Starting /dee2/code/volunteer_pipeline.sh SRR7473318 current disk space = 1543256367104 free memory = 1599414624 SRR7473318 SRAfilesize 590f67e15a0e493218febc52defaa12c SRR7473318.sra SRR7473318.sra file validated SRR7473318 is paired end SRR7473318 is conventional basespace SRR7473318 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473318_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24325 34.0 33.0 34.0 33.0 34.0 2 33.357 34.0 34.0 34.0 33.0 34.0 3 33.42675 34.0 34.0 34.0 33.0 34.0 4 33.43375 34.0 34.0 34.0 33.0 34.0 5 33.28975 34.0 34.0 34.0 33.0 34.0 6 36.9755 38.0 37.0 38.0 35.0 38.0 7 37.38475 38.0 38.0 38.0 37.0 38.0 8 37.48275 38.0 38.0 38.0 37.0 38.0 9 37.46925 38.0 38.0 38.0 38.0 38.0 10-14 37.46615 38.0 38.0 38.0 37.2 38.0 15-19 37.4423 38.0 38.0 38.0 37.8 38.0 20-24 37.447700000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.271550000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.20105 38.0 38.0 38.0 37.0 38.0 35-39 37.1428 38.0 38.0 38.0 36.4 38.0 40-44 36.852549999999994 38.0 38.0 38.0 35.4 38.0 45-49 36.80985 38.0 38.0 38.0 35.0 38.0 50-54 36.79685 38.0 38.0 38.0 34.8 38.0 55-59 36.80725 38.0 38.0 38.0 35.0 38.0 60-64 36.64795 38.0 38.0 38.0 34.4 38.0 65-69 36.5918 38.0 38.0 38.0 34.0 38.0 70-74 36.4676 38.0 38.0 38.0 33.8 38.0 75-79 36.449200000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.37775 38.0 38.0 38.0 34.0 38.0 85-89 36.148649999999996 38.0 37.4 38.0 33.2 38.0 90-94 35.819250000000004 38.0 37.0 38.0 32.0 38.0 95-99 35.61845 38.0 36.2 38.0 31.0 38.0 100-104 35.5145 38.0 36.0 38.0 30.6 38.0 105-109 35.1613 38.0 35.8 38.0 28.4 38.0 110-114 34.98524999999999 38.0 35.2 38.0 28.2 38.0 115-119 34.429899999999996 38.0 34.8 38.0 25.0 38.0 120-124 34.077549999999995 38.0 34.4 38.0 23.6 38.0 125-129 33.601749999999996 38.0 34.0 38.0 22.2 38.0 130-134 33.24235 38.0 33.8 38.0 18.6 38.0 135-139 32.5253 37.6 32.8 38.0 14.0 38.0 140-144 31.822850000000006 36.4 32.2 38.0 13.6 38.0 145-149 30.3525 36.0 30.4 38.0 6.4 38.0 150-151 25.495875 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 2.0 14 1.0 15 3.0 16 2.0 17 5.0 18 11.0 19 8.0 20 7.0 21 8.0 22 19.0 23 16.0 24 14.0 25 24.0 26 27.0 27 34.0 28 46.0 29 49.0 30 73.0 31 94.0 32 118.0 33 149.0 34 229.0 35 407.0 36 944.0 37 1704.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.100427888245655 10.395167379813742 11.225773974326705 41.2786307576139 2 25.294855708908408 13.500627352572145 32.82308657465496 28.38143036386449 3 21.349999999999998 18.175 24.525 35.949999999999996 4 26.400000000000002 25.650000000000002 20.9 27.05 5 28.273435536566975 27.9969841668761 22.995727569741142 20.733852726815783 6 23.425 30.225 22.975 23.375 7 16.950000000000003 23.45 39.425 20.175 8 20.4 21.8 28.775000000000002 29.025000000000002 9 20.974999999999998 20.474999999999998 30.925000000000004 27.625 10-14 22.355 25.729999999999997 24.895 27.02 15-19 22.985 24.66 25.615 26.740000000000002 20-24 23.11 24.975 25.424999999999997 26.490000000000002 25-29 23.43 25.06 25.119999999999997 26.39 30-34 23.185 24.654999999999998 25.314999999999998 26.845000000000002 35-39 22.839567913582716 24.874974994999 25.160032006401277 27.125425085017003 40-44 23.360040060090135 24.69203805708563 25.343014521782674 26.604907361041562 45-49 23.644457783113246 24.399759903961584 25.10504201680672 26.850740296118445 50-54 23.74 24.65 25.085 26.525 55-59 23.425 24.305 25.34 26.93 60-64 23.805 23.84 25.255 27.1 65-69 23.369999999999997 24.505 24.86 27.265 70-74 23.64 24.565 24.875 26.919999999999998 75-79 23.56 24.39 24.575 27.474999999999998 80-84 23.974999999999998 24.135 25.045 26.845000000000002 85-89 24.375 24.97 24.45 26.205000000000002 90-94 23.94838193367679 24.42354824188466 24.723653278647525 26.904416545791026 95-99 23.457840977368317 24.27398357700781 24.879831764470257 27.388343681153614 100-104 23.705000000000002 24.845 24.759999999999998 26.69 105-109 23.755000000000003 24.415 24.875 26.955000000000002 110-114 23.974999999999998 25.085 24.265 26.674999999999997 115-119 23.599999999999998 24.610000000000003 25.03 26.76 120-124 23.743310158555495 24.733656779872955 24.443555244335517 27.079477817236032 125-129 24.492862509391436 24.628099173553718 24.818432256448787 26.060606060606062 130-134 24.162186605034417 24.42847811887655 24.8053057328041 26.60402954328493 135-139 24.31943746860874 24.841788046207935 24.334505273731793 26.504269211451533 140-144 24.768483756319768 24.272913850928568 24.603293787856035 26.355308604895626 145-149 24.751431153962038 24.66606407552476 24.354725318871147 26.227779451642057 150-151 24.15141955835962 23.886435331230285 24.618296529968454 27.343848580441644 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.5 26 2.5 27 3.0 28 2.5 29 4.5 30 9.5 31 12.5 32 16.0 33 23.0 34 25.0 35 25.0 36 39.0 37 55.5 38 69.5 39 84.5 40 109.0 41 132.5 42 153.5 43 170.0 44 166.5 45 172.0 46 179.5 47 166.0 48 141.5 49 141.5 50 146.0 51 143.5 52 147.0 53 154.5 54 152.0 55 137.0 56 121.0 57 117.0 58 107.0 59 90.0 60 89.5 61 82.5 62 72.5 63 62.0 64 51.0 65 56.0 66 57.0 67 43.5 68 46.0 69 44.0 70 36.5 71 33.5 72 29.0 73 22.5 74 16.0 75 14.0 76 9.0 77 5.0 78 3.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.375 3 0.0 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.15 45-49 0.04 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.034999999999999996 95-99 0.13999999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.17500000000000002 130-134 0.485 135-139 0.44999999999999996 140-144 0.11499999999999999 145-149 0.43 150-151 0.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.01903781836893 95.25 2 1.3377926421404682 2.6 3 0.41162850527399025 1.2 4 0.20581425263699513 0.8 5 0.0 0.0 6 0.02572678157962439 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.5249999999999999 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.112500000000001 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473318 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473318_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.15825 33.0 33.0 34.0 32.0 34.0 2 32.428 33.0 33.0 34.0 32.0 34.0 3 32.37125 34.0 33.0 34.0 32.0 34.0 4 32.394 34.0 33.0 34.0 32.0 34.0 5 32.31 34.0 33.0 34.0 32.0 34.0 6 36.37925 38.0 38.0 38.0 35.0 38.0 7 36.767 38.0 38.0 38.0 36.0 38.0 8 36.858 38.0 38.0 38.0 36.0 38.0 9 36.84575 38.0 38.0 38.0 36.0 38.0 10-14 36.906600000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.7093 38.0 38.0 38.0 35.8 38.0 20-24 36.354749999999996 38.0 38.0 38.0 35.0 38.0 25-29 36.58305 38.0 38.0 38.0 35.6 38.0 30-34 36.66315 38.0 38.0 38.0 36.0 38.0 35-39 36.70265 38.0 38.0 38.0 36.0 38.0 40-44 36.65025 38.0 38.0 38.0 35.8 38.0 45-49 36.471900000000005 38.0 38.0 38.0 35.4 38.0 50-54 36.569100000000006 38.0 38.0 38.0 35.2 38.0 55-59 36.49095 38.0 38.0 38.0 35.0 38.0 60-64 36.3338 38.0 38.0 38.0 34.8 38.0 65-69 36.05500000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.15545 38.0 38.0 38.0 34.0 38.0 75-79 36.024350000000005 38.0 38.0 38.0 33.4 38.0 80-84 36.0918 38.0 38.0 38.0 33.8 38.0 85-89 35.90505 38.0 38.0 38.0 33.0 38.0 90-94 35.721500000000006 38.0 38.0 38.0 32.8 38.0 95-99 35.1605 38.0 37.6 38.0 30.0 38.0 100-104 34.482749999999996 38.0 36.0 38.0 25.4 38.0 105-109 34.536449999999995 38.0 36.2 38.0 26.2 38.0 110-114 34.178450000000005 38.0 35.8 38.0 23.4 38.0 115-119 33.77165 38.0 35.0 38.0 20.2 38.0 120-124 33.6864 38.0 35.0 38.0 21.0 38.0 125-129 33.2057 38.0 34.4 38.0 14.6 38.0 130-134 32.6894 38.0 33.4 38.0 13.4 38.0 135-139 32.23864999999999 38.0 32.8 38.0 13.0 38.0 140-144 31.5183 38.0 31.2 38.0 10.0 38.0 145-149 30.049 37.4 29.0 38.0 2.0 38.0 150-151 24.024250000000002 31.5 11.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 8.0 4 10.0 5 1.0 6 1.0 7 3.0 8 1.0 9 1.0 10 4.0 11 4.0 12 5.0 13 7.0 14 8.0 15 11.0 16 18.0 17 4.0 18 13.0 19 16.0 20 18.0 21 22.0 22 17.0 23 16.0 24 45.0 25 18.0 26 33.0 27 16.0 28 36.0 29 49.0 30 60.0 31 78.0 32 100.0 33 125.0 34 172.0 35 321.0 36 690.0 37 2050.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.55149501661129 15.946843853820598 15.997955532839253 33.50370559672885 2 32.055837563451774 20.482233502538072 26.21827411167513 21.243654822335024 3 25.30581039755352 24.20998980632008 26.656472986748213 23.827726809378184 4 28.248730964467008 28.62944162436548 19.34010152284264 23.78172588832487 5 29.21978582355941 32.17746047934727 18.230494645588983 20.372259051504336 6 24.605597964376592 34.35114503816794 18.702290076335878 22.34096692111959 7 22.39858906525573 18.316956412194507 34.794658604182416 24.489795918367346 8 24.654435787886403 22.392560944961044 23.096255340537823 29.85674792661473 9 24.661992989484226 23.209814722083124 26.064096144216325 26.064096144216325 10-14 26.74651698907487 25.393404831111553 22.371454344993484 25.488623834820086 15-19 26.776809550193924 25.35636931446129 23.281116204100137 24.58570493124465 20-24 27.204388459975622 24.928890694839495 23.125761885412434 24.74095895977245 25-29 26.320306977683533 25.850752297283652 23.058669090174693 24.770271634858123 30-34 26.410812446416866 25.760250138685763 23.152957789096778 24.675979625800597 35-39 27.183290449523234 25.02396448211493 23.4044700065587 24.38827506180314 40-44 27.57629255989912 24.701134930643125 23.273644388398488 24.448928121059268 45-49 27.171931956257595 25.15188335358445 23.673552045362495 24.00263264479546 50-54 26.95406929895246 24.617244157937147 23.83662369057212 24.592062852538277 55-59 27.04814721451979 25.187799344592893 23.735820519284093 24.028232921603227 60-64 26.593273406726592 24.886375113624887 23.886476113523887 24.633875366124634 65-69 27.56113681427627 24.566576846814787 23.59042147541817 24.281864863490775 70-74 27.425862416784348 24.39479523905588 23.66350615291507 24.515836191244706 75-79 26.450279723804243 24.489693059825612 24.771936898341817 24.288090318028324 80-84 27.45709828393136 24.060188213980172 23.8286950832872 24.654018418801268 85-89 27.55640420079393 24.948495050499975 23.456107733279737 24.03899301542636 90-94 27.368102491677593 24.74528397054373 23.20690003026329 24.679713507515384 95-99 27.177291953320083 25.07771492636192 23.497936095398256 24.247057024919737 100-104 27.97469005607284 24.605175163331445 23.31910077678893 24.101034003806777 105-109 27.40078141065186 25.241620398930703 23.061895949002672 24.295702241414766 110-114 28.051787916152897 25.17468146321414 23.76695437731196 23.006576243321003 115-119 27.594702802587 25.44399958936454 22.83646442870342 24.124833179345035 120-124 27.965363529230924 25.203668596608086 23.27714300353538 23.553824870625608 125-129 27.85824345146379 25.63944530046225 22.95839753466872 23.54391371340524 130-134 27.88071652209619 25.81737925370836 22.742904070215058 23.559000153980396 135-139 27.827812547702642 25.110670126698214 23.904747366814227 23.156769958784917 140-144 27.63064072527249 25.583172048487317 23.576449017011306 23.209738209228888 145-149 28.08334610081201 25.550278331035187 23.195955262754712 23.17042030539809 150-151 28.13431868274342 26.02100350058343 22.818617917801117 23.026059898872035 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 4.5 2 4.0 3 2.5 4 3.0 5 3.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 1.0 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 0.5 20 2.5 21 3.0 22 2.5 23 5.0 24 4.0 25 2.0 26 3.0 27 3.5 28 6.0 29 7.5 30 8.5 31 9.0 32 10.5 33 15.5 34 19.5 35 26.0 36 32.5 37 39.0 38 50.0 39 60.5 40 87.5 41 115.5 42 122.0 43 132.5 44 145.5 45 171.5 46 170.5 47 156.5 48 168.5 49 164.0 50 145.0 51 138.5 52 134.5 53 134.0 54 142.0 55 152.5 56 139.0 57 112.5 58 110.0 59 111.0 60 102.5 61 94.0 62 103.0 63 88.0 64 69.5 65 66.5 66 60.0 67 50.0 68 48.0 69 53.5 70 38.5 71 33.0 72 33.5 73 20.0 74 13.5 75 11.5 76 8.0 77 6.0 78 4.0 79 2.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 1.5 3 1.9 4 1.5 5 1.95 6 1.7500000000000002 7 0.775 8 0.525 9 0.15 10-14 0.22999999999999998 15-19 0.735 20-24 1.5599999999999998 25-29 0.97 30-34 0.855 35-39 0.895 40-44 0.8750000000000001 45-49 1.24 50-54 0.72 55-59 0.8250000000000001 60-64 0.9900000000000001 65-69 1.6549999999999998 70-74 0.86 75-79 0.795 80-84 0.645 85-89 0.49500000000000005 90-94 0.8699999999999999 95-99 1.8849999999999998 100-104 2.8049999999999997 105-109 2.74 110-114 2.68 115-119 2.59 120-124 2.415 125-129 2.65 130-134 2.585 135-139 1.735 140-144 1.83 145-149 2.095 150-151 3.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.61781460383222 94.25 2 1.7348524080787155 3.35 3 0.33661315380631796 0.975 4 0.18125323666494045 0.7000000000000001 5 0.05178663904712584 0.25 6 0.05178663904712584 0.3 7 0.02589331952356292 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 7 0.17500000000000002 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 5 0.125 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 5.050000000000001 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCATT 10 0.006901744 144.5 8 TCCATTT 10 0.006901744 144.5 9 CAAGTCC 35 0.0033580794 61.92857 4 >>END_MODULE Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra Read 991122 spots for SRR7473318.sra Written 991122 spots for SRR7473318.sra Read 991103 spots for SRR7473318.sra Written 991103 spots for SRR7473318.sra SRR ids: ['SRR7473318.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ny2tpvq1 SRR7473318.sra spots: 19822079 blocks: [[1, 991103], [991104, 1982206], [1982207, 2973309], [2973310, 3964412], [3964413, 4955515], [4955516, 5946618], [5946619, 6937721], [6937722, 7928824], [7928825, 8919927], [8919928, 9911030], [9911031, 10902133], [10902134, 11893236], [11893237, 12884339], [12884340, 13875442], [13875443, 14866545], [14866546, 15857648], [15857649, 16848751], [16848752, 17839854], [17839855, 18830957], [18830958, 19822079]] SRR7473318 file size 6695351 SRR7473318 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473318 SRR7473318_1.fastq SRR7473318_2.fastq Input file: SRR7473318_1.fastq Paired file: SRR7473318_2.fastq trimmed: SRR7473318-trimmed-pair1.fastq, SRR7473318-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:15:03 2024 >> started Sat Dec 7 13:15:25 2024 >> done (21.590s) 19822079 read pairs processed; of these: 32478 ( 0.16%) short read pairs filtered out after trimming by size control 75904 ( 0.38%) empty read pairs filtered out after trimming by size control 19713697 (99.45%) read pairs available; of these: 11593391 (58.81%) trimmed read pairs available after processing 8120306 (41.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 17 0.00% 20 11 0.00% 21 10 0.00% 22 17 0.00% 23 23 0.00% 24 17 0.00% 25 19 0.00% 26 15 0.00% 27 20 0.00% 28 30 0.00% 29 36 0.00% 30 33 0.00% 31 35 0.00% 32 28 0.00% 33 31 0.00% 34 37 0.00% 35 49 0.00% 36 38 0.00% 37 38 0.00% 38 48 0.00% 39 55 0.00% 40 60 0.00% 41 80 0.00% 42 78 0.00% 43 73 0.00% 44 96 0.00% 45 105 0.00% 46 110 0.00% 47 137 0.00% 48 153 0.00% 49 156 0.00% 50 202 0.00% 51 204 0.00% 52 233 0.00% 53 238 0.00% 54 267 0.00% 55 278 0.00% 56 340 0.00% 57 373 0.00% 58 417 0.00% 59 446 0.00% 60 506 0.00% 61 581 0.00% 62 623 0.00% 63 711 0.00% 64 772 0.00% 65 933 0.00% 66 1094 0.01% 67 1305 0.01% 68 1975 0.01% 69 4213 0.02% 70 4445 0.02% 71 2440 0.01% 72 2064 0.01% 73 2164 0.01% 74 2202 0.01% 75 2497 0.01% 76 2676 0.01% 77 2903 0.01% 78 3348 0.02% 79 3736 0.02% 80 4078 0.02% 81 4398 0.02% 82 4966 0.03% 83 5829 0.03% 84 7794 0.04% 85 8500 0.04% 86 9009 0.05% 87 9706 0.05% 88 10529 0.05% 89 11067 0.06% 90 11423 0.06% 91 12405 0.06% 92 12669 0.06% 93 14355 0.07% 94 15230 0.08% 95 17055 0.09% 96 17760 0.09% 97 18557 0.09% 98 19015 0.10% 99 20235 0.10% 100 21478 0.11% 101 21045 0.11% 102 22500 0.11% 103 23240 0.12% 104 24916 0.13% 105 26947 0.14% 106 28150 0.14% 107 28477 0.14% 108 30040 0.15% 109 33164 0.17% 110 34923 0.18% 111 33851 0.17% 112 34786 0.18% 113 38472 0.20% 114 38390 0.19% 115 40992 0.21% 116 42768 0.22% 117 43465 0.22% 118 45451 0.23% 119 46827 0.24% 120 48927 0.25% 121 50363 0.26% 122 52916 0.27% 123 54688 0.28% 124 57504 0.29% 125 58572 0.30% 126 60680 0.31% 127 63755 0.32% 128 66016 0.33% 129 69142 0.35% 130 73160 0.37% 131 75467 0.38% 132 79699 0.40% 133 83565 0.42% 134 88391 0.45% 135 92961 0.47% 136 98384 0.50% 137 106282 0.54% 138 113570 0.58% 139 122650 0.62% 140 132911 0.67% 141 148520 0.75% 142 163820 0.83% 143 185075 0.94% 144 217265 1.10% 145 259943 1.32% 146 329041 1.67% 147 447577 2.27% 148 677083 3.43% 149 1315594 6.67% 150 5259559 26.68% 151 8120306 41.19% 19713697 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=19 prefix-density=0.98 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=103.82 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=13.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=21 prefix-density=0.99 prefix-fanout=2.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=23.12 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.3 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7473318 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:16:12 Started mapping on | Dec 07 13:16:12 Finished on | Dec 07 13:21:52 Mapping speed, Million of reads per hour | 208.73 Number of input reads | 19713697 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17412836 Uniquely mapped reads % | 88.33% Average mapped length | 293.00 Number of splices: Total | 17792220 Number of splices: Annotated (sjdb) | 16728084 Number of splices: GT/AG | 17576139 Number of splices: GC/AG | 192938 Number of splices: AT/AC | 6181 Number of splices: Non-canonical | 16962 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 152500 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 15651 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.88% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2165729 2165729 2165729 N_multimapping 152500 152500 152500 N_noFeature 597226 16813092 843264 N_ambiguous 409943 2334 56716 UnstrandedReadsAssigned:16405667 PositiveStrandReadsAssigned:597410 NegativeStrandReadsAssigned:16512856 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473318 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473318-trimmed-pair1.fastq SRR7473318-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,713,697 reads, 16,590,506 reads pseudoaligned [quant] estimated average fragment length: 275.624 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52973 SRR7473318.ke.tsv 35125 SRR7473318.se.tsv 88098 total ==> SRR7473318.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.18 0 0 PNS24247 1044 769.376 53.2477 5.25323 PNS24249 1928 1653.38 67.228 3.08633 PNS24246 1044 769.376 53.2477 5.25323 PNS24248 1044 769.376 53.2477 5.25323 PNS24244 1471 1196.38 156.029 9.89925 PNS24243 293 89.497 0 0 KQK14069 1603 1328.38 20764.1 1186.47 KQK14071 474 224.293 333.477 112.853 ==> SRR7473318.se.tsv <== BRADI_1g14170v3 23621 BRADI_1g53295v3 5 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 746 BRADI_1g74790v3 572 BRADI_1g09890v3 5 BRADI_1g77505v3 115 BRADI_1g48960v3 0 SRR7473318 completed mapping pipeline successfully