 136.5 52 141.0 53 150.5 54 128.5 55 107.0 56 115.0 57 115.5 58 102.5 59 91.5 60 91.5 61 88.5 62 79.0 63 72.5 64 70.5 65 61.5 66 52.5 67 48.0 68 47.0 69 42.0 70 30.5 71 23.0 72 20.5 73 17.0 74 15.5 75 11.0 76 6.0 77 3.5 78 3.0 79 3.0 80 1.5 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.42500000000000004 3 0.0 4 0.0 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.11499999999999999 45-49 0.06 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.005 95-99 0.04 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.09 130-134 0.52 135-139 0.415 140-144 0.075 145-149 0.31 150-151 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15573770491804 95.8 2 1.485655737704918 2.9000000000000004 3 0.25614754098360654 0.75 4 0.05122950819672131 0.2 5 0.025614754098360656 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025614754098360656 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 20 (98% over 50bp) GTCCCCCCTTCGCAGTAACACCAAGTACAGGAATATTAACCTGTTTCCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.2125 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.6125 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.5625 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.35 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 5.9625 0.0 0.0 0.0 0.0 126-127 6.6375 0.0 0.0 0.0 0.0 128-129 7.112500000000001 0.0 0.0 0.0 0.0 130-131 7.575 0.0 0.0 0.0 0.0 132-133 8.037500000000001 0.0 0.0 0.0 0.0 134-135 8.425 0.0 0.0 0.0 0.0 136-137 8.95 0.0 0.0 0.0 0.0 138-139 9.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473317 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473317_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.248 33.0 33.0 34.0 32.0 34.0 2 32.502 33.0 33.0 34.0 32.0 34.0 3 32.23725 34.0 33.0 34.0 32.0 34.0 4 32.29525 33.0 33.0 34.0 31.0 34.0 5 32.238 34.0 33.0 34.0 32.0 34.0 6 36.363 38.0 38.0 38.0 35.0 38.0 7 36.611 38.0 38.0 38.0 36.0 38.0 8 36.6775 38.0 38.0 38.0 35.0 38.0 9 36.72975 38.0 38.0 38.0 35.0 38.0 10-14 36.788199999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.571200000000005 38.0 38.0 38.0 35.6 38.0 20-24 36.3953 38.0 38.0 38.0 35.2 38.0 25-29 36.37235 38.0 38.0 38.0 34.8 38.0 30-34 36.388850000000005 38.0 38.0 38.0 35.4 38.0 35-39 36.406099999999995 38.0 38.0 38.0 35.2 38.0 40-44 36.413650000000004 38.0 38.0 38.0 35.4 38.0 45-49 36.274649999999994 38.0 38.0 38.0 34.8 38.0 50-54 36.339099999999995 38.0 38.0 38.0 34.8 38.0 55-59 36.28295 38.0 38.0 38.0 34.4 38.0 60-64 36.1549 38.0 38.0 38.0 34.2 38.0 65-69 35.86445 38.0 38.0 38.0 33.8 38.0 70-74 36.01795 38.0 38.0 38.0 33.8 38.0 75-79 35.9793 38.0 38.0 38.0 34.0 38.0 80-84 35.85725 38.0 38.0 38.0 33.4 38.0 85-89 35.69070000000001 38.0 38.0 38.0 32.6 38.0 90-94 35.60095 38.0 38.0 38.0 32.6 38.0 95-99 35.25619999999999 38.0 37.6 38.0 30.4 38.0 100-104 34.4344 38.0 36.6 38.0 25.6 38.0 105-109 34.334050000000005 38.0 36.0 38.0 24.4 38.0 110-114 34.1842 38.0 36.0 38.0 23.8 38.0 115-119 33.85365 38.0 35.0 38.0 21.4 38.0 120-124 33.7428 38.0 35.0 38.0 21.4 38.0 125-129 33.440749999999994 38.0 35.0 38.0 15.8 38.0 130-134 32.64875 38.0 34.0 38.0 13.8 38.0 135-139 32.41825 38.0 33.4 38.0 13.0 38.0 140-144 31.774500000000007 38.0 32.0 38.0 10.8 38.0 145-149 30.3829 37.6 30.4 38.0 2.0 38.0 150-151 25.264625000000002 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 23.0 4 12.0 5 2.0 6 0.0 7 2.0 8 2.0 9 2.0 10 4.0 11 5.0 12 2.0 13 5.0 14 3.0 15 11.0 16 22.0 17 13.0 18 5.0 19 11.0 20 14.0 21 16.0 22 28.0 23 21.0 24 18.0 25 35.0 26 30.0 27 26.0 28 34.0 29 52.0 30 65.0 31 67.0 32 86.0 33 121.0 34 166.0 35 273.0 36 644.0 37 2158.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.87341772151899 19.31645569620253 11.569620253164556 29.240506329113924 2 30.835443037974684 22.962025316455698 26.025316455696203 20.17721518987342 3 23.3222760908395 26.435315131411073 26.99668282725185 23.245725950497576 4 25.676701239564885 32.582848469516826 19.22590437642297 22.514545914495322 5 27.564265716467297 32.98549249172817 18.19801476202596 21.25222702977857 6 24.359949302915084 34.043092522179975 18.859315589353614 22.73764258555133 7 22.873011865690483 17.87427417318859 34.2085331986872 25.044180762433726 8 26.325043958804322 20.54760110524994 22.255714644561667 30.87164029138407 9 24.411027568922307 23.659147869674186 23.884711779448622 28.045112781954888 10-14 26.786609201162676 25.17790919113962 22.1860278640874 25.8494537436103 15-19 26.66599404731877 25.071886192806335 23.043938858901274 25.218180900973618 20-24 26.84506044817644 24.72052202944003 23.450857403004704 24.983560119378826 25-29 26.226195888265895 25.104813860685965 23.442945900894074 25.226044350154066 30-34 25.90851655294415 24.27091230730351 24.255749305029063 25.564821834723272 35-39 26.818158813705146 23.857482666126828 23.619616377347032 25.70474214282099 40-44 26.81313131313131 24.41414141414141 23.56060606060606 25.212121212121215 45-49 26.725493179167298 24.28622141082205 23.555961255641765 25.432324154368885 50-54 27.02961804329179 24.002220091831074 24.062768050860285 24.90539381401685 55-59 27.33925507217119 24.487735944281823 23.291611991521147 24.881396992025838 60-64 26.36607187989688 24.566547035333368 23.919526866501542 25.14785421826821 65-69 26.658169768034668 24.710680601580425 23.415753250063727 25.21539638032118 70-74 27.275938635446106 24.601332256762213 23.375050464271297 24.747678643520388 75-79 26.97667373523175 24.704634959103302 23.01827728971019 25.300414015954757 80-84 26.613309171448705 25.083056478405314 23.462196718010674 24.841437632135307 85-89 26.925202190184354 24.473803184809366 23.629878937057317 24.971115687948963 90-94 26.5669838392992 24.925741328097466 23.44056789004682 25.06670694255651 95-99 27.027027027027028 24.751066856330013 23.638488112172322 24.583418004470637 100-104 26.828387096774193 24.923870967741934 23.710967741935484 24.536774193548386 105-109 26.355313239378663 24.74539656413949 23.60868223433803 25.290607962143813 110-114 27.569876975343593 24.779945436763267 23.26144026355073 24.38873732434241 115-119 27.409684857801693 25.621316935690498 22.85933897002306 24.109659236484752 120-124 28.203157031570314 25.43050430504305 22.821853218532183 23.54448544485445 125-129 27.87524366471735 25.741253719093056 23.089155637632093 23.294346978557503 130-134 28.255061144794986 25.557496660158257 22.782858904531906 23.40458329051485 135-139 28.252353090816584 25.469346222335282 23.413889595522768 22.864411091325362 140-144 28.002238957866883 25.30022389578669 23.605739873804193 23.091797272542237 145-149 27.700276951482206 25.623140834957432 23.638321879167094 23.03826033439327 150-151 28.103896103896105 26.675324675324674 22.454545454545453 22.766233766233764 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 4.0 2 3.0 3 1.0 4 2.0 5 3.0 6 1.0 7 1.0 8 1.5 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.5 15 1.0 16 1.0 17 1.0 18 1.5 19 2.5 20 1.5 21 1.0 22 1.5 23 4.0 24 5.0 25 4.0 26 3.0 27 4.0 28 6.5 29 6.0 30 5.5 31 7.0 32 9.0 33 14.0 34 21.0 35 28.5 36 40.5 37 47.0 38 54.0 39 61.5 40 80.5 41 115.5 42 128.5 43 140.0 44 140.5 45 140.0 46 159.5 47 161.5 48 153.5 49 152.5 50 156.0 51 139.0 52 133.5 53 145.0 54 140.5 55 128.5 56 106.0 57 102.5 58 117.0 59 118.0 60 102.5 61 90.0 62 93.0 63 97.0 64 94.5 65 81.5 66 69.5 67 65.0 68 66.5 69 57.0 70 38.5 71 34.0 72 32.0 73 25.0 74 17.0 75 10.0 76 6.0 77 4.0 78 1.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 1.25 3 2.025 4 1.175 5 1.775 6 1.375 7 0.975 8 0.475 9 0.25 10-14 0.22999999999999998 15-19 0.885 20-24 1.155 25-29 1.015 30-34 1.075 35-39 1.205 40-44 1.0 45-49 1.405 50-54 0.905 55-59 0.9299999999999999 60-64 1.085 65-69 1.925 70-74 0.9199999999999999 75-79 0.97 80-84 0.67 85-89 0.46499999999999997 90-94 0.685 95-99 1.58 100-104 3.125 105-109 2.79 110-114 2.8649999999999998 115-119 2.4250000000000003 120-124 2.44 125-129 2.53 130-134 2.69 135-139 1.725 140-144 1.7399999999999998 145-149 2.5100000000000002 150-151 3.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.17948717948718 95.72500000000001 2 1.358974358974359 2.65 3 0.28205128205128205 0.8250000000000001 4 0.15384615384615385 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02564102564102564 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.7125000000000004 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.9 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0125 118-119 4.775 0.0 0.0 0.0 0.025 120-121 5.1 0.0 0.0 0.0 0.025 122-123 5.3375 0.0 0.0 0.0 0.025 124-125 5.7625 0.0 0.0 0.0 0.025 126-127 6.425 0.0 0.0 0.0 0.025 128-129 6.9 0.0 0.0 0.0 0.025 130-131 7.4125 0.0 0.0 0.0 0.025 132-133 7.8625 0.0 0.0 0.0 0.025 134-135 8.2125 0.0 0.0 0.0 0.025 136-137 8.7 0.0 0.0 0.0 0.025 138-139 9.075 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093870 spots for SRR7473317.sra Written 1093870 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra Read 1093866 spots for SRR7473317.sra Written 1093866 spots for SRR7473317.sra SRR ids: ['SRR7473317.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_469_d6rr SRR7473317.sra spots: 21877324 blocks: [[1, 1093866], [1093867, 2187732], [2187733, 3281598], [3281599, 4375464], [4375465, 5469330], [5469331, 6563196], [6563197, 7657062], [7657063, 8750928], [8750929, 9844794], [9844795, 10938660], [10938661, 12032526], [12032527, 13126392], [13126393, 14220258], [14220259, 15314124], [15314125, 16407990], [16407991, 17501856], [17501857, 18595722], [18595723, 19689588], [19689589, 20783454], [20783455, 21877324]] SRR7473317 file size 7391806 SRR7473317 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473317 SRR7473317_1.fastq SRR7473317_2.fastq Input file: SRR7473317_1.fastq Paired file: SRR7473317_2.fastq trimmed: SRR7473317-trimmed-pair1.fastq, SRR7473317-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:14:42 2024 >> started Sat Dec 7 13:15:09 2024 >> done (27.327s) 21877324 read pairs processed; of these: 51180 ( 0.23%) short read pairs filtered out after trimming by size control 114254 ( 0.52%) empty read pairs filtered out after trimming by size control 21711890 (99.24%) read pairs available; of these: 12386934 (57.05%) trimmed read pairs available after processing 9324956 (42.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 24 0.00% 20 39 0.00% 21 20 0.00% 22 36 0.00% 23 21 0.00% 24 33 0.00% 25 35 0.00% 26 34 0.00% 27 39 0.00% 28 49 0.00% 29 57 0.00% 30 49 0.00% 31 60 0.00% 32 58 0.00% 33 52 0.00% 34 60 0.00% 35 71 0.00% 36 75 0.00% 37 92 0.00% 38 109 0.00% 39 113 0.00% 40 133 0.00% 41 150 0.00% 42 175 0.00% 43 166 0.00% 44 178 0.00% 45 192 0.00% 46 212 0.00% 47 245 0.00% 48 260 0.00% 49 307 0.00% 50 399 0.00% 51 422 0.00% 52 472 0.00% 53 493 0.00% 54 477 0.00% 55 549 0.00% 56 605 0.00% 57 647 0.00% 58 751 0.00% 59 781 0.00% 60 969 0.00% 61 1094 0.01% 62 1259 0.01% 63 1425 0.01% 64 1473 0.01% 65 1706 0.01% 66 1914 0.01% 67 2346 0.01% 68 3218 0.01% 69 6441 0.03% 70 6169 0.03% 71 3892 0.02% 72 3930 0.02% 73 4225 0.02% 74 4599 0.02% 75 4790 0.02% 76 4858 0.02% 77 5325 0.02% 78 5622 0.03% 79 6467 0.03% 80 7349 0.03% 81 8472 0.04% 82 9686 0.04% 83 11298 0.05% 84 13769 0.06% 85 14696 0.07% 86 15138 0.07% 87 15296 0.07% 88 16614 0.08% 89 17004 0.08% 90 18492 0.09% 91 20358 0.09% 92 21745 0.10% 93 24854 0.11% 94 26156 0.12% 95 27562 0.13% 96 27993 0.13% 97 27663 0.13% 98 27278 0.13% 99 28766 0.13% 100 31150 0.14% 101 31278 0.14% 102 34578 0.16% 103 37038 0.17% 104 40054 0.18% 105 41935 0.19% 106 42126 0.19% 107 41951 0.19% 108 42680 0.20% 109 45077 0.21% 110 45703 0.21% 111 45562 0.21% 112 48906 0.23% 113 54218 0.25% 114 54698 0.25% 115 58164 0.27% 116 59480 0.27% 117 58353 0.27% 118 59118 0.27% 119 59027 0.27% 120 62174 0.29% 121 62523 0.29% 122 67076 0.31% 123 70809 0.33% 124 75539 0.35% 125 77234 0.36% 126 78555 0.36% 127 80006 0.37% 128 80351 0.37% 129 82091 0.38% 130 84092 0.39% 131 87373 0.40% 132 92110 0.42% 133 97263 0.45% 134 104765 0.48% 135 110531 0.51% 136 116215 0.54% 137 121812 0.56% 138 127355 0.59% 139 133645 0.62% 140 141536 0.65% 141 153943 0.71% 142 168005 0.77% 143 191060 0.88% 144 219892 1.01% 145 262031 1.21% 146 324756 1.50% 147 432790 1.99% 148 649964 2.99% 149 1243350 5.73% 150 5396321 24.85% 151 9324956 42.95% 21711890 reads passed initial QC criterion=sequence-density sequence-density=1.22 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=18 prefix-density=1.26 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.93 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=11 prefix-density=1.02 prefix-fanout=2.9 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=79.49 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473317 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:15:55 Started mapping on | Dec 07 13:15:55 Finished on | Dec 07 13:20:52 Mapping speed, Million of reads per hour | 263.17 Number of input reads | 21711890 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 19809619 Uniquely mapped reads % | 91.24% Average mapped length | 291.26 Number of splices: Total | 20821597 Number of splices: Annotated (sjdb) | 19637041 Number of splices: GT/AG | 20566930 Number of splices: GC/AG | 225059 Number of splices: AT/AC | 8227 Number of splices: Non-canonical | 21381 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169297 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 18510 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.07% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1757703 1757703 1757703 N_multimapping 169297 169297 169297 N_noFeature 588525 19234614 771767 N_ambiguous 452795 2609 61525 UnstrandedReadsAssigned:18768299 PositiveStrandReadsAssigned:572396 NegativeStrandReadsAssigned:18976327 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473317 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473317-trimmed-pair1.fastq SRR7473317-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,711,890 reads, 19,064,145 reads pseudoaligned [quant] estimated average fragment length: 269.465 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR7473317.ke.tsv 35125 SRR7473317.se.tsv 88098 total ==> SRR7473317.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.372 0 0 PNS24247 1044 775.535 36.5462 3.26894 PNS24249 1928 1659.54 52.602 2.19878 PNS24246 1044 775.535 36.5462 3.26894 PNS24248 1044 775.535 36.5462 3.26894 PNS24244 1471 1202.54 109.759 6.33157 PNS24243 293 96.9436 0 0 KQK14069 1603 1334.54 1534.61 79.7692 KQK14071 474 232.854 92.577 27.5795 ==> SRR7473317.se.tsv <== BRADI_1g14170v3 2200 BRADI_1g53295v3 11 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 2174 BRADI_1g74790v3 370 BRADI_1g09890v3 2 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR7473317 completed mapping pipeline successfully